A Parallel Implementation of the Modus Ponens Inference Rule in a DNA Strand-Displacement System
|
|
- Amy Walsh
- 6 years ago
- Views:
Transcription
1 A Parallel Implementation of the Modus Ponens Inference Rule in a DNA Strand-Displacement System Jack K. Horner P.O. Box 266 Los Alamos NM USA PDPTA 2013 Abstract Computation implemented in DNA reactions promises to advance high-performance computing (HPC) for at least three reasons. It (1) is inherently Amdahl-scalable by reactor-volume, (2) has a power/operationsper-second(ops) ratio that is potentially orders of magnitude smaller than that of silicon circuits, and (3) can provide a natural access-interface to DNA-based high-density information storage. In order to serve as general-purpose computing regime, DNA computing will have to support Boolean operations. Here, I describe an implementation of the modus ponens inference rule (commonly used in Boolean logic) in a DNA strand-displacement (DSD) system. Keywords: DNA computing, DNA strand displacement, modus ponens 1.0 Introduction Computing implemented in DNA reactions promises to advance high-performance computing (HPC) for at least three reasons. It: Is inherently Amdahl-scalable ([6]; [7], p. 39) by reactor-volume Has a power/operations-persecond(ops) ratio that is potentially orders of magnitude smaller than that of silicon circuits ([7], pp ; [8]) Provides a natural access-interface to DNA-based high-density information storage ([2]). DNA strand displacement A variety of information-processing circuits, including a catalytic gate ([3], an implementation of which has been tested in vitro), have recently been implemented in DNA strand displacement (DSD) reactions. In a DSD reaction, portions of a strand of DNA in one reactant displace portions of a strand in another DNA reactant. A DSD simulation system is described in [4] and [5]. Some examples of DNA molecules represented in the language defined in [5] follow. ( A "stroke" ( ) denotes the juxtaposition of multiple molecules.)
2 Figure 1. Some examples of DNA molecules expressed in the language of [5]. In Figure 1, the notation 1:2 represents a lower strand of DNA, where the 3 end of the strand is on the left, denoted by an arrowhead. The strand is divided into domains, which correspond to short DNA sequences. In the leftmost element of Figure 1, the domains are represented by numbers 1 and 2, where each number represents a distinct domain. In Figure 1, the red domain 1 represents a toehold domain, while the black domain 2 represents an ordinary specificity domain. Toehold domains are very short sequences, generally between 4 and 10 nucleotides in length, that enable one DNA strand to bind to another. Since toehold domains are short, two strands bound to one another will quickly unbind in the absence of further interaction along neighboring domains. In Figure 1, the notation <1 2> represents an upper strand of DNA, where the 3 end of the strand is assumed to be on the right. The strand consists of two domains that are complementary to domains 1 and 2 of the leftmost element of Figure 1, where two domains are complementary if their respective sequences are Watson-Crick complementary. Two complementary strands, 1:2 and <1 2>, can hybridize along their complementary domains to form a double-stranded molecule, denoted by [1 2], as shown in the third element from the left in Figure 1. A molecule can also consist of multiple upper strands bound to a single lower strand. For example, [1 2]:[3 4] denotes a DNA molecule that consists of upper strands <1 2>and <3 4> bound to a single lower strand 1:2:3:4. There can also be gaps between bound upper strands as in the molecule [1 2]:3:[4 5], where domain 3 of the lower strand is unoccupied (see rightmost element of Figure 1). Bound upper strands can also overhang to the left or right, as shown in Figure 2. Figure 2. Three examples of overhanging strands, expressed in the notation of [5]. In Figure 2, the molecule <1>[2 3]<4> consists of an upper strand< > bound to a lower strand 2:3. The region[2 3] of the molecule is double-stranded, while <1>and <4> represent single-stranded regions overhanging to the left and right. The molecule [1]<2>:[3] consists of an upper strand <1 2> bound to a molecule1:[3], where the single-stranded region <2> is overhanging the double-stranded region [3]. Multiple overhanging strands can be bound simultaneously along different regions, as in the case of the molecule<1>[2 3]<4>:<5>[6 7]<8>, which represents two upper strands, < > and < >, bound along regions [2 3] and [6 7], respectively. Notice
3 that the colon is used to separate the two bound upper strands. A given strand can also be displaced by another strand as a result of binding, as shown in Figure 3. Figure 3. An example of a strand displacement reaction in the notation of [5]. Although toehold domains are short enough to unbind rapidly in the absence of additional specificity domains, they are still long enough to greatly accelerate the initiation of strand displacement when additional specificity domains are present. In Figure 3, when the strand <1 2> becomes bound it initiates the displacement of its neighboring strand by a process of branch migration. Although this process involves a random walk of multiple elementary steps, these are relatively fast at experimental concentrations and can be omitted ([3]). This means that the unbinding reaction on toehold domain 1 in Figure 3 can be effectively ignored and the two consecutive reactions can be approximated by a single displacement reaction. In general, the DNA molecules are assumed to have no additional secondary structure. This can be achieved by careful selection of appropriate DNA sequences ([3],[4]). In addition, DNA sequences of distinct domains are assumed to be sufficiently different that they do not interfere with each other. For further detail, see [4] and [5]. Modus ponens Modus ponens, sometimes called the "rule of detachment"([9], p. 47), is an inference rule widely used in Boolean logic ([1]). It allows us to infer a proposition ψ from a conjunction of propositions of the form φ -> ψ and φ, where φ and ψ range over propositions and -> denotes Boolean implication ([1]). Implementing modus ponens in [4] requires mapping the elements of the rule (i.e., φ, φ -> ψ, and ψ) to elements of DNA circuits that are implementable in [4]. 2.0 Method Figure 4 shows a mapping of "φ" and " φ -> ψ" to the DSD strand-definition language of [5]. Figure 4. Mapping of φ and φ -> ψ to input species of [4]. The top species (the "substrate", in catalyst-gate nomenclature) represents the proposition φ -> ψ. The bottom species (the "fuel", in catalyst-gate nomenclature) represents the proposition φ.
4 Figure 5 shows the DSD script for the catalytic gate described in [3] (without the "reporter" molecules of [3]), implemented in the language described in [5], using the input descriptors shown in Figure 4. The reaction product of interest is the sequence <1 2>, which represents ψ. (* DIRECTIVES AND DOMAIN-DEFINITION SEGMENT *) directive duration points 1000 (* run sim for 7000 sec, save 1000 points *) (* directive leak 1.0E-9, default leakage rate /nm/s *) (* directive tau , default merged rate /s *) (* directive migrate , default nucleotide migration rate /s *) (* directive lengths 6 20, default toehold and normal domain lengths *) (* directive tolerance 1.0E-6, default ODE tolerance for deterministic simulator *) (* directive time s, default time units *) (* directive concentration nm, default concentration units *) directive plot <2 3^ 4>; <1>[2]:<6>[3^ 4]:5^*; <1 2> (* plot a subset of strands *) directive scale (* multiply concentrations, divide binding and leak rates *) new 3@ 4.2E-4, 4.0E-2 (* initialize *) new 5@ 6.5E-4, 4.0E-3 (* initialize *) (* PROGRAM SEGMENT *) ( 13 * <2 3^ 4> 10 * <4 5^> 10 * <1>[2]:<6>[3^ 4]:5^* ) Figure 5. DSD code used in this study (adapted from [4]). The script shown in Figure 5 was executed as a "deterministic" system under [4] on a Dell Inspiron 545 with an Intel Core2 Quad CPU Q8200 clocked at 2.33 GHz, with 8.00 GB RAM, under Windows Vista Home Premium/SP Results Figure 6 shows the reaction graph produced by the method described in Section 2.0.
5 Figure 6. The reaction graph produced by the method described in Section 2.0. Rectangles with darker borders represent inputs; all other rectangles represent intermediates. Arrows represent reaction direction. The output of interest is the strand <1 2>, which represents ψ. ψ is "detached" by the system from the main reactant of the system, <1>[2]:<6>[3^ 4]:5^* (modus ponens is sometimes called the "rule of detachment"). Strand <4 5> is the catalyst of the system. ( See Figure 7 for concrete realizations of the sequences in the diagram.) Figure 7 shows a concrete DNA segment-description realization, generated by [4], of the species in Figure 6. Figure 7. A concrete DNA segment-description realization of the DNA species in Figure 6.
6 Figure 8 shows part of the output of DSD simulation of modus ponens under the conditions described in Section 2.0. Figure 8. Output of the simulation described in Section 2.0. The green line represents the proposition φ -> ψ (the "substrate", in catalytic-gate nomenclature). The red line represents φ (the "fuel", in catalytic-system nomenclature). The blue line represents the production of ψ (= " <1 2>") from modus ponens ("(φ and φ -> ψ) implies ψ "). The system is Amdahl-scalable by reactor-volume. In actual practice, a "reporter" species (typically, a dye) would be used to visualize the production of ψ. Compilation of the system described in Section 2.0 took ~3 seconds. The subsequent simulation utilized ~25% of the CPU and ~0.5 GB memory on the platform described in Section 2.0, as measured on the system monitor, and executed in ~0.1 second. 4.0 Conclusions and discussion The method described in Section 2.0 and the results described in Section 3.0 motivate several observations.: 1. Modus ponens can be implemented in a DSD system. 2. The implementation is Amdahlscalable by reactor-volume.
7 3. The implementation shown here could be easily abstracted to a DSD module ([5]) which would hide the representation internals of the implementation. 4. In principle, any catalytic system that, in the presence of a molecule A, "detached" a molecule B from a complex molecule C that contained both A and B, could be used to model modus ponens. 5. Other, perhaps simpler, implementations of modus ponens may be possible in [4]. The implementation described here, however, is known to work because the catalytic gate schema on which it trades has been implemented in vitro ([3]). 5.0 Acknowledgements This work benefited from discussions with Tony Pawlicki. For any problems that remain, I am solely responsible [5] Lankin MR, Petersen R, and Phillips A. Visual DSD user manual v0.14 beta [6] Amdahl G. Validity of the single processor approach to achieving large-scale computing capabilities. AFIPS Conference Proceedings 30 (1967), [7] Hennessy JL and Patterson D. Computer Architecture: A Quantitative Approach. Fourth Edition. Morgan Kaufmann [8] Amos M. Theoretical and Experimental DNA Computation. Springer [9] Tarski A. Introduction to Logic and to the Methodology of the Deductive Sciences (Second, revised edition, 1946). Dover republication, References [1] Church A. An Introduction to Mathematical Logic. Volume I. Princeton [2] Goldman N, Bertone P, Chen S, Dessimoz C, LeProust EM, Sipos B, and Birney E. Towards practical, high-capacity, low-maintenance information storage in synthesized DNA. Nature 494 (7 February 2013), [3] Zhang DY, Turberfield, AJ, Yurke B, and Winfree E. Engineering entropy-driven reactions and networks catalyzed by DNA. Science 318 (2007) [4] Phillips A. The DNA strand displacement simulator, DSD v Software is available for Windows (and other operating systems) at
Design of Arithmetic and Control Cells for a DNA Binary Processor
2015 International Conference on Computational Science and Computational Intelligence Design of Arithmetic and Control Cells for a DNA Binary Processor Aby K George Electrical and Computer Engineering
More informationDNA Circuits for Analog Computing
DNA Circuits for Analog Computing Tianqi Song Department of Computer Science Duke University 1 Outline Motivation What is DNA computing? Why are we interested in DNA computing? What has been done? Why
More informationProbabilistic analysis of localized DNA hybridization circuits
Probabilistic analysis of localized DNA hybridization circuits Neil Dalchau,, Harish Chandran,, Nikhil Gopalkrishnan,, Andrew Phillips,, and John Reif,, Microsoft Research, Cambridge CB 2FB, UK, Department
More informationDesign and Analysis of DNA Strand Displacement Devices using Probabilistic Model Checking
1 Introduction Design and Analysis of DNA Strand Displacement Devices using Probabilistic Model Checking Matthew R. Lakin David Parker Luca Cardelli Marta Kwiatkowska Abstract Andrew Phillips Designing
More informationBio-inspired Computing for Network Modelling
ISSN (online): 2289-7984 Vol. 6, No.. Pages -, 25 Bio-inspired Computing for Network Modelling N. Rajaee *,a, A. A. S. A Hussaini b, A. Zulkharnain c and S. M. W Masra d Faculty of Engineering, Universiti
More informationHigh-Fidelity DNA Hybridization using Programmable Molecular DNA Devices
High-Fidelity DNA Hybridization using Programmable Molecular DNA Devices Nikhil Gopalkrishnan Harish Chandran John Reif Department of Computer Science, Duke University, Durham, NC 27708 Abstract The hybridization
More informationLocalized Hybridization Circuits
Localized Hybridization Circuits Harish Chandran 1, Nikhil Gopalkrishnan 1, Andrew Phillips 2, and John Reif 1 1 Department of Computer Science, Duke University {harish,nikhil,reif}@cs.duke.edu 2 Microsoft
More informationDNA Logic Circuits with a DNA Polymerase and a Nicking Enzyme
DNA Logic Circuits with a DNA Polymerase and a Nicking Enzyme Ryo Hirose 1, Satoshi Kobayashi 1, Ken Komiya 2 1 Department of Communication Engineering and Informatics Graduate School of Informatics and
More informationProgramming Cells. Andrew Phillips Biological Computation Group Microsoft Research ATGCTTACCGGTACGTTTACGACTACGT AGCTAGCATGCTTACCGGTACGTTTACG AC
Programming Cells ATGCTTACCGGTACGTTTACGACTACGT AGCTAGCATGCTTACCGGTACGTTTACG AC Andrew Phillips Biological Computation Group Microsoft Research 1 Image courtesy of James Brown, Haseloff Lab, University
More informationSections 12.3, 13.1, 13.2
Sections 12.3, 13.1, 13.2 Background: Watson & Crick recognized that base pairing in the double helix allows DNA to be copied, or replicated Each strand in the double helix has all the information to remake
More informationStay Tuned Computational Science NeSI. Jordi Blasco
Computational Science Team @ NeSI Jordi Blasco (jordi.blasco@nesi.org.nz) Outline 1 About NeSI CS Team Who we are? 2 Identify the Bottlenecks Identify the Most Popular Apps Profile and Debug 3 Tuning Increase
More informationTileSoft: Sequence Optimization Software for Designing DNA Secondary Structures
1 TileSoft: Sequence Optimization Software for Designing DNA Secondary Structures P. Yin*, B. Guo*, C. Belmore*, W. Palmeri*, E. Winfree, T. H. LaBean* and J. H. Reif* * Department of Computer Science,
More informationProgrammable and Multiparameter DNA-based Logic Platform For Cancer Recognition and Targeted Therapy
Programmable and Multiparameter DNA-based Logic Platform For Cancer Recognition and Targeted Therapy Mingxu You,, Guizhi Zhu,, Tao Chen,, Michael J. Donovan and Weihong Tan, * Department of Chemistry and
More informationQPR ScoreCard. White Paper. QPR ScoreCard - Balanced Scorecard with Commitment. Copyright 2002 QPR Software Oyj Plc All Rights Reserved
QPR ScoreCard White Paper QPR ScoreCard - Balanced Scorecard with Commitment QPR Management Software 2/25 Table of Contents 1 Executive Overview...3 2 Implementing Balanced Scorecard with QPR ScoreCard...4
More informationSupporting Information for. Localized DNA Hybridization Chain Reactions. on DNA Origami
Supporting Information for Localized DNA Hybridization Chain Reactions on DNA Origami Hieu Bui 1,3*, Shalin Shah 2*, Reem Mokhtar 1, Tianqi Song 1, Sudhanshu Garg 1, John Reif 1,2 1 Department of Computer
More informationDesign Principles in Synthetic Biology
Design Principles in Synthetic Biology Chris Myers 1, Nathan Barker 2, Hiroyuki Kuwahara 3, Curtis Madsen 1, Nam Nguyen 1, Michael Samoilov 4, and Adam Arkin 4 1 University of Utah 2 Southern Utah University
More informationDNA-Based Digital Storage
TWIST BISCIECE WHITE PAPER DA-Based Digital Storage DA-Based Digital Storage ABSTRACT Digital data generation is increasing exponentially, and estimates suggest that the amount of new data being generated
More informationLinear Data Structure for DNA Computer
2009 Sixth International Conference on Fuzzy Systems and Knowledge Discovery Linear Data Structure for DNA Computer Wanggen Li 1,2 1 Information Sciences and Technology Donghua University, Shanghai 201620,
More informationDesign for Low-Power at the Electronic System Level Frank Schirrmeister ChipVision Design Systems
Frank Schirrmeister ChipVision Design Systems franks@chipvision.com 1. Introduction 1.1. Motivation Well, it happened again. Just when you were about to beat the high score of your favorite game your portable
More informationSupporting Information
Supporting Information Wiley-VCH 2014 69451 Weinheim, Germany Complex Reconfiguration of DNA Nanostructures** Bryan Wei,* Luvena L. Ong, Jeffrey Chen, Alexander S. Jaffe, and Peng Yin* ange_201402437_sm_miscellaneous_information.pdf
More informationSupporting Information. DNA Tetraplexes-Based Toehold Activation for Controllable DNA Strand Displacement Reactions
Supporting Information DNA Tetraplexes-Based Toehold Activation for Controllable DNA Strand Displacement Reactions Wei Tang, Huaming Wang, Dingzhong Wang, Yan Zhao, Na Li, and Feng Liu* Beijing National
More informationLeakless DNA strand displacement systems
Leakless DNA strand displacement systems Chris Thachuk 1, Erik Winfree 1, and David Soloveichik 2 1 California Institute of Technology 2 UCSF Center for Systems and Synthetic Biology Abstract. While current
More informationIntegrating DNA Strand Displacement Circuitry to Nonlinear Hybridization Chain Reaction
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Integrating DNA Strand Displacement Circuitry to Nonlinear
More informationParallels Remote Application Server and Microsoft Azure. Scalability and Cost of Using RAS with Azure
Parallels Remote Application Server and Microsoft Azure and Cost of Using RAS with Azure Contents Introduction to Parallels RAS and Microsoft Azure... 3... 4 Costs... 18 Conclusion... 21 2 C HAPTER 1 Introduction
More informationDNA Algorithms of Implementing Biomolecular Databases on a Biological Computer
104 IEEE TRANSACTIONS ON NANOBIOSCIENCE, VOL 14, NO 1, JANUARY 2015 DNA Algorithms of Implementing Biomolecular on a Biological Computer Weng-Long Chang Athanasios V Vasilakos Abstract In this paper, DNA
More informationEB TechPaper. Robot architectures. DNA for automated driving. elek trobit.com
EB TechPaper Robot architectures DNA for aumated driving elek trobit.com 1 Robot architectures DNA for aumated driving Introduction With functions such as lane assist, emergency brake assist and adaptive
More informationComputer UCSC. The MASC Group
Computer Architecture @ UCSC The MASC Group Department of Computer Engineering, University of California Santa Cruz http://masc.cse.ucsc.edu MASC Projects 2 MASC Projects 3 MASC Projects 4 Thermal Measurements
More informationTassc:Estimator technical briefing
Tassc:Estimator technical briefing Gillian Adens Tassc Limited www.tassc-solutions.com First Published: November 2002 Last Updated: April 2004 Tassc:Estimator arrives ready loaded with metric data to assist
More informationDesign of Full Adder and Full Subtractor using DNA Computing
Design of Full Adder and Full Subtractor using DNA Computing Ashish Lamaniya Department of Computer Sc. & Engineering, SRIT, RGPV University, Jabalpur, India Prof Brajesh Patel Head of Computer Sc. & Engineering
More informationCOMBINED-OBJECTIVE OPTIMIZATION IN IDENTICAL PARALLEL MACHINE SCHEDULING PROBLEM USING PSO
COMBINED-OBJECTIVE OPTIMIZATION IN IDENTICAL PARALLEL MACHINE SCHEDULING PROBLEM USING PSO Bathrinath S. 1, Saravanasankar S. 1 and Ponnambalam SG. 2 1 Department of Mechanical Engineering, Kalasalingam
More informationMulti-Layer Data Encryption using Residue Number System in DNA Sequence
International Journal of Computer Applications (975 8887) Multi-Layer Data Encryption using Residue Number System in DNA Sequence M. I. Youssef Faculty Of Engineering, Department Of Electrical Engineering
More informationCHAPTER 4 PROPOSED HYBRID INTELLIGENT APPROCH FOR MULTIPROCESSOR SCHEDULING
79 CHAPTER 4 PROPOSED HYBRID INTELLIGENT APPROCH FOR MULTIPROCESSOR SCHEDULING The present chapter proposes a hybrid intelligent approach (IPSO-AIS) using Improved Particle Swarm Optimization (IPSO) with
More informationTLM-Driven Design and Verification Time For a Methodology Shift
TLM-Driven Design and Time For a Methodology Shift By Jack Erickson, Cadence Design Systems, Inc. Transaction level modeling (TLM) is gaining favor over register-transfer level () for design components
More informationDNA Based Evolvable Instruction Set Architecture & Arithmetic Unit
DNA Based Evolvable Instruction Set Architecture & Arithmetic Unit (Extended Abstract) Abstract. The paper proposes a novel DNA based concept towards the natural evolution of instruction set architecture
More informationSupporting Information. Multi-strand Structure Prediction of Nucleic. Acid Assemblies and Design of RNA Switches
Supporting Information Multi-strand Structure Prediction of Nucleic Acid Assemblies and Design of RNA Switches Eckart Bindewald 1#, Kirill A. Afonin 2,3#, Mathias Viard 1, Paul Zakrevsky 2, Taejin Kim
More informationFor more Current papers visit Quantitative methods for assessing the quality of proposed architectural designs
Question No: 1 Quantitative methods for assessing the quality of proposed architectural designs are readily available. True False Question No: 2 A decision table should be used to document all conditional
More informationA WORKLOAD GENERATOR FOR DATABASE SYSTEM BENCHMARKS. Hoe Jin Jeong and Sang Ho Lee
A WORKLOAD GENERATOR FOR DATABASE SYSTEM BENCHMARKS Hoe Jin Jeong and Sang Ho Lee School of Computing, Soongsil University, Seoul, Korea bqangel@gmail.com and shlee@comp.ssu.ac.kr Abstract There are cases
More informationHamburg 20 September, 2018
Hamburg 20 September, 2018 Data Warehouse Modernization Pivotal Greenplum Dell Greenplum Building Blocks Les Klein EMEA Field CTO, Pivotal @LesKlein Great organizations leverage software, analytics, and
More informationSupporting Information
Copyright WILEY-VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 2014. Supporting Information for Small, DOI: 10.1002/smll.201303558 Ultraspecific and Highly Sensitive Nucleic Acid Detection by Integrating
More informationFractal Exercise. Fractals, task farm and load imbalance
Fractal Exercise Fractals, task farm and load imbalance 2 Contents 1 Introduction and Aims... 3 1.1 Mandelbrot Set... 3 2 Looking at the concepts... 4 2.1 What is a task farm?... 4 2.1.1 Using a task farm...
More informationgreen B 1 ) into a single unit to model the substrate in this reaction. enzyme
Teacher Key Objectives You will use the model pieces in the kit to: Simulate enzymatic actions. Explain enzymatic specificity. Investigate two types of enzyme inhibitors used in regulating enzymatic activity.
More informationInformation-based autonomous reconfiguration in systems of interacting DNA nanostructures
https://doi.org/10.1038/s41467-018-07805-7 OPEN Information-based autonomous reconfiguration in systems of interacting DNA nanostructures Philip Petersen 1, Grigory Tikhomirov 2 & Lulu Qian 2,3 1234567890():,;
More informationVisual-Physical Grammars
11 A Good Practice Example Abstract This paper describes a proof-of-concept study for a new kind of formal grammar a visual-physical grammar. Visual-physical grammars are generative descriptions for the
More informationLecture 2 (cont( cont) Trends in Computational Science DNA and Quantum Computers
Lecture 2 (cont( cont) Trends in Computational Science DNA and Quantum Computers 1. Nicholas Carter 2. Andrea Mantler, University of North Carolina 3. Michael M. Crow, Executive Vice Provost, Columbia
More informationProgramming biomolecular selfassembly
Programming biomolecular selfassembly pathways Yin, P., Choi, H. M. T., Calvert, C. R., & Pierce, N.. (2008). Programming biomolecular selfassembly pathways. Nature, 451(7176), 318 322. doi:10.1038/nature06451
More informationSSA Signal Search Analysis II
SSA Signal Search Analysis II SSA other applications - translation In contrast to translation initiation in bacteria, translation initiation in eukaryotes is not guided by a Shine-Dalgarno like motif.
More informationModels in Engineering Glossary
Models in Engineering Glossary Anchoring bias is the tendency to use an initial piece of information to make subsequent judgments. Once an anchor is set, there is a bias toward interpreting other information
More informationNature Motivated Approaches to Computer Science I. György Vaszil University of Debrecen, Faculty of Informatics Department of Computer Science
Nature Motivated Approaches to Computer Science I. György Vaszil University of Debrecen, Faculty of Informatics Department of Computer Science Potsdam, July 2017 What is Nature Motivated? Theoretical computational
More informationProblem Set No. 3 Due: Thursday, 11/04/10 at the start of class
Department of Chemical Engineering ChE 170 University of California, Santa Barbara Fall 2010 Problem Set No. 3 Due: Thursday, 11/04/10 at the start of class Objective: To understand and develop models
More information13-2 Manipulating DNA Slide 1 of 32
1 of 32 The Tools of Molecular Biology The Tools of Molecular Biology How do scientists make changes to DNA? Scientists use their knowledge of the structure of DNA and its chemical properties to study
More informationNSF {Program (NSF ) first announced on August 20, 2004} Program Officers: Frederica Darema Helen Gill Brett Fleisch
NSF07-504 {Program (NSF04-609 ) first announced on August 20, 2004} Program Officers: Frederica Darema Helen Gill Brett Fleisch Computer Systems Research Program: Components and Thematic Areas Advanced
More informationProbabilistic Reasoning with a Bayesian DNA Device Based on Strand Displacement
Probabilistic Reasoning with a Bayesian DNA Device Based on Strand Displacement Inaki Sainz de Murieta and Alfonso Rodriguez-Paton Departamento de Inteligencia Artificial, Universidad Politecnica de Madrid
More informationRNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA
RNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA that it has a hydroxyl group at the 2 position of the
More informationFULTECH CONSULTING RISK TECHNOLOGIES
FULTECH CONSULTING RISK TECHNOLOGIES ENTERPRISE-WIDE RISK MANAGEMENT Many global financial services firms rely on their legacy technology infrastructure for critical calculations dedicated to support enterprise-wide
More informationHiSeqTM 2000 Sequencing System
IET International Equipment Trading Ltd. www.ietltd.com Proudly serving laboratories worldwide since 1979 CALL +847.913.0777 for Refurbished & Certified Lab Equipment HiSeqTM 2000 Sequencing System Performance
More informationAccelerating Motif Finding in DNA Sequences with Multicore CPUs
Accelerating Motif Finding in DNA Sequences with Multicore CPUs Pramitha Perera and Roshan Ragel, Member, IEEE Abstract Motif discovery in DNA sequences is a challenging task in molecular biology. In computational
More informationOPERATING SYSTEMS. Systems and Models. CS 3502 Spring Chapter 03
OPERATING SYSTEMS CS 3502 Spring 2018 Systems and Models Chapter 03 Systems and Models A system is the part of the real world under study. It is composed of a set of entities interacting among themselves
More informationProgramming cell adhesion for on-chip sequential Boolean logic
Supporting Information Programming cell adhesion for on-chip sequential Boolean logic functions Xiangmeng Qu,, Shaopeng Wang,, Zhilei Ge,, Jianbang Wang, Guangbao Yao, Jiang Li, Xiaolei Zuo, Jiye Shi,
More informationLOGISTICAL ASPECTS OF THE SOFTWARE TESTING PROCESS
LOGISTICAL ASPECTS OF THE SOFTWARE TESTING PROCESS Kazimierz Worwa* * Faculty of Cybernetics, Military University of Technology, Warsaw, 00-908, Poland, Email: kazimierz.worwa@wat.edu.pl Abstract The purpose
More informationCombining OpenCV and High Level Synthesis to Accelerate your FPGA / SoC EV Application
Combining OpenCV and High Level Synthesis to Accelerate your FPGA / SoC EV Application Adam Taylor Adiuvo Engineering & Training Ltd Tends in Embedded Vision Ubiquity Applications are wide spread ADAS,
More informationNegotiation to Improve Role Adoption in Organizations
Negotiation to Improve Role Adoption in Organizations Asad Rahman and Henry Hexmoor Computer Science and Computer Engineering Engineering Hall, Room 340A University of Arkansas Fayetteville, AR 72701 {rahman,
More informationBeginnings of Molecular Computing & Biological Mathematics. Christian Jacob CPSC January 2003
Beginnings of Molecular Computing & Biological Mathematics Christian Jacob CPSC 601.73 23 January 2003 Biological Computation CPSC 601.73 Winter 2003 1 Adleman s Experiments Leonard Adleman was able to
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationMasayoshi Honda, Jeehae Park, Robert A. Pugh, Taekjip Ha, and Maria Spies
Molecular Cell, Volume 35 Supplemental Data Single-Molecule Analysis Reveals Differential Effect of ssdna-binding Proteins on DNA Translocation by XPD Helicase Masayoshi Honda, Jeehae Park, Robert A. Pugh,
More informationAddressing the I/O bottleneck of HPC workloads. Professor Mark Parsons NEXTGenIO Project Chairman Director, EPCC
Addressing the I/O bottleneck of HPC workloads Professor Mark Parsons NEXTGenIO Project Chairman Director, EPCC I/O is key Exascale challenge Parallelism beyond 100 million threads demands a new approach
More informationtest workload real workload synthetic workload
1 The workload is the most crucial part of any performance evaluation project. It is possible to reach misleading conclusions if the workload is not properly selected. When the conclusions of a study are
More informationPlease note. The development, release, and timing of any future features or functionality described for our products remains at our sole discretion.
Please note IBM s statements regarding its plans, directions, and intent are subject to change or withdrawal without notice and at IBM s sole discretion. Information regarding potential future products
More information* Keywords: Single batch-processing machine, Simulated annealing, Sterilization operation, Scheduling.
2016 International Conference on Artificial Intelligence and Computer Science (AICS 2016) ISBN: 978-1-60595-411-0 A Bi-criterion Simulated Annealing Method for a Single Batch-processing Machine Scheduling
More informationClick to edit Master title style
Click to edit Master title style Biological Modeling using APMonitor David Grigsby Brigham Young University 23 Apr 2012 Overview Computational Biology SBML Biomodels Database APMonitor Format conversion
More informationIntelligent DNA Chips: Logical Operation of Gene Expression Profiles on DNA Computers
Genome Informatics 11: 33 42 (2000) 33 Intelligent DNA Chips: Logical Operation of Gene Expression Profiles on DNA Computers Yasubumi Sakakibara 1 Akira Suyama 2 yasu@j.dendai.ac.jp suyama@dna.c.u-tokyo.ac.jp
More informationFunctional Analysis Module
CC532 Collaborate System Design Fundamentals of Systems Engineering W6, Spring, 2012 KAIST Functional Analysis Module Space Systems Engineering, version 1.0 Space Systems Engineering: Functional Analysis
More informationDelivering High Performance for Financial Models and Risk Analytics
QuantCatalyst Delivering High Performance for Financial Models and Risk Analytics September 2008 Risk Breakfast London Dr D. Egloff daniel.egloff@quantcatalyst.com QuantCatalyst Inc. Technology and software
More informationGoya Deep Learning Inference Platform. Rev. 1.2 November 2018
Goya Deep Learning Inference Platform Rev. 1.2 November 2018 Habana Goya Deep Learning Inference Platform Table of Contents 1. Introduction 2. Deep Learning Workflows Training and Inference 3. Goya Deep
More informationWhat s New in Discovery Studio 2.5.5
What s New in Discovery Studio 2.5.5 Discovery Studio takes modeling and simulations to the next level. It brings together the power of validated science on a customizable platform for drug discovery research.
More informationNVIDIA QUADRO VIRTUAL DATA CENTER WORKSTATION APPLICATION SIZING GUIDE FOR SIEMENS NX APPLICATION GUIDE. Ver 1.0
NVIDIA QUADRO VIRTUAL DATA CENTER WORKSTATION APPLICATION SIZING GUIDE FOR SIEMENS NX APPLICATION GUIDE Ver 1.0 EXECUTIVE SUMMARY This document provides insights into how to deploy NVIDIA Quadro Virtual
More informationMethods in virus diagnosis PCR techniques
Methods in virus diagnosis PCR techniques 450 MBIO PRACTICAL LESSON 5 Molecular Methods Methods based on the detection of viral genome are also commonly known as molecular methods. It is often said that
More informationSENTRON Powermanager. SENTRON Powermanager. Identifying hidden potential for energy optimization and savings. Answers for industry.
SENTRON Powermanager Identifying hidden potential for energy optimization and savings SENTRON Powermanager TM software, combined with Siemens power meters and low voltage protective devices, provides a
More informationHot Chips-18. Design of a Reusable 1GHz, Superscalar ARM Processor
Hot Chips-18 Design of a Reusable 1GHz, Superscalar ARM Processor Stephen Hill Consulting Engineer ARM - Austin Design Centre 22 August 2006 1 Outline Overview of Cortex -A8 (Tiger) processor What is reusability
More informationBusiness Process Modeling
Business Process Modeling Jaelson Castro jbc@cin.ufpe.br Jaelson Castro 2016 1 Objectives Business processes Modeling concurrency and synchronization in business activities BPMN Diagrams Jaelson Castro
More informationRelease 12.2 Beta Program
Release 12.2 Beta Program By Gustavo Gonzalez Taking Our Own Medicine Used the E-Business Suite since 2004 Upgraded to R12 in January 2009 Implemented OBIEE in January 2010 R12.2 Beta Program in January
More informationPhilip Simpson. FPGA Design. Best Practices for Team-based Design
FPGA Design 5 Philip Simpson FPGA Design Best Practices for Team-based Design Philip Simpson Altera Corporation San Jose, CA 95134 USA Feilmidh@sbcglobal.net ISBN 978-1-4419-6338-3 e-isbn 978-1-4419-6339-0
More informationCHAPTER 5 SUPPLIER SELECTION BY LEXICOGRAPHIC METHOD USING INTEGER LINEAR PROGRAMMING
93 CHAPTER 5 SUPPLIER SELECTION BY LEXICOGRAPHIC METHOD USING INTEGER LINEAR PROGRAMMING 5.1 INTRODUCTION The SCMS model is solved using Lexicographic method by using LINGO software. Here the objectives
More informationAsk the right question, regardless of scale
Ask the right question, regardless of scale Customers use 100s to 1,000s Of cores to answer business-critical Questions they couldn t have done before. Trivial to support different use cases Different
More informationCase Study Documentation & Migration COBOL
Case Study Documentation & Migration COBOL Business Scenario: The customer is a US urban county of about 26 square miles located close to Washington DC. The County s CLIENT And Service Event (CASE) and
More informationTranscription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
More informationSkyMAX is a new-generation flight scheduling optimization system that maximizes an airline s total network profitability by determining the right
SkyMAX is a new-generation flight scheduling optimization system that maximizes an airline s total network profitability by determining the right flight at the right place at the right time. MAKE YOUR
More informationSTAND: New Tool for Performance Estimation of the Block Data Processing Algorithms in High-load Systems
STAND: New Tool for Performance Estimation of the Block Data Processing Algorithms in High-load Systems Victor Minchenkov, Vladimir Bashun St-Petersburg State University of Aerospace Instrumentation {victor,
More informationRedox-Active Molecular Flash Memory for On-Chip Memory
Redox-Active Molecular Flash Memory for On-Chip Memory By Hao Zhu Electrical and Computer Engineering George Mason University, Fairfax, VA 2013.10.24 Outline Introduction Molecule attachment method & characterizations
More informationFEATURES AND BENEFITS
SGS MINERALS SERVICES T3 SGS 1079 MET PLATFORM SGS Minerals Services is the industry leader in providing support and creating solutions for mining projects worldwide. SGS offers advanced process control
More informationExpanding the Discipline of Enterprise Architecture Modeling to Business Intelligence with EA4BI
Expanding the Discipline of Enterprise Architecture Modeling to Business Intelligence with EA4BI Rudi Claes Inno.com Institute, Beerzel, Belgium Abstract. The current mainstream enterprise architecture
More informationGenetic Information: DNA replication
Genetic Information: DNA replication Umut Fahrioglu, PhD MSc DNA Replication Replication of DNA is vital to the transmission of genomes and the genes they contain from one cell generation to the other.
More informationTowards Modelling-Based Self-adaptive Resource Allocation in Multi-tiers Cloud Systems
Towards Modelling-Based Self-adaptive Resource Allocation in Multi-tiers Cloud Systems Mehdi Sliem 1(B), Nabila Salmi 1,2, and Malika Ioualalen 1 1 MOVEP Laboratory, USTHB, Algiers, Algeria {msliem,nsalmi,mioualalen}@usthb.dz
More informationThe ability to understand and reliably engineer complex. Ensemble Bayesian Analysis of Bistability in a Synthetic Transcriptional Switch
pubs.acs.org/synthbio Ensemble Bayesian Analysis of Bistability in a Synthetic Transcriptional Switch Pakpoom Subsoontorn,,, Jongmin Kim,,, and Erik Winfree*,,, Departments of Biology, Computation and
More informationThe Manycore Shift. Microsoft Parallel Computing Initiative Ushers Computing into the Next Era
The Manycore Shift Microsoft Parallel Computing Initiative Ushers Computing into the Next Era Published: November 2007 Abstract When major qualitative shifts such as the emergence of the graphical user
More informationDNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th. Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video
DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video 17 History of DNA Create Tellegami or 18 Lecture: DNA Structure
More information1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.
Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2012, B. J. MacLennan, EECS, University of Tennessee,
More informationOMNIA THE USER-FRIENDLY AND HOMOGENEOUS ACCESS TO A WIDE RANGE OF ITS APPLICATIONS
OMNIA THE USER-FRIENDLY AND HOMOGENEOUS ACCESS TO A WIDE RANGE OF ITS APPLICATIONS The OMNIA Platform is SWARCO s state-of-the-art solution for the integrated road transport environment. Its modularity
More informationTechnical Seminar 22th Jan 2013 DNA Origami
Technical Seminar 22th Jan 2013 DNA Origami Hitoshi Takizawa, PhD Agenda 1) Basis of structural DNA nanotechnology 2) DNA origami technique (2D, 3D, complex shape) 3) Programmable nanofactory 4) Application
More informationHEURISTIC APPROACH TO MULTIPLE-JOB SUBMISSION: A CASE STUDY
Proceedings of the IASTED International Conference Parallel and Distributed Computing and Systems (PDCS 2011) December 14-16, 2011 Dallas, USA HEURISTIC APPROACH TO MULTIPLE-JOB SUBMISSION: A CASE STUDY
More informationVHDL Introduction. EL 310 Erkay Savaş Sabancı University
VHDL Introduction EL 310 Erkay Savaş Sabancı University 1 What is VHDL? VHDL stands for VHSIC Hardware Description Language VHSIC =Very High-Speed Integrated Circuit Initialized by US DoD as a sponsored
More information