Erk activation drives intestinal tumorigenesis in Apc min/+ mice
|
|
- Donald Rich
- 5 years ago
- Views:
Transcription
1 correction notice Nat. Med. 16, (2010) Erk activation drives intestinal tumorigenesis in Apc min/+ mice Sung Hee Lee, Li-Li Hu, Jose Gonzalez-Navajas, Geom Seog Seo, Carol Shen, Jonathan Brick, Scott Herdman, Nissi Varki, Maripat Corr, Jongdae Lee & Eyal Raz In the version of this supplementary file originally posted online, the key in Supplementary Figure 1a was incorrect. The error has been corrected in this file as of 6 October 2010.
2 Supplementary Figure 1 Genetic deletion of Myd88 prevents mortality of Apc min/+ mice. A. Survival curves of Apc min/+ /Lps2 and Apc min/+ /Myd88 -/- mice compared with the Apc min/+ mice. P < for Apc min/+ /Myd88 -/- vs. Apc min/+ mice (Apc min/+ /Lps2 vs. Apc min/+ mice, P=0.0695, by log-rank analysis), n > 25 in each group. B. The number of polyps in Apc min/+ /Myd88 -/- mice is significantly reduced. The small intestine was divided to three equal parts, proximal, middle and distal, and polyps 3 mm in diameter were counted in 20 week old mice; P=0.0005, P=0.004 and P= by ANOVA. n=7 in each group. C. The polyps in Apc min/+ /Myd88 -/- mice are much smaller than those in Apc min/+ mice. H&E-stained sections of intestinal tumors from 20-week old APC min/+ and Apc min/+ /Myd88 -/- mice. These histological patterns represent the polyps in the distal small intestine (DSI) and the colon in Apc min/+ and Apc min/+ /Myd88 -/- mice, respectively. Scale bars, 20 m (DSI, magnification 100) or 50 m (Colon, magnification 40). The polyps observed in Apc min/+ /Lps2 were indistinguishable from those observed in Apc min/+ mice (data not shown). D. Genetic deletion of Myd88 in Apc min/+ mice significantly lowers polyp incidence in the colon. Grossly visible polyps were counted in this analysis (n=7 in each group). Each of these tumors is 3 mm in diameter. ( P=0.002, ANOVA). Mean ±s.d. E. The total number of adenomas in Apc min/+ /Myd88 -/- mice is lower than that in Apc min/+ mice. The number of adenomas (micro plus macroadenomas) in H&E sections of 4 different mice was counted with microscope. F. A representative H&E staining of distal small intestines (Swiss role) demonstrating a decrease in the number of micro- and macro-adenomas in Apc min/+ /Myd88 -/- mice. 1
3 Supplementary Fig. 1 A 1
4 B 2
5 3
6 E F Apc min/+ Apc min/+ /Myd88 -/- 4
7 Supplementary Figure 2A Validation of commercial antibodies for c-myc RKO cells were transfected with either a control or c-myc sirna, and the total cell lysates were subjected to IB with the indicated antibodies. RKO cells were transfected with the indicated c-myc constructs, and the total cell lysates were subjected to IB with the indicated antibodies. The plasmids encoding flagc-myc WT and the mutants (S62A and T58A) were obtained from Dr. K. Nakayama (Kyushu University, Kyushu Japan). 5
8 Supplemental. Figure 2B The level of c-myc is decreased in Apc min/+ /Myd88 -/- IEC harvested from normal and tumor region. To address whether c-myc levels in Apc min/+ /Myd88 -/- IEC is decreased, the c-myc level in isolated IEC from Apc min/+ and Apc min/+ /Myd88 -/- was measured by flow cytometry. The data below indicate that c-myc level in Apc min/+ /Myd88 -/- IEC is reduced in the whole IEC population. Anti-claudin-5- Alexa fluor 488 antibody (an IEC marker) was obtained from Invitrogen (Carlsbad, CA). 6
9 Supplementary Figure 3A RKO cells express TLR2 and TLR9. RKO cells were harvested by using cell dissociation buffer (GIBCO) and resuspended in 1ml of DMEM at a concentration of 10 6 cells/ml. Cells were then fixed by adding 100µL of 16% PFA (for a final concentration of 1.5%) and incubated 10 min at RT. Following fixation, cells were centrifuged and resuspended in 1ml of ice-cold 100% methanol to permeabilize them (20 min at 4 o C), washed twice with 3 ml of FACS buffer (PBS/0.5%BSA/0.05%NaN 3 ) and stained in 100µL of FACS buffer for 30 min at 4 o C using the antibodies indicated and the appropriate isotype controls. The antibodies were purchased from Imgenex (San Diego, CA). Supplementary Figure 3B TLR2 activation enhances c-myc via Myd88. RKO cells were transfected with a control or MyD88 sirna, and the transfected cells were stimulated with P3C, 2 days post-transfection. Protein levels were measured by IB. Supplementary Figure 3C TLR5 activation enhances c-myc in IEC. RKO cells were stimulated with flagellin as indicated. Protein levels were measured by IB. 7
10 Supplementary Figure 3 A 8
11 9
12 Supplementary Figure 4A TLR2 activation enhances c-myc expression and induces ERK phosphorylation in Caco-2 cells. Caco-2 cells were stimulated with P3C as indicated and the protein levels were measured by IB (the upper panel). The indicated mrna levels were measured by qrt-pcr (the lower panel). Supplementary Figure 4B TLR2 activation in Caco-2 cells suppresses ubiquitination of c-myc. Caco-2 cells were stimulated with P3C as indicated, and c- myc was immunoprecipitated and immunoblotted with anti-ubiquitin antibodies. Supplementary Figure 4C TLR2 or EGFR activation in RIE-1 cells induces ERK phosphorylation and c-myc. Cells from the non-transformed rat intestinal cell line, RIE-1, were stimulated with P3C or EGF as indicated, and the protein levels were measured by IB. 10
13 11
14 C 12
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently
More informationSarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationSupplementary Information
Supplementary Information Supplementary Figure 1: Over-expression of CD300f in NIH3T3 cells enhances their capacity to phagocytize AC. (a) NIH3T3 cells were stably transduced by EV, CD300f WT or CD300f
More informationAt E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationSupplementary Materials
Supplementary Materials Supplementary Figure 1. PKM2 interacts with MLC2 in cytokinesis. a, U87, U87/EGFRvIII, and HeLa cells in cytokinesis were immunostained with DAPI and an anti-pkm2 antibody. Thirty
More informationSupplementary methods
Supplementary methods Cell culture, infection, transfection, and RNA interference HEK293 cells and its derivatives were grown in DMEM supplemented with 10% FBS. Various constructs were introduced into
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationSupplementary methods Shoc2 In Vitro Ubiquitination Assay
Supplementary methods Shoc2 In Vitro Ubiquitination Assay 35 S-labelled Shoc2 was prepared using a TNT quick Coupled transcription/ translation System (Promega) as recommended by manufacturer. For the
More informationSupplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1
Legends Supplementary Figure 1. GST pull-down analysis of the interaction of GST- (A, B), GST mutants (B) or GST- (C) with indicated proteins. A, B, Cell lysate from untransfected HeLa cells were loaded
More informationFigure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse
Figure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse stabilin-1, or mouse stabilin-2 were immunoblotted using anti
More informationSupplementary Figure S1. N-terminal fragments of LRRK1 bind to Grb2.
Myc- HA-Grb2 Mr(K) 105 IP HA 75 25 105 1-1163 1-595 - + - + - + 1164-1989 Blot Myc HA total lysate 75 25 Myc HA Supplementary Figure S1. N-terminal fragments of bind to Grb2. COS7 cells were cotransfected
More informationSupplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated
Supplementary Figure Legends Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated with either vehicle (left; n=3) or CCl 4 (right; n=3) were co-immunostained for NRP-1 (green)
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationSupplemental Information
Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai
More informationSupplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More informationSupplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells.
Supplementary Fig. 1 Supplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells. (a) FRTL-5 cells were treated with 1 mm dibutyryl camp for 24 h, and the lysates
More informationSupplemental Figure 1
Supplemental Figure 1 A IL-12p7 (pg/ml) 7 6 4 3 2 1 Medium then TLR ligands MDP then TLR ligands Medium then TLR ligands + MDP MDP then TLR ligands + MDP B IL-12p4 (ng/ml) 1.2 1..8.6.4.2. Medium MDP Medium
More informationSupplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide,
Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, conjugated with either TAT or Myristic acid and biotin for
More informationSupplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2
Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 female) or wild-type (5 months old, 1 male; 11 months old,
More informationSupplemental Materials and Methods
Supplemental Materials and Methods In situ hybridization In situ hybridization analysis of HFE2 and genin mrna in rat liver tissues was performed as previously described (1). Briefly, the digoxigenin-labeled
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3363 Supplementary Figure 1 Several WNTs bind to the extracellular domains of PKD1. (a) HEK293T cells were co-transfected with indicated plasmids. Flag-tagged proteins were immunoprecipiated
More informationThis is the author's accepted version of the manuscript.
This is the author's accepted version of the manuscript. The definitive version is published in Nature Communications Online Edition: 2015/4/16 (Japan time), doi:10.1038/ncomms7780. The final version published
More informationmonoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in
Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal
More informationSupplementary Information. HBx-upregulated lncrna UCA1 promotes cell growth and tumorigenesis
Supplementary Information HBx-upregulated lncrna UCA1 promotes cell growth and tumorigenesis by recruiting EZH2 and repressing p27kip1/cdk2 signaling Jiao-Jiao Hu 1, Wei Song 1, Shao-Dan Zhang 1, Xiao-Hui
More informationSupplementary Methods
Supplementary Methods Mice injections. C57BL/6 female mice 6-10 weeks of age were purchased from the Jackson Laboratory. Soluble rapamycin (Sigma) was diluted in PBS and administered i.p. to mice at 1.5
More informationTranscriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3
ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3206 Supplementary Figure 1 Autophagy-related gene expression in murine and human intestinal tumors. (a) Representative LC3 immunostaining in colonic adenoma and adjacent non tumoral tissue
More informationSupplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the
Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the prey clones identified in the yeast two hybrid screen.
More informationSupplementary Information
Supplementary Information Mutual reinforcement of inflammation and carcinogenesis by the Helicobacter pylori CagA oncoprotein Nobumi Suzuki, Naoko Murata-Kamiya, Kohei Yanagiya, Wataru Suda, Masahira Hattori,
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rainero et al., http://www.jcb.org/cgi/content/full/jcb.201109112/dc1 Figure S1. The expression of DGK- is reduced upon transfection
More informationOnline Supporting Material for. The Bisecting GlcNAc on N-Glycans Inhibits Growth. Factor Signaling and Retards Mammary Tumor
Online Supporting Material for The Bisecting GlcNAc on N-Glycans Inhibits Growth Factor Signaling and Retards Mammary Tumor Progression Yinghui Song 1, Jason A. Aglipay 1, Joshua D. Bernstein 2, Sumanta
More informationtranscription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,
Supplementary Data Supplementary Figure Legends Supplementary Figure 1 FHL-mediated TGFβ-responsive reporter transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected
More informationFlag-Rac Vector V12 V12 N17 C40. Vector C40 pakt (T308) Akt1. Myc-DN-PAK1 (N-SP)
a b FlagRac FlagRac V2 V2 N7 C4 V2 V2 N7 C4 p (T38) p (S99, S24) p Flag (Rac) NIH 3T3 COS c +Serum p (T38) MycDN (NSP) Mycp27 3 6 2 3 6 2 3 6 2 min p Myc ( or p27) Figure S (a) Effects of Rac mutants on
More informationIntestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by. Regulating Occludin
Intestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by Regulating Occludin Chaithanya Chelakkot 1,ǂ, Jaewang Ghim 2,3,ǂ, Nirmal Rajasekaran 4, Jong-Sun Choi 5, Jung-Hwan
More informationNature Immunology: doi: /ni.3015
Supplementary Figure 1 Role of RIP1-RIP3 and PGAM5 in RNA virus induced inflammasome activation. (a) LDH release from LPS-primed BMDMs from wild-type mice (WT), Rip3 -/- or Nlrp3 -/- mice infected with
More informationHigh throughput screening: Huh-7 cells were seeded into 96-well plate (2000
1 SUPPLEMENTARY INFORMATION METHODS 6 7 8 9 1 11 1 1 1 1 16 17 18 19 High throughput screening: Huh-7 cells were seeded into 96-well plate ( cells/well) and infected with MOI of DENV-. One hour post-infection
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationAnti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR
Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt
More informationTRIM31 is recruited to mitochondria after infection with SeV.
Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker
More informationSupplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.
Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of
More informationSupporting Information
Supporting Information He et al. 10.1073/pnas.1116302108 SI Methods Cell Culture. Mouse J774A.1 and RAW 264.7 macrophages were obtained from ATCC and were cultured in MEM supplemented with 10% FS (Sigma)
More informationGene Sequence Fragment size ΔEGFR F 5' GGGCTCTGGAGGAAAAGAAAG GT 3' 116 bp R 5' CTTCTTACACTTGCGGACGC 3'
Supplementary Table 1: Real-time PCR primer sequences for ΔEGFR, wtegfr, IL-6, LIF and GAPDH. Gene Sequence Fragment size ΔEGFR F 5' GGGCTCTGGAGGAAAAGAAAG GT 3' 116 bp R 5' CTTCTTACACTTGCGGACGC 3' wtegfr
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2743 Figure S1 stabilizes cellular protein level, post-transcriptionally. (a, b) and DDR1 were RNAi-depleted from HEK.293.-CBG cells. Western blots with indicated antibodies (a). RT-PCRs
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3562 In the format provided by the authors and unedited. Supplementary Figure 1 Glucose deficiency induced FH-ATF2 interaction. In b-m, immunoblotting or immunoprecipitation analyses were
More informationSupplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated
Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated reporter luciferase constructs, HEK293T cells were stimulated
More informationSupplementary Figure 1 a
3 min PMA 45 min PMA AnnexinV-FITC Supplementary Figure 1 5 min PMA 15 min PMA a 9 min PMA 12 min PMA 5 min FGF7 15 min FGF7 3 min FGF7 6 min FGF7 9 min FGF7 12 min FGF7 5 min control 3 min control 6 min
More informationSupplementary Material
Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated
More informationRegulation of hepcidin expression by inflammation-induced activin B
Regulation of hepcidin expression by inflammation-induced activin B Yohei Kanamori, Makoto Sugiyama, Osamu Hashimoto, Masaru Murakami, Tohru Matsui and Masayuki Funaba Supplemental methods Liver cell separation
More informationCytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of
Supplementary Information Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Syntaxin 1 and SNAP-25 in Neuron Survival Lisheng Peng, Huisheng Liu, Hongyu Ruan, William H. Tepp, William H. Stoothoff,
More informationSupplementary Figure Legend
Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss
More informationA human immunodeficiency caused by mutations in the PIK3R1 gene. Whole exome sequencing. Whole exome sequencing libraries were prepared from 3
A human immunodeficiency caused by mutations in the PIK3R1 gene. Supplementary Methods Whole exome sequencing. Whole exome sequencing libraries were prepared from 3 µg of genomic DNA extracted from total
More informationSupplementary Information (Aoki, K. et al., "Chromosomal instability by β-catenin/tcf transcription in APC or β-catenin mutant cells")
Supplementary Information (Aoki, K. et al., "Chromosomal instability by β-catenin/tcf transcription in APC or β-catenin mutant cells") Supplementary materials and methods ES cells and Mice The floxed β-catenin
More informationAnti-HB-EGF (Human) mab
Page 1 For Research Use Only. Not for use in diagnostic procedures. CODE No. D308-3 Anti-HB-EGF (Human) mab CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 3H4 Mouse IgG1
More informationThis Document Contains:
This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular
More informationSupplementary Figure. S1
Supplementary Figure. S1 Supplementary Figure S1. Correlation of phagocytic ability measured with YG and YO beads. Fresh human monocytes (2 10 6 /ml) were labelled with APC conjugated anti CD14 mab alone
More informationStargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression
Supplementary Information Stargazin regulates AMPA receptor trafficking through adaptor protein complexes during long term depression Shinji Matsuda, Wataru Kakegawa, Timotheus Budisantoso, Toshihiro Nomura,
More informationB. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.
A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200
More informationReplication-independent chromatin loading of Dnmt1 during G2 and M phases
Replication-independent chromatin loading of Dnmt1 during G2 and M phases Hariharan P. Easwaran 1, Lothar Schermelleh 2, Heinrich Leonhardt 1,2,* and M. Cristina Cardoso 1,* 1 Max Delbrück Center for Molecular
More information(a) Immunoblotting to show the migration position of Flag-tagged MAVS
Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing
More informationSupplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions.
Supplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions. 1 (a) Etoposide treatment gradually changes acetylation level and co-chaperone
More informationSupplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total
Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total ERK in the aortic tissue from the saline- or AngII-infused
More informationCell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
More information* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm)
I: p-p9rsk I: p9rsk I: C I: p-p9rsk I: p9rsk 5 (ka) 5 5 (min) Ang II ( nm) p-p9rsk (Ser8) p9rsk p-p9rsk (Ser8) p9rsk (h) Mannitol 5 mm -Glucose 5 mm p9rsk (Ser8) (arbitrary units) p-p9rsk (Ser8) (arbitrary
More informationNature Medicine doi: /nm.2558
Supplementary. Fig. 1. (a) Sirt1 and mutant HTT (detected by HTT 81-90 antibody) protein levels were detected by Western blotting in cerebral cortex of N171-82Q mice. (b) Sirt1 and mutant HTT (detected
More informationSupplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence
1 5 6 7 8 9 10 11 1 1 1 Supplementary Figure 1. Characterization of the POP transcriptional and post-transcriptional regulatory elements. (A) POP nucleotide sequence depicting the consensus sequence for
More informationSupplementary Figure Legends
Supplementary Figure Legends Figure S1 gene targeting strategy for disruption of chicken gene, related to Figure 1 (f)-(i). (a) The locus and the targeting constructs showing HpaI restriction sites. The
More informationSupplemental Data Supplementary Figure Legends and Scheme Figure S1.
Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,
More informationisolated from ctr and pictreated mice. Activation of effector CD4 +
Supplementary Figure 1 Bystander inflammation conditioned T reg cells have normal functional suppressive activity and ex vivo phenotype. WT Balb/c mice were treated with polyi:c (pic) or PBS (ctr) via
More informationTranscriptional regulation of IFN-l genes in Hepatitis C virus-infected hepatocytes via IRF-3 IRF-7 NF- B complex
POSTER PRESENTATION Transcriptional regulation of IFN-l genes in Hepatitis C virus-infected hepatocytes via IRF-3 IRF-7 NF- B complex Hai-Chon Lee *, Je-In Youn, Kyungwha Lee, Hwanyul Yong, Seung-Yong
More informationJCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Kimura et al.,
Supplemental material JCB Kimura et al., http://www.jcb.org/cgi/content/full/jcb.201503023/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. TRIMs regulate IFN-γ induced autophagy. (A and B) HC image analysis
More informationsupplementary information
DOI: 10.1038/ncb2116 Figure S1 CDK phosphorylation of EZH2 in cells. (a) Comparison of candidate CDK phosphorylation sites on EZH2 with known CDK substrates by multiple sequence alignments. (b) CDK1 and
More informationSupplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.
Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length
More informationSupplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after
Supplementary Information: Materials and Methods Recombinant protein expression and in vitro kinase assay. GST and GST-p53 were purified according to standard protocol after induction with.5mm IPTG for
More informationRevision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines
Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines Further information can be found at: http://stke.sciencemag.org/sites/default/files/researcharticlerevmsinstructions_0.pdf.
More informationSupplementary Materials
Supplementary Materials Figure S1. Anti-pY128 Cas antibody is specific. HEK293 cells were transfected with Flagtagged WT or Y128F mutant p130 Cas plasmid. Cell lysates were immunoprecipitated with anti-
More informationSupplementary Figure 1
Supplementary Figure 1 Virus infection induces RNF128 expression. (a,b) RT-PCR analysis of Rnf128 (RNF128) mrna expression in mouse peritoneal macrophages (a) and THP-1 cells (b) upon stimulation with
More informationFlow cytometric determination of apoptosis by annexin V/propidium iodide double staining.
Supplementary materials and methods Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining. Cells were analyzed for phosphatidylserine exposure by an annexin-v FITC/propidium
More informationLINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS.
Supplemental Data: LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS. Scott Jepson, Bryan Vought, Christian H.
More informationNo wash 2 Washes 2 Days ** ** IgG-bead phagocytosis (%)
Supplementary Figures Supplementary Figure 1. No wash 2 Washes 2 Days Tat Control ** ** 2 4 6 8 IgG-bead phagocytosis (%) Supplementary Figure 1. Reversibility of phagocytosis inhibition by Tat. Human
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/429/ra54/dc1 Supplementary Materials for Dephosphorylation of the adaptor LAT and phospholipase C by SHP-1 inhibits natural killer cell cytotoxicity Omri Matalon,
More informationSupplemental data. Supplemental Materials and Methods
Supplemental data Supplemental Materials and Methods Transfection of plasmid. Transfection of plasmids into FRTL5 cells was performed using Lipofectamine LTX with Plus reagent (Invitrogen) according to
More informationNature Immunology: doi: /ni.1744
Macrophage colony stimulating factor induces macrophage proliferation and survival through a pathway involving DAP12 and β-catenin Karel Otero, Isaiah R Turnbull, Pietro Luigi Poliani *, William Vermi
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/5/233/ra50/dc1 Supplementary Materials for Epidermal Growth Factor Receptor Is Essential for Toll-Like Receptor 3 Signaling Michifumi Yamashita, Saurabh Chattopadhyay,
More informationThe non-muscle-myosin-ii heavy chain Myh9 mediates colitis-induced epithelium injury by restricting Lgr5+ stem cells
Supplementary Information The non-muscle-myosin-ii heavy chain Myh9 mediates colitis-induced epithelium injury by restricting Lgr5+ stem cells Bing Zhao 1,3, Zhen Qi 1,3, Yehua Li 1,3, Chongkai Wang 2,
More informationSupporting Information
Supporting Information Chakrabarty et al. 10.1073/pnas.1018001108 SI Materials and Methods Cell Lines. All cell lines were purchased from the American Type Culture Collection. Media and FBS were purchased
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/3/146/ra80/dc1 Supplementary Materials for DNMT1 Stability Is Regulated by Proteins Coordinating Deubiquitination and Acetylation-Driven Ubiquitination Zhanwen
More informationSupplementary Materials and Methods
Supplementary Materials and Methods sirna sequences used in this study The sequences of Stealth Select RNAi for ALK and FLOT-1 were as follows: ALK sense no.1 (ALK): 5 -AAUACUGACAGCCACAGGCAAUGUC-3 ; ALK
More informationApoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium
Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium Iodide (Invitrogen, Carlsbad, CA) staining. Briefly, 2x10 5 cells were washed once in cold PBS and resuspended
More informationSupplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured
Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured under static conditions. Cells were seeded in the chamber area of the device and cultured overnight without medium perfusion.
More informationRegulation of axonal and dendritic growth by the extracellular calcium-sensing
Regulation of axonal and dendritic growth by the extracellular calcium-sensing receptor (CaSR). Thomas N. Vizard, Gerard W. O Keeffe, Humberto Gutierrez, Claudine H. Kos, Daniela Riccardi, Alun M. Davies
More informationSupplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates
Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates vascular calcification (VC). (a) Von Kossa staining shows that TSA potentiated the Pi-induced VC. Scale bar, 100
More informationFigure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.
LEGENDS TO SUPPLEMENTARY FIGURES Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.2) were stained with the antibodies oct3/4
More informationFlow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).
Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant
More informationSUPPLEMENTARY INFORMATION
ARTICLE NUMBER: 0 DOI: 0.0/NMICROBIOL.0. The host protein CLUH participates in the subnuclear transport of influenza virus ribonucleoprotein complexes Tomomi Ando,, Seiya Yamayoshi, Yuriko Tomita,, Shinji
More informationSupplementary Figure 1
Supplementary Figure 1 PTEN promotes virus-induced expression of IFNB1 and its downstream genes. (a) Quantitative RT-PCR analysis of IFNB1 mrna (left) and ELISA of IFN-β (right) in HEK 293 cells (2 10
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2386 Figure 1 Src-containing puncta are not focal adhesions, podosomes or endosomes. (a) FAK-/- were stained with anti-py416 Src (green) and either (in red) the focal adhesion protein paxillin,
More informationCancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information
Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information 1. Supplementary Figure S1-S10: Pages 2-11 2. Supplementary References:
More information