Gene Expression Data Analysis (I)

Size: px
Start display at page:

Download "Gene Expression Data Analysis (I)"

Transcription

1 Gene Expression Data Analysis (I) Bing Zhang Department of Biomedical Informatics Vanderbilt University

2 Bioinformatics tasks Biological question Experiment design Microarray experiment Image analysis Pre-processing Data Mining Experimental verification Data storage Data integration Data visualization Differential expression Clustering Classification Biological interpretation Hypothesis

3 Experiment design: well begun is half done A clearly defined biological question Well control of potential sources of variation (biological and technical) Statistically sound microarray experimental arrangement (replicates) Compliance with the standard of microarray information collection (MIAME)

4 Image analysis Analysis of the image of the scanned array in order to extract an intensity for each spot or feature on the array. Gridding: align a grid to the spots Segmentation: identify the shape of each spot Intensity extraction: extract intensity for each spot and potentially for each surrounding background Fixed circle Adaptive circle Seeded region growing

5 Data preprocessing Background correction: subtract background signal from the spot intensity to get a more accurate estimate of the biological signal from the spot Local subtraction: MM probe or local background Model-based correction: signal component + noise component Usually leads to an increased level of noise for low-expressing probe sets Normalization: remove systematic variation in a microarray experiment which affects the measured gene expression levels Experimenter bias Variability in experimental conditions Sample collection and preparation Machine parameters Summarization: combine the multiple probe intensities for each probe set to produce an expression value estimate (for affymetrix arrays) RMA model: y kij = β kj + α ki +ε kij k, j, i refer to probe set, array and probe, respectively

6 Normalization (within array, two-channel arrays) Remove systematic differences due to intensity and location dependent dye biases MA-plot M=log2(Cy5/Cy3) A=(log2(Cy5)+log2(Cy3))/2 Normalization Before normalization Global lowess normalization Global lowess (Locally weighted scatter plot smoothing) normalization: a non linear regression of log2(ratio)s against the average log2(intensity). It computes local linear regressions that are joined together to form a smooth curve. This normalization takes into account intensity artifacts. Print-tip lowess normalization: local linear regression computation are limited to a single print-tip group Before normalization Print-tip lowess normalization

7 Normalization (between arrays) Adjust the arrays using some control or housekeeping genes that you would expect to have the same intensity level across all of the samples Adjust using spike control Multiply each array by a constant to make the mean (median) intensity the same for each individual array (Global normalization) Match the percentiles of each array (Quantile normalization) No normalization Global normalization Quantile normalization

8 Get to know your data matrix Genes Samples Sample_1 Sample_2 Sample_3 Sample_4 Sample_5 Sample_6 TNNC DKK ZNF CHST FABP MGST DEFA VIL AKAP HS3ST

9 Bioinformatics tasks Biological question Experiment design Microarray experiment Image analysis Pre-processing Data Mining Experimental verification Data storage Data integration Data visualization Differential expression Clustering Classification Biological interpretation Hypothesis

10 Differential expression Genes Samples Sample_1 Sample_2 Sample_3 Sample_4 Sample_5 Sample_6 TNNC DKK ZNF CHST FABP MGST DEFA VIL AKAP HS3ST Case Control

11 Fold change n-fold change Arbitrarily selected fold change cut-offs Pros Usually 2 fold Intuitive and easily visualised Simple and rapid Cons Statistically inefficient Magnitude does not necessarily indicate importance Often too restrictive MA-plot M: log ratio ( log 2 (A/B) ) A: average log intensity ( log 2 (A*B)/2 )

12 Statistical analysis Genes Samples Sample_1 Sample_2 Sample_3 Sample_4 Sample_5 Sample_6 TNNC DKK ZNF CHST FABP MGST DEFA VIL AKAP HS3ST Case Control Null hypothesis Alternative hypothesis H 0 : µ 1 = µ 2 H 1 : µ 1 µ 2

13 Planning experiments for case-control studies Simulation of the dependency of fold change detection on the sample size. Experimental error is assumed to be 20%, i.e., CV of replicated control and treatment series equals 0.2. Samples are drawn from Gaussian distributions with mean equal to 1 for the control series and mean equal to 1.5 (black), 2 (red), 2.5 (green), 3 (blue), 5 (yellow), and 10 (magenta) for the treatment samples, respectively, in order to simulate the fold changes. Sampling is repeated 1000 times and the proportion of true positive test results (P < 0.05) is plotted (Y-axis) over the sample size (X-axis).

14 Differential Gene Expression: DNA arrays (continuous data) Statistical tests Student s t-test: a two sample location test of the null hypothesis that the means of two normally distributed populations are equal (equal variance). Welch s t-test: unequal variance Mann Whitney U test (also called Wilcoxon rank-sum test): nonparametric t-test vs U-test Robustness: U-test is more robust to outliers Efficiency: When normality holds, the efficiency of the U-test is about 0.95 when compared to the t-test. For distributions sufficiently far from normal and for sufficiently large sample sizes, the U-test can be considerably more efficient than the t-test. GeneX GeneX t-test: p=0.06; U test: p=0.1 t-test: p=0.32; U test: p=0.1

15 Differential Gene Expression: sequencing-based technologies (count data) 2 x 2 contingency table Counts in case Counts in control Total Counts for gene X a b a+b Counts for all other genes c d c+d Total a+c b+d a+b+c+d Statistical tests Chi-square test Fisher s exact test Poisson regression

16 Correction for multiple testing Why? In an experiment with a 10,000-gene array in which the significance level p is set at 0.05, 10,000 x 0.05 = 500 genes would be inferred as significant even though none is differentially expressed The probability of drawing the wrong conclusion in at least one of the n different test is P(wrong) =1 (1 α s ) n = α g α s Where is the significance level at single gene level, and is the global significance level. α g

17 Correction for multiple testing Methods Control the family-wise error rate (FWER), the probability that there is a single type I error in the entire set (family) of hypotheses tested. e.g. Standard Bonferroni Correction. uncorrected p value x no. of genes tested Control the false discovery rate (FDR), the expected proportion of false positives among the number of rejected hypotheses. e.g. Benjamini and Hochberg correction. Ranking all genes according to their p value Picking a desired FDR level, q (e.g. 5%) p i Starting from the top of the list, accept all genes with m q, where i is the number of genes accepted so far, and m is the total number of genes tested.

18 Gene list interpretation Microarray data Differential expression 92546_r_at 92545_f_at 96055_at _f_at _at _s_at 92202_g_at _at _at _s_at _at _at... Normalization Clustering Lists of genes with potential biological interest

19 Bioinformatics tasks Biological question Experiment design Microarray experiment Image analysis Pre-processing Data Mining Experimental verification Data storage Data integration Data visualization Differential expression Clustering Classification Biological interpretation Hypothesis

20 Over-representation analysis HSPA1A HSPA1B HSPA1L HSPA8 HSPB1 HSPB2 HSPB8 HSPC138 HSPD1 HSPE1 HSPH1 HYPB HYPK IBRDC2 ID4 IGFBP5 IL1F5 IL6ST compare PNRC1 GADD45B RRAGC DDIT3 ASNS FOSB UBE2H EPC1 HDAC9 JMJD1C RRAGC RIT1 PURA... Input gene list (152 genes) Observed total total Expected Predefined functional category (339 genes) Enrichment ratio: 6.08 p value: 9.34E-9

21 Over-representation analysis Significant genes Non-significant genes Total Genes in the category k j-k j Other genes n-k m-n-j+k m-j Total n m-n m Hypergeometric distribution: given a total of m genes where j genes are in the functional category, if we pick n genes randomly, what is the probability of having k or more genes from the category? p = min(n, j ) i= k m j n i j i m n Zhang et.al. Nucleic Acids Res. 33:W741, 2005

22 Commonly used functional categories Gene Ontology ( ) Structured, precisely defined, controlled vocabulary for describing the roles of genes and gene products Three organizing principles: molecular function, biological process, and cellular component Pathways KEGG ( ) Pathway Commons ( ) WikiPathways ( ) Common targets of transcription factors TRANSFAC ( Cytogenetic bands

23 WebGestalt: Web-based Gene Set Analysis Toolkit 8 organisms 132 ID types webgestalt 73,986 functional categories Zhang et.al. Nucleic Acids Res. 33:W741, 2005 Duncan et al. BMC Bioinformatics. 11:P10, 2010

24 WebGestalt: over-represented GO biological processes

25 WebGestalt: over-represented pathway

26 Limitation of the over-representation analysis Does not account for the order of genes in the significant gene list Arbitrary thresholding leads to the lose of information Assumes genes are independent

27 Gene Set Enrichment Analysis (GSEA) Subramanian et.al. PNAS 102:15545, 2005 Test whether the members of a predefined functional category are randomly distributed throughout the ranked gene list Calculation of an Enrichment Score, modified Kolmogorov Smirnov test Estimation of Significance Level of ES, permutation test Adjustment for Multiple Hypothesis Testing, control False Discovery Rate Leading edge subset: genes contribute to the significance

28 Summary Biological question Experiment design Microarray experiment Image analysis Pre-processing Data Mining Experimental verification Data storage Data integration Data visualization Differential expression Clustering Classification Biological interpretation Hypothesis

Gene Expression Data Analysis

Gene Expression Data Analysis Gene Expression Data Analysis Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu BMIF 310, Fall 2009 Gene expression technologies (summary) Hybridization-based

More information

Understanding protein lists from proteomics studies. Bing Zhang Department of Biomedical Informatics Vanderbilt University

Understanding protein lists from proteomics studies. Bing Zhang Department of Biomedical Informatics Vanderbilt University Understanding protein lists from proteomics studies Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu A typical comparative shotgun proteomics study IPI00375843

More information

EECS730: Introduction to Bioinformatics

EECS730: Introduction to Bioinformatics EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and

More information

Introduction to gene expression microarray data analysis

Introduction to gene expression microarray data analysis Introduction to gene expression microarray data analysis Outline Brief introduction: Technology and data. Statistical challenges in data analysis. Preprocessing data normalization and transformation. Useful

More information

Introduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics

Introduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics Introduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics abedi777@ymail.com Outlines Technology Basic concepts Data analysis Printed Microarrays In Situ-Synthesized

More information

Exploration and Analysis of DNA Microarray Data

Exploration and Analysis of DNA Microarray Data Exploration and Analysis of DNA Microarray Data Dhammika Amaratunga Senior Research Fellow in Nonclinical Biostatistics Johnson & Johnson Pharmaceutical Research & Development Javier Cabrera Associate

More information

Normalization. Getting the numbers comparable. DNA Microarray Bioinformatics - #27612

Normalization. Getting the numbers comparable. DNA Microarray Bioinformatics - #27612 Normalization Getting the numbers comparable The DNA Array Analysis Pipeline Question Experimental Design Array design Probe design Sample Preparation Hybridization Buy Chip/Array Image analysis Expression

More information

Understanding protein lists from comparative proteomics studies

Understanding protein lists from comparative proteomics studies Understanding protein lists from comparative proteomics studies Bing Zhang, Ph.D. Department of Biomedical Informatics Vanderbilt University School of Medicine bing.zhang@vanderbilt.edu A typical comparative

More information

Gene expression: Microarray data analysis. Copyright notice. Outline: microarray data analysis. Schedule

Gene expression: Microarray data analysis. Copyright notice. Outline: microarray data analysis. Schedule Gene expression: Microarray data analysis Copyright notice Many of the images in this powerpoint presentation are from Bioinformatics and Functional Genomics by Jonathan Pevsner (ISBN -47-4-8). Copyright

More information

Gene List Enrichment Analysis

Gene List Enrichment Analysis Outline Gene List Enrichment Analysis George Bell, Ph.D. BaRC Hot Topics March 16, 2010 Why do enrichment analysis? Main types Selecting or ranking genes Annotation sources Statistics Remaining issues

More information

Microarray Data Analysis Workshop. Preprocessing and normalization A trailer show of the rest of the microarray world.

Microarray Data Analysis Workshop. Preprocessing and normalization A trailer show of the rest of the microarray world. Microarray Data Analysis Workshop MedVetNet Workshop, DTU 2008 Preprocessing and normalization A trailer show of the rest of the microarray world Carsten Friis Media glna tnra GlnA TnrA C2 glnr C3 C5 C6

More information

Seven Keys to Successful Microarray Data Analysis

Seven Keys to Successful Microarray Data Analysis Seven Keys to Successful Microarray Data Analysis Experiment Design Platform Selection Data Management System Access Differential Expression Biological Significance Data Publication Type of experiment

More information

Outline. Analysis of Microarray Data. Most important design question. General experimental issues

Outline. Analysis of Microarray Data. Most important design question. General experimental issues Outline Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization Introduction to microarrays Experimental design Data normalization Other data transformation Exercises George Bell,

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review

More information

Pre processing and quality control of microarray data

Pre processing and quality control of microarray data Pre processing and quality control of microarray data Christine Stansberg, 20.04.10 Workflow microarray experiment 1 Problem driven experimental design Wet lab experiments RNA labelling 2 Data pre processing

More information

David M. Rocke Division of Biostatistics and Department of Biomedical Engineering University of California, Davis

David M. Rocke Division of Biostatistics and Department of Biomedical Engineering University of California, Davis David M. Rocke Division of Biostatistics and Department of Biomedical Engineering University of California, Davis Outline RNA-Seq for differential expression analysis Statistical methods for RNA-Seq: Structure

More information

Preprocessing Methods for Two-Color Microarray Data

Preprocessing Methods for Two-Color Microarray Data Preprocessing Methods for Two-Color Microarray Data 1/15/2011 Copyright 2011 Dan Nettleton Preprocessing Steps Background correction Transformation Normalization Summarization 1 2 What is background correction?

More information

V10-8. Gene Expression

V10-8. Gene Expression V10-8. Gene Expression - Regulation of Gene Transcription at Promoters - Experimental Analysis of Gene Expression - Statistics Primer - Preprocessing of Data - Differential Expression Analysis Fri, May

More information

Lecture 2: March 8, 2007

Lecture 2: March 8, 2007 Analysis of DNA Chips and Gene Networks Spring Semester, 2007 Lecture 2: March 8, 2007 Lecturer: Rani Elkon Scribe: Yuri Solodkin and Andrey Stolyarenko 1 2.1 Low Level Analysis of Microarrays 2.1.1 Introduction

More information

Microarray Data Analysis in GeneSpring GX 11. Month ##, 200X

Microarray Data Analysis in GeneSpring GX 11. Month ##, 200X Microarray Data Analysis in GeneSpring GX 11 Month ##, 200X Agenda Genome Browser GO GSEA Pathway Analysis Network building Find significant pathways Extract relations via NLP Data Visualization Options

More information

Microarray Data Analysis. Normalization

Microarray Data Analysis. Normalization Microarray Data Analysis Normalization Outline General issues Normalization for two colour microarrays Normalization and other stuff for one color microarrays 2 Preprocessing: normalization The word normalization

More information

Exploration and Analysis of DNA Microarray Data

Exploration and Analysis of DNA Microarray Data Exploration and Analysis of DNA Microarray Data Dhammika Amaratunga Senior Research Fellow in Nonclinical Biostatistics Johnson & Johnson Pharmaceutical Research & Development Javier Cabrera Associate

More information

Background Correction and Normalization. Lecture 3 Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy

Background Correction and Normalization. Lecture 3 Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy Background Correction and Normalization Lecture 3 Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy Feature Level Data Outline Affymetrix GeneChip arrays Two

More information

1. Introduction Gene regulation Genomics and genome analyses

1. Introduction Gene regulation Genomics and genome analyses 1. Introduction Gene regulation Genomics and genome analyses 2. Gene regulation tools and methods Regulatory sequences and motif discovery TF binding sites Databases 3. Technologies Microarrays Deep sequencing

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review Visualizing

More information

Analyzing Gene Set Enrichment

Analyzing Gene Set Enrichment Analyzing Gene Set Enrichment BaRC Hot Topics June 20, 2016 Yanmei Huang Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Purpose of Gene Set Enrichment Analysis

More information

Comparison of Microarray Pre-Processing Methods

Comparison of Microarray Pre-Processing Methods Comparison of Microarray Pre-Processing Methods K. Shakya, H. J. Ruskin, G. Kerr, M. Crane, J. Becker Dublin City University, Dublin 9, Ireland Abstract Data pre-processing in microarray technology is

More information

Introduction to ChIP Seq data analyses. Acknowledgement: slides taken from Dr. H

Introduction to ChIP Seq data analyses. Acknowledgement: slides taken from Dr. H Introduction to ChIP Seq data analyses Acknowledgement: slides taken from Dr. H Wu @Emory ChIP seq: Chromatin ImmunoPrecipitation it ti + sequencing Same biological motivation as ChIP chip: measure specific

More information

Rafael A Irizarry, Department of Biostatistics JHU

Rafael A Irizarry, Department of Biostatistics JHU Getting Usable Data from Microarrays it s not as easy as you think Rafael A Irizarry, Department of Biostatistics JHU rafa@jhu.edu http://www.biostat.jhsph.edu/~ririzarr http://www.bioconductor.org Acknowledgements

More information

Probe-Level Data Normalisation: RMA and GC-RMA Sam Robson Images courtesy of Neil Ward, European Application Engineer, Agilent Technologies.

Probe-Level Data Normalisation: RMA and GC-RMA Sam Robson Images courtesy of Neil Ward, European Application Engineer, Agilent Technologies. Probe-Level Data Normalisation: RMA and GC-RMA Sam Robson Images courtesy of Neil Ward, European Application Engineer, Agilent Technologies. References Summaries of Affymetrix Genechip Probe Level Data,

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction

More information

Microarray Technique. Some background. M. Nath

Microarray Technique. Some background. M. Nath Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction

More information

Introduction to Bioinformatics. Fabian Hoti 6.10.

Introduction to Bioinformatics. Fabian Hoti 6.10. Introduction to Bioinformatics Fabian Hoti 6.10. Analysis of Microarray Data Introduction Different types of microarrays Experiment Design Data Normalization Feature selection/extraction Clustering Introduction

More information

Analysis of a Proposed Universal Fingerprint Microarray

Analysis of a Proposed Universal Fingerprint Microarray Analysis of a Proposed Universal Fingerprint Microarray Michael Doran, Raffaella Settimi, Daniela Raicu, Jacob Furst School of CTI, DePaul University, Chicago, IL Mathew Schipma, Darrell Chandler Bio-detection

More information

Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison. CodeLink compatible

Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison. CodeLink compatible Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison CodeLink compatible Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood

More information

STATISTICAL CHALLENGES IN GENE DISCOVERY

STATISTICAL CHALLENGES IN GENE DISCOVERY STATISTICAL CHALLENGES IN GENE DISCOVERY THROUGH MICROARRAY DATA ANALYSIS 1 Central Tuber Crops Research Institute,Kerala, India 2 Dept. of Statistics, St. Thomas College, Pala, Kerala, India email:sreejyothi

More information

Expression summarization

Expression summarization Expression Quantification: Affy Affymetrix Genechip is an oligonucleotide array consisting of a several perfect match (PM) and their corresponding mismatch (MM) probes that interrogate for a single gene.

More information

Александр Предеус. Институт Биоинформатики. Gene Set Analysis: почему интерпретировать глобальные генетические изменения труднее, чем кажется

Александр Предеус. Институт Биоинформатики. Gene Set Analysis: почему интерпретировать глобальные генетические изменения труднее, чем кажется Александр Предеус Институт Биоинформатики Gene Set Analysis: почему интерпретировать глобальные генетические изменения труднее, чем кажется Outline Formulating the problem What are the references? Overrepresentation

More information

Background and Normalization:

Background and Normalization: Background and Normalization: Investigating the effects of preprocessing on gene expression estimates Ben Bolstad Group in Biostatistics University of California, Berkeley bolstad@stat.berkeley.edu http://www.stat.berkeley.edu/~bolstad

More information

Experimental design of RNA-Seq Data

Experimental design of RNA-Seq Data Experimental design of RNA-Seq Data RNA-seq course: The Power of RNA-seq Thursday June 6 th 2013, Marco Bink Biometris Overview Acknowledgements Introduction Experimental designs Randomization, Replication,

More information

CS-E5870 High-Throughput Bioinformatics Microarray data analysis

CS-E5870 High-Throughput Bioinformatics Microarray data analysis CS-E5870 High-Throughput Bioinformatics Microarray data analysis Harri Lähdesmäki Department of Computer Science Aalto University September 20, 2016 Acknowledgement for J Salojärvi and E Czeizler for the

More information

Microarray Informatics

Microarray Informatics Microarray Informatics Donald Dunbar MSc Seminar 4 th February 2009 Aims To give a biologistʼs view of microarray experiments To explain the technologies involved To describe typical microarray experiments

More information

Microarray Informatics

Microarray Informatics Microarray Informatics Donald Dunbar MSc Seminar 31 st January 2007 Aims To give a biologist s view of microarray experiments To explain the technologies involved To describe typical microarray experiments

More information

Standard Data Analysis Report Agilent Gene Expression Service

Standard Data Analysis Report Agilent Gene Expression Service Standard Data Analysis Report Agilent Gene Expression Service Experiment: S534662 Date: 2011-01-01 Prepared for: Dr. Researcher Genomic Sciences Lab Prepared by S534662 Standard Data Analysis Report 2011-01-01

More information

Estoril Education Day

Estoril Education Day Estoril Education Day -Experimental design in Proteomics October 23rd, 2010 Peter James Note Taking All the Powerpoint slides from the Talks are available for download from: http://www.immun.lth.se/education/

More information

CS 5984: Application of Basic Clustering Algorithms to Find Expression Modules in Cancer

CS 5984: Application of Basic Clustering Algorithms to Find Expression Modules in Cancer CS 5984: Application of Basic Clustering Algorithms to Find Expression Modules in Cancer T. M. Murali January 31, 2006 Innovative Application of Hierarchical Clustering A module map showing conditional

More information

Lecture 8: Predicting and analyzing metagenomic composition from 16S survey data

Lecture 8: Predicting and analyzing metagenomic composition from 16S survey data Lecture 8: Predicting and analyzing metagenomic composition from 16S survey data What can we tell about the taxonomic and functional stability of microbiota? Why? Nature. 2012; 486(7402): 207 214. doi:10.1038/nature11234

More information

From CEL files to lists of interesting genes. Rafael A. Irizarry Department of Biostatistics Johns Hopkins University

From CEL files to lists of interesting genes. Rafael A. Irizarry Department of Biostatistics Johns Hopkins University From CEL files to lists of interesting genes Rafael A. Irizarry Department of Biostatistics Johns Hopkins University Contact Information e-mail Personal webpage Department webpage Bioinformatics Program

More information

Identification of biological themes in microarray data from a mouse heart development time series using GeneSifter

Identification of biological themes in microarray data from a mouse heart development time series using GeneSifter Identification of biological themes in microarray data from a mouse heart development time series using GeneSifter VizX Labs, LLC Seattle, WA 98119 Abstract Oligonucleotide microarrays were used to study

More information

Cell Stem Cell, volume 9 Supplemental Information

Cell Stem Cell, volume 9 Supplemental Information Cell Stem Cell, volume 9 Supplemental Information Large-Scale Analysis Reveals Acquisition of Lineage-Specific Chromosomal Aberrations in Human Adult Stem Cells Uri Ben-David, Yoav Mayshar, and Nissim

More information

Experience with Weka by Predictive Classification on Gene-Expre

Experience with Weka by Predictive Classification on Gene-Expre Experience with Weka by Predictive Classification on Gene-Expression Data Czech Technical University in Prague Faculty of Electrical Engineering Department of Cybernetics Intelligent Data Analysis lab

More information

Introduction to microarrays

Introduction to microarrays Bayesian modelling of gene expression data Alex Lewin Sylvia Richardson (IC Epidemiology) Tim Aitman (IC Microarray Centre) Philippe Broët (INSERM, Paris) In collaboration with Anne-Mette Hein, Natalia

More information

Gene Set Enrichment Analysis! Robert Gentleman!

Gene Set Enrichment Analysis! Robert Gentleman! Gene Set Enrichment Analysis! Robert Gentleman! Outline! Description of the experimental setting! Defining gene sets! Description of the original GSEA algorithm! proposed by Mootha et al (2003)! Our approach

More information

ALLEN Human Brain Atlas

ALLEN Human Brain Atlas TECHNICAL WHITE PAPER: MICROARRAY DATA NORMALIZATION The is a publicly available online resource of gene expression information in the adult human brain. Comprising multiple datasets from various projects

More information

Combining ANOVA and PCA in the analysis of microarray data

Combining ANOVA and PCA in the analysis of microarray data Combining ANOVA and PCA in the analysis of microarray data Lutgarde Buydens IMM, Analytical chemistry Radboud University Nijmegen, the Netherlands Scientific Staff: PhD students: External PhD: Post doc:

More information

AP Statistics Scope & Sequence

AP Statistics Scope & Sequence AP Statistics Scope & Sequence Grading Period Unit Title Learning Targets Throughout the School Year First Grading Period *Apply mathematics to problems in everyday life *Use a problem-solving model that

More information

The essentials of microarray data analysis

The essentials of microarray data analysis The essentials of microarray data analysis (from a complete novice) Thanks to Rafael Irizarry for the slides! Outline Experimental design Take logs! Pre-processing: affy chips and 2-color arrays Clustering

More information

Pre-processing DNA Microarray Data

Pre-processing DNA Microarray Data Pre-processing DNA Microarray Data Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Bioconductor Short Course Winter 2002 Copyright 2002, all rights reserved Biological question Experimental

More information

Image Analysis. Based on Information from Terry Speed s Group, UC Berkeley. Lecture 3 Pre-Processing of Affymetrix Arrays. Affymetrix Terminology

Image Analysis. Based on Information from Terry Speed s Group, UC Berkeley. Lecture 3 Pre-Processing of Affymetrix Arrays. Affymetrix Terminology Image Analysis Lecture 3 Pre-Processing of Affymetrix Arrays Stat 697K, CS 691K, Microbio 690K 2 Affymetrix Terminology Probe: an oligonucleotide of 25 base-pairs ( 25-mer ). Based on Information from

More information

From reads to results: differential. Alicia Oshlack Head of Bioinformatics

From reads to results: differential. Alicia Oshlack Head of Bioinformatics From reads to results: differential expression analysis with ihrna seq Alicia Oshlack Head of Bioinformatics Murdoch Childrens Research Institute Benefits and opportunities ii of RNA seq All transcripts

More information

Introduction to Bioinformatics! Giri Narasimhan. ECS 254; Phone: x3748

Introduction to Bioinformatics! Giri Narasimhan. ECS 254; Phone: x3748 Introduction to Bioinformatics! Giri Narasimhan ECS 254; Phone: x3748 giri@cs.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs11.html Reading! The following slides come from a series of talks by Rafael Irizzary

More information

RNA-Seq Now What? BIS180L Professor Maloof May 24, 2018

RNA-Seq Now What? BIS180L Professor Maloof May 24, 2018 RNA-Seq Now What? BIS180L Professor Maloof May 24, 2018 We have differentially expressed genes, what do we want to know about them? We have differentially expressed genes, what do we want to know about

More information

Bioinformatics for Biologists

Bioinformatics for Biologists Bioinformatics for Biologists Microarray Data Analysis. Lecture 1. Fran Lewitter, Ph.D. Director Bioinformatics and Research Computing Whitehead Institute Outline Introduction Working with microarray data

More information

Feature selection methods for SVM classification of microarray data

Feature selection methods for SVM classification of microarray data Feature selection methods for SVM classification of microarray data Mike Love December 11, 2009 SVMs for microarray classification tasks Linear support vector machines have been used in microarray experiments

More information

Measuring and Understanding Gene Expression

Measuring and Understanding Gene Expression Measuring and Understanding Gene Expression Dr. Lars Eijssen Dept. Of Bioinformatics BiGCaT Sciences programme 2014 Why are genes interesting? TRANSCRIPTION Genome Genomics Transcriptome Transcriptomics

More information

Mouse expression data were normalized using the robust multiarray algorithm (1) using

Mouse expression data were normalized using the robust multiarray algorithm (1) using Supplementary Information Bioinformatics statistical analysis of microarray data Mouse expression data were normalized using the robust multiarray algorithm (1) using a custom probe set definition that

More information

Alexander Statnikov, Ph.D.

Alexander Statnikov, Ph.D. Alexander Statnikov, Ph.D. Director, Computational Causal Discovery Laboratory Benchmarking Director, Best Practices Integrative Informatics Consultation Service Assistant Professor, Department of Medicine,

More information

2007/04/21.

2007/04/21. 2007/04/21 hmwu@stat.sinica.edu.tw http://idv.sinica.edu.tw/hmwu 1 GeneChip Expression Array Design Assay and Analysis Flow Chart Quality Assessment Low Level Analysis (from probe level data to expression

More information

advanced analysis of gene expression microarray data aidong zhang World Scientific State University of New York at Buffalo, USA

advanced analysis of gene expression microarray data aidong zhang World Scientific State University of New York at Buffalo, USA advanced analysis of gene expression microarray data aidong zhang State University of New York at Buffalo, USA World Scientific NEW JERSEY LONDON SINGAPORE BEIJING SHANGHAI HONG KONG TAIPEI CHENNAI Contents

More information

Affymetrix GeneChip Arrays. Lecture 3 (continued) Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy

Affymetrix GeneChip Arrays. Lecture 3 (continued) Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy Affymetrix GeneChip Arrays Lecture 3 (continued) Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy Affymetrix GeneChip Design 5 3 Reference sequence TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT

More information

Gene Annotation and Gene Set Analysis

Gene Annotation and Gene Set Analysis Gene Annotation and Gene Set Analysis After you obtain a short list of genes/clusters/classifiers what next? For each gene, you may ask What it is What is does What processes is it involved in Which chromosome

More information

Exploration, Normalization, Summaries, and Software for Affymetrix Probe Level Data

Exploration, Normalization, Summaries, and Software for Affymetrix Probe Level Data Exploration, Normalization, Summaries, and Software for Affymetrix Probe Level Data Rafael A. Irizarry Department of Biostatistics, JHU March 12, 2003 Outline Review of technology Why study probe level

More information

Gene List Enrichment Analysis - Statistics, Tools, Data Integration and Visualization

Gene List Enrichment Analysis - Statistics, Tools, Data Integration and Visualization Gene List Enrichment Analysis - Statistics, Tools, Data Integration and Visualization Aik Choon Tan, Ph.D. Associate Professor of Bioinformatics Division of Medical Oncology Department of Medicine aikchoon.tan@ucdenver.edu

More information

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute Content on today s lecture What are microarrays measuring? From fluorescence intensities to transcript

More information

Comparative analysis of RNA-Seq data with DESeq2

Comparative analysis of RNA-Seq data with DESeq2 Comparative analysis of RNA-Seq data with DESeq2 Simon Anders EMBL Heidelberg Two applications of RNA-Seq Discovery find new transcripts find transcript boundaries find splice junctions Comparison Given

More information

Introduction to Genome Wide Association Studies 2014 Sydney Brenner Institute for Molecular Bioscience/Wits Bioinformatics Shaun Aron

Introduction to Genome Wide Association Studies 2014 Sydney Brenner Institute for Molecular Bioscience/Wits Bioinformatics Shaun Aron Introduction to Genome Wide Association Studies 2014 Sydney Brenner Institute for Molecular Bioscience/Wits Bioinformatics Shaun Aron Genotype calling Genotyping methods for Affymetrix arrays Genotyping

More information

Pre-processing DNA Microarray Data

Pre-processing DNA Microarray Data Pre-processing DNA Microarray Data Short course: Practical Analysis of DNA Microarray Data Instructors: Vince Carey & Sandrine Dudoit KolleKolle, Denmark October 26-28, 2003 1 Slides from Short Courses

More information

Exam 1 from a Past Semester

Exam 1 from a Past Semester Exam from a Past Semester. Provide a brief answer to each of the following questions. a) What do perfect match and mismatch mean in the context of Affymetrix GeneChip technology? Be as specific as possible

More information

Effects of Different Normalization Methods on Gene Set Enrichment Analysis (GSEA)

Effects of Different Normalization Methods on Gene Set Enrichment Analysis (GSEA) Effects of Different Normalization Methods on Gene Set Enrichment Analysis (GSEA) Ming Zhao Tutor: Dr. Mengjin Zhu 12th, Nov, 2011 Key Laboratory of Agricultural Animal Genetics, Breeding and Reproduction

More information

Oligonucleotide microarray data are not normally distributed

Oligonucleotide microarray data are not normally distributed Oligonucleotide microarray data are not normally distributed Johanna Hardin Jason Wilson John Kloke Abstract Novel techniques for analyzing microarray data are constantly being developed. Though many of

More information

Measuring gene expression (Microarrays) Ulf Leser

Measuring gene expression (Microarrays) Ulf Leser Measuring gene expression (Microarrays) Ulf Leser This Lecture Gene expression Microarrays Idea Technologies Problems Quality control Normalization Analysis next week! 2 http://learn.genetics.utah.edu/content/molecules/transcribe/

More information

Preprocessing Affymetrix GeneChip Data. Affymetrix GeneChip Design. Terminology TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT

Preprocessing Affymetrix GeneChip Data. Affymetrix GeneChip Design. Terminology TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT Preprocessing Affymetrix GeneChip Data Credit for some of today s materials: Ben Bolstad, Leslie Cope, Laurent Gautier, Terry Speed and Zhijin Wu Affymetrix GeneChip Design 5 3 Reference sequence TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT

More information

Accelerating Gene Set Enrichment Analysis on CUDA-Enabled GPUs. Bertil Schmidt Christian Hundt

Accelerating Gene Set Enrichment Analysis on CUDA-Enabled GPUs. Bertil Schmidt Christian Hundt Accelerating Gene Set Enrichment Analysis on CUDA-Enabled GPUs Bertil Schmidt Christian Hundt Contents Gene Set Enrichment Analysis (GSEA) Background Algorithmic details cudagsea Performance evaluation

More information

Statistical Issues in Microarray Data and Data Analysis

Statistical Issues in Microarray Data and Data Analysis Statistical Issues in Microarray Data and Data Analysis Outline Background Reliability of Microarray Technology MAQC experimental design and data Analysis of MAQC data Selection of Differential Expressed

More information

Systematic comparison of CRISPR/Cas9 and RNAi screens for essential genes

Systematic comparison of CRISPR/Cas9 and RNAi screens for essential genes CORRECTION NOTICE Nat. Biotechnol. doi:10.1038/nbt. 3567 Systematic comparison of CRISPR/Cas9 and RNAi screens for essential genes David W Morgens, Richard M Deans, Amy Li & Michael C Bassik In the version

More information

ChIP-seq and RNA-seq. Farhat Habib

ChIP-seq and RNA-seq. Farhat Habib ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions

More information

4.3 Nonparametric Tests cont...

4.3 Nonparametric Tests cont... Class #14 Wednesday 2 March 2011 What did we cover last time? Hypothesis Testing Types Student s t-test - practical equations Effective degrees of freedom Parametric Tests Chi squared test Kolmogorov-Smirnov

More information

Comparative Analysis using the Illumina DASL assay with FFPE tissue. Wendell Jones, PhD Vice President, Statistics and Bioinformatics

Comparative Analysis using the Illumina DASL assay with FFPE tissue. Wendell Jones, PhD Vice President, Statistics and Bioinformatics TM Comparative Analysis using the Illumina DASL assay with FFPE tissue Wendell Jones, PhD Vice President, Statistics and Bioinformatics Background EA has examined several protocol assay possibilities for

More information

Gene expression analysis: Introduction to microarrays

Gene expression analysis: Introduction to microarrays Gene expression analysis: Introduction to microarrays Adam Ameur The Linnaeus Centre for Bioinformatics, Uppsala University February 15, 2006 Overview Introduction Part I: How a microarray experiment is

More information

FACTORS CONTRIBUTING TO VARIABILITY IN DNA MICROARRAY RESULTS: THE ABRF MICROARRAY RESEARCH GROUP 2002 STUDY

FACTORS CONTRIBUTING TO VARIABILITY IN DNA MICROARRAY RESULTS: THE ABRF MICROARRAY RESEARCH GROUP 2002 STUDY FACTORS CONTRIBUTING TO VARIABILITY IN DNA MICROARRAY RESULTS: THE ABRF MICROARRAY RESEARCH GROUP 2002 STUDY K. L. Knudtson 1, C. Griffin 2, A. I. Brooks 3, D. A. Iacobas 4, K. Johnson 5, G. Khitrov 6,

More information

Microarray data analysis: from disarray to consolidation and consensus

Microarray data analysis: from disarray to consolidation and consensus Microarray data analysis: from disarray to consolidation and consensus David B. Allison*, Xiangqin Cui*, Grier P. Page* and Mahyar Sabripour* Abstract In just a few years, microarrays have gone from obscurity

More information

Bioinformatics III Structural Bioinformatics and Genome Analysis. PART II: Genome Analysis. Chapter 7. DNA Microarrays

Bioinformatics III Structural Bioinformatics and Genome Analysis. PART II: Genome Analysis. Chapter 7. DNA Microarrays Bioinformatics III Structural Bioinformatics and Genome Analysis PART II: Genome Analysis Chapter 7. DNA Microarrays 7.1 Motivation 7.2 DNA Microarray History and current states 7.3 DNA Microarray Techniques

More information

Using 2-way ANOVA to dissect the immune response to hookworm infection in mouse lung

Using 2-way ANOVA to dissect the immune response to hookworm infection in mouse lung Using 2-way ANOVA to dissect the immune response to hookworm infection in mouse lung Using 2-way ANOVA to dissect the immune response to hookworm infection in mouse lung General microarry data analysis

More information

The Affymetrix platform for gene expression analysis Affymetrix recommended QA procedures The RMA model for probe intensity data Application of the

The Affymetrix platform for gene expression analysis Affymetrix recommended QA procedures The RMA model for probe intensity data Application of the 1 The Affymetrix platform for gene expression analysis Affymetrix recommended QA procedures The RMA model for probe intensity data Application of the fitted RMA model to quality assessment 2 3 Probes are

More information

Exercise on Microarray data analysis

Exercise on Microarray data analysis Exercise on Microarray data analysis Aim The aim of this exercise is to introduce basic data analysis of transcriptome data using the statistical software R. The exercise is divided in two parts. First,

More information

Upstream/Downstream Relation Detection of Signaling Molecules using Microarray Data

Upstream/Downstream Relation Detection of Signaling Molecules using Microarray Data Vol 1 no 1 2005 Pages 1 5 Upstream/Downstream Relation Detection of Signaling Molecules using Microarray Data Ozgun Babur 1 1 Center for Bioinformatics, Computer Engineering Department, Bilkent University,

More information

Comparative analysis of RNA-Seq data with DESeq and DEXSeq

Comparative analysis of RNA-Seq data with DESeq and DEXSeq Comparative analysis of RNA-Seq data with DESeq and DEXSeq Simon Anders EMBL Heidelberg Discovery Two applications of RNA-Seq find new transcripts find transcript boundaries find splice junctions Comparison

More information

RNA

RNA RNA sequencing Michael Inouye Baker Heart and Diabetes Institute Univ of Melbourne / Monash Univ Summer Institute in Statistical Genetics 2017 Integrative Genomics Module Seattle @minouye271 www.inouyelab.org

More information

Ning Tang ALL RIGHTS RESERVED

Ning Tang ALL RIGHTS RESERVED 2014 Ning Tang ALL RIGHTS RESERVED ROBUST GENE SET ANALYSIS AND ROBUST GENE EXPRESSION By NING TANG A dissertation submitted to the Graduate School New Brunswick Rutgers, The State University of New Jersey

More information