To construct a mammary gland specific, E6-AP-expressing transgenic vector, MMTV-

Transcription

1 Supplemental Methods: Plasmid Construction To construct a mammary gland specific, E6-AP-expressing transgenic vector, MMTV- E6-AP, we used MMTVkBpA expression vector obtained from Dr. Sophia Tsai, Baylor College of Medicine, Houston, TX. The MMTV-E6-AP transgenic expression vector was constructed as follows: initially a linker (5 -AATTCCCCGGG-3 and 5 AATTCCCGGGG-3 ) containing the internal XmaI site was inserted into the E.CoRI site of the MMTVkBpA expression vector and the resultant plasmid was named MMTVkBpAXmaI. To insert flag-tagged E6-AP into the MMTVkBpA expression plasmid, the full length E6-AP cdna was amplified by PCR with the primers containing flag tag sequences5 TCCCCCCGGGATGGAC TACAA GGACGACGATGACAAGGAAGCCTGCACGAATGAG-3 (upper strand) and 5 -TCCCCCCGGGTTACAGCATGCCAAATCCTTTGGCATACGTGATGGCCTT-3 (lower strand). The PCR product was then digested with XmaI and cloned into the corresponding site of the MMTVkBpA XmaI. After subcloning, the PCR amplified cdna of E6-AP was sequenced and was found to be correct in sequence and reading frame. In order to generate MMTV-ubiquitin-protein ligase defective mutant E6-AP (C833S) transgenic expression vector, the full length cdna of ubiquitin-protein ligase defective mutant E6-AP, in which C833 was changed to S, was amplified by PCR and subcloned into the MMTVkBpA vector using XmaI cloning site. The MMTVkBpAXmaI vectors containing either wild-type E6-AP cdna or C833S mutant cdna were digested with NotI and KpnI to generate NotI-KpnI vector free fragments that were then purified by Geneclean II kit (QBiogene, Inc., Carlsbad, CA) and used to generate transgenic mouse lines as described below. Generation of Transgenic Mice and Genotyping

2 For PCR screening, 2 pairs of primer sets were designed. The sequence of the primers are as follows: primer 1 (forward), 5 - TGCTAACCATGTTCATGCC-3 primer 2 (reverse), 5 - CTCAGAGCAGGAGTTGTTGGG-3 Primer 3(forward), 5 - ATGGACTACAAGGACGACGATG-3 and primer 4 (reverse) 5 -CCGGAAGCTCTGTACC-3 The PCR conditions include 30 cycles at 94 0 C for 2 minutes, 50 0 C for 1 minute and 72 0 C for 30 seconds. The PCR product was then analyzed by agarose gel electrophoresis. Southern blot analysis on transgenic mouse lines was performed by using the 435 bp (XhoI- XhoI) long fragment of E6-AP Exon 3 as a probe on genomic DNA digested with BamHI and BglII for transgene detection and integration using the QuickHyb protocol (Stratagene, La Jolla, CA). Genotyping of E6-AP Knockout Mice E6-AP knockout animals were genotyped by PCR method as described previously. The primers used for PCR genotyping are as follows: P1/genomic forward, 5 - ACTTCTCAAGGTAAGCTGAGCTTGC-3 P2/reverse, 5 -GCTCAAGGTTGTATGCCTTGGTGCT-3 and P3/HPRT forward, 5 -TGCATCGCATTGTCTGAGTAGGTGTC-3. The PCR cycling conditions include 35 cycles at 95 0 C for 5 minutes, 92 0 C for 1 minute, 56 0 C for 1 minute, and 72 0 C for 1 minute, followed by 72 0 C for 5 min. The PCR product was then analyzed by agarose gel electrophoresis.

3 After DNA purification and precipitation, the transgenic DNAs were suspended in injection buffer and microinjected into B6C3FI stud male fertilized one-cell embryos. The injected embryos were then implanted into the oviducts of pseudopregnant recipient mothers to carry the embryos to term. Once animals were born, the transgenic founders were identified by PCR and/or Southern blot analysis. Mammary Whole Mount Analysis and Immunohistochemistry For whole mount analysis, the inguinal mammary glands were excised, spread on glass slides, and fixed in Carnoy s solution (60% absolute alcohol, 30% chloroform and 10% acetic acid) for 2 to 4 hrs. The glands were then hydrated and stained overnight with Carmine-Alum. The mammary glands were then dehydrated, precleared in xylene and stored in methyl salicylate. Images of the mammary glands were captured digitally using a Carl Zeiss microscope attached with camera and were processed using Adobe Photoshop for printing. For immunohistochemistry, the mammary glands were fixed in 10% formalin solution (Fisher Scientific) for 18 to 24 hrs at room temperature. Mammary glands were then embedded in paraffin and 5 m sections were cut and mounted on slides. The tissue sections were deparaffinized, incubated for 30 minutes in 1% hydrogen peroxide and blocked for 1 hr at room temperature with 10% normal goat serum (NGS). This was followed by an overnight incubation at 4 o C with a primary antibody. Then the slides were washed and incubated with biotinylated goat anti-rabbit secondary antibody for 1 hr at room temperature followed by incubation for 30 mins with streptavidin conjugated peroxidase (ABC kit, Vector Laboratories, Burlingame, CA). The antigen-bound antibody was visualized with imidazole-dab reaction producing a brown colored stain. Finally, the slides were counterstained with hematoxylin. Images were captured

4 digitally using a Carl Zeiss microscope coupled with a CCD camera and were processed for printing using Adobe Photoshop program. Negative controls were included in each experiment using non-immune serum instead of the primary antibody. Extraction of Proteins from Mammary Tissue and Cells Frozen whole mammary glands from female mice were pulverized in liquid nitrogen using a pestle and mortar, and the tissue was immediately homogenized in RIPA lysis buffer [20 mm Tris (ph 7.5), 150 mm NaCl, 1 mm EDTA, 0.5% sodium deoxycholate, 1% IGEPAL CA-630, and 0.1% sodium dodecyl sulfate] containing phenylmethyl sulfonyl fluoride (1 mm) and 1x protease inhibitor mixture (Sigma-Aldrich Corp., St. Louis, MO). The tissue homogenates were placed on ice for 20 mins, and then cleared by centrifugation at 12,000xg for 10 mins at 4 0 C. The protein concentration of lysate was measured with the Bio-Rad protein assay kit. Cells were washed with phosphate-buffered saline and lysed in ice-cold RIPA buffer for 30 mins. After centrifugation at 12,000xg for 15 mins at 4 0 C, the protein concentration of the lysate was determined using the Bio-Rad protein assay kit. Immunoprecipitation and Western Blot Analysis The cell lysate was pre-cleared with normal immunoglobulin G (IgG) for 1 hour and then incubated overnight with the desired antibody. This was followed by the addition of 20µl protein A and G beads for 2 hrs. The antibody bound complex was washed extensively with NaCl-free RIPA buffer and the immunoprecipitate was analyzed by Western blot. The immunoprecipitate and cell/tissue lysates were resolved on 10 % SDS-PAGE gel and transferred onto nitrocellulose membranes (Protran, Schleicher and Schull, Inc, Keene, NH).

5 Membranes were blocked with 5% nonfat dry milk in Tris-buffered saline [20mM Tris base (ph 7.5) and 150mMNacl] containing 0.05% Tween-20 (TBS-T), then probed with the primary antibody diluted in 1% nonfat milk in TBS-T. After washing in TBS-T, the membranes were incubated with their appropriate horseradish peroxidase-conjugated secondary antibodies (Bio- Rad Laboratories, Inc.). The Western blot was visualized by chemiluminescence (PerkinElmer). BrdU Staining and Flow Cytometry Analysis T47D cells treated with sie6-ap or siscrambled for 2 days, the cells were induced with progesterone for 18 hrs and exposed to 10 µm BrdU for 2 hrs. Cells were collected and fixed with 70 % ice-cold ethanol for 30 mins on ice followed by 2N HCl denaturation and neturalization with 0.1 M sodium tetraborate. Direct immunofluoresence staining was performed by adding 30 µl of anti-brdu-fitc and incubated for 30 mins at room temperature. Propidium iodide and DNase free RNase were added prior to flow cytometry analysis. In vitro Synthesis of PR-B and Ubiquitination Assay In vitro synthesis of radio-labeled PR-B was performed using Transcription/Translation (TNT) coupled rabbit reticulocyte lysate in the presence of [ 35 S]methionine according to the manufacturer s recommendation (Promega Corp.). [ 35 S]-labeled PR-B was incubated with E1, E6-AP, and different E2s in a buffer containing 20 mm Tris-HCl (ph 7.5), 50 mm NaCl, 4 mm ATP, 10 mm MgCl 2, 0.2 mm dithiothreitol, and 4 µg ubiquitin for 3 hrs at 30 0 C. Reactions were terminated by boiling samples in sodium dodecyl sulfate-loading buffer [100 mm Tris-HCl (ph 8.0), 200 mm dithiothreitol, 4% sodium dodecyl sulfate, 20% glycerol, and 0.2% bromophenol blue]. The reaction mixtures were resolved by 10% SDS-PAGE, and radiolabeled proteins visualized by autoradiography.

6 TUNEL Assay Apoptotic cells in mammary gland tissue sections were detected using the DeadEnd Fluorometric TUNEL System (Promega) according to the manufacturer s instructions. Briefly, paraffin-embedded sections were deparaffinized, rehydrated, and fixed. The tissues were permeabilized with proteinase K; the DNA strand breaks were end labeled with fluoresceinlabeled nucleotide with terminal deoxynucleotidyl transferase. Incorporated fluorescein was detected by antifluorescein antibody conjugated with horseradish peroxidase. Labeled cells were detected with chromagen substrate 3,3'-diaminobenzidine. Finally, the sections were counterstained with hematoxylin and mounted. A quantitative evaluation of apoptotic cells was performed, and the results were expressed as TUNEL-positive cells per 100 epithelial cells. BrdU Incorporation Assay in Mammary Tissues: For BrdU incorporation assay, 12 weeks old virgin mice were intraperitoneally injected with BrdU at 100 g/g body weight, 2 hours prior to sacrifice, to label cells in the S phase. The inguinal glands were removed, fixed in formalin, embedded in paraffin and sectioned. Following deparaffinization and rehydration, the sections were washed in phosphate-buffered saline (PBS) and quenched for endogenous peroxidase with 6% (v/v) H 2 O 2 for 30 mins. After digestion with 0.02% pepsin at 37 0 C for 30 mins, the sections were treated with 2N HCl for 45 minutes and then neutralized in 0.1 M sodium borate, ph 8.5, for 10 mins. Following a 30 mins of blocking step with 10% (w/v) horse serum in PBS, the tissue sections were incubated overnight with a biotin-conjugated monoclonal antibody directed against BrdU (1:50 dilution) at 4 0 C in a humidified chamber. After three washes with PBS, biotin-avidin binding and detection were carried out according to the manufacturer s recommended protocol. To enhance contrast,

7 sections were counterstained with hematoxylin. Images were captured digitally using a Carl Zeiss coupled with digital camera and were processed for printing using Adobe Photoshop program. Supplemental Tables: Table 1: List of cdna qpcr primers. Species Gene Forward Primer Reverse Primer Mouse Human Calnexin CCGAAGAGTAGTTGATGATTG CCAGAACAGCAGAAGAGG PR CAGATTCAGAAGCCAGCCAGAG CCACAGGTAAGCACGCCATAG E6-AP CTGAGGCACTGGTTCTGAG CTTCTGAGTCTTCTTCCATAGC Wnt4 ACTCCCTCCCTGTCTTTG CACACTTCTCCAGTTCTCC ER GAAGCACAAGCGTCAGAG GGTTCAGCATCCAACAAGG Calnexin CGAAGAATAGTTGATGATTGG ACAGCAGAAGAGGATAACC PR CAAAACCTGACACCTCCAGTT GCCACATGGTAAGGCATAATGA E6-AP GGACTCGTGTCTGATTAGG AAGCAAGTATGAGATGTAGG FKBP51 TCAGCCAGCCTCCTTGTG CTCTCACTCGCTCATTATCATTGC Wnt4 ATGATGCTCTGACAACATCGCCTA AGCACGTCTTTACCTCACAGG ER GCTGCTGGCTACATCATC AGGACTCGGTGGATATGG Table 2: List of putative Wnt4 PRE region specific qpcr primers. Gene Locus Wnt4 PRE 1 Wnt4 PRE 2 Wnt4 PRE 3 Sense Primer ACATACCAGGGCACAACATTTGAG CCTGTAAATGGAACTAAGAAC CCTTTACACACCTTATCTACTG Antisense Primer CCAGGCTACCAGGCATAGACC AATGTCAGTAGTAAGAGTGC CTCTGGGACTGGCATTTG

8 Wnt4 PRE 4 Wnt4 PRE 5 Wnt4 PRE 6 CCTGGTTTGTGGTGTGTG CAGCAGAGTGACAGAGTTC TAGAAGTCTGCCATTGTG TGGCTAAGACCTGACTGG CAGAGCCTTGAGCCTACC AGAAGGTTGAATCTGAGC Figure Legends. Fig S1. Comparison of mammary gland morphology between E6-AP transgenic mice and their wildtype non-transgenic littermates using whole mount analysis. Mammary glands with representative morphology during 15 days pregnant, 10 days lactating and 8 weeks involuting are presented. Fig S2. Comparison of mammary gland morphology between E6-AP C833S transgenic mice and their wildtype non-transgenic littermates using whole mount analysis. Mammary glands with representative morphology during 15 days pregnant, 10 days lactating and 8 weeks involuting are presented. Fig S3. Comparison of mammary gland morphology between E6-AP KO transgenic mice and their wildtype non-transgenic littermates using whole mount analysis. Mammary glands with representative morphology during 15 days pregnant, 10 days lactating and 8 weeks involuting are presented. Fig S4. Immunohistochemical analysis of ER-α and PR in E6-AP transgenic mice mammary tissue. ER-α and PR are predominantly expressed in epithelial compartment of mouse mammary gland. Paraffinembedded total mammary tissue from E6-AP transgenic mice and age matched wild type mice were processed for immunohistochemistry using anti-er-α and anti-pr antibodies. Positive nuclei are stained brown, and nonexpressing nuclei are purple. Fig S5. Immunohistochemical analysis of ER-α and PR in E6-AP C833S transgenic mice mammary tissue. ER-α and PR are predominantly expressed in epithelial compartment of mouse mammary gland. Paraffinembedded total mammary tissue from E6-AP C833S transgenic mice and age matched wild-type mice were

9 processed for immunohistochemistry using anti-er-α and anti-pr antibodies. Positive nuclei are stained brown, and nonexpressing nuclei are purple. Fig S6. Immunohistochemical analysis of ER-α and PR in E6-AP KO transgenic mice mammary tissue. ER-α and PR are predominantly expressed in epithelial compartment of mouse mammary gland. Paraffinembedded total mammary tissue from E6-AP KO transgenic mice and wild-type mice were processed for immunohistochemistry using anti-er-α and anti-pr antibodies. Positive nuclei are stained brown, and nonexpressing nuclei are purple. Fig S7. Down regulation of E6-AP results in the up-regulation of genes regulated by PR-A and B. T47D cells treated with sie6-ap or siscramble for 48 hrs followed by progesterone treatment for 2, 4, 6 and 8hrs. Total RNA extracted at different progesterone treatment time points was used in RT-PCR analysis using primer specific for PR-A and B target gene HSDIIB2. Results from three different experiments were averaged and plotted as relative mrna levels. Error bars represent 5% of the average quantitated results. Fig S8. Down regulation of E6-AP results in the up-regulation of genes regulated by PR-A and B. T47D cells treated with sie6-ap or siscramble for 48 hrs followed by progesterone treatment for 2, 4, 6 and 8hrs. Total RNA extracted at different progesterone treatment time points was used in RT-PCR analysis using primer specific for PR-A and B target gene FKBP51. Results from three different experiments were averaged and plotted as relative mrna levels. Error bars represent 5% of the average quantitated results. Fig S9. Down regulation of E6-AP results in the up-regulation of Wnt-4 transcription. T47D cells treated with sie6-ap or siscramble for 48 hrs followed by progesterone treatment for 2, 4, 6 and 8hrs. Total RNA extracted at different progesterone treatment time points was used in RT- PCR analysis using primer specific for Wnt-4. Results from three different experiments were

10 averaged and plotted as relative mrna levels. Error bars represent 5% of the average quantitated results. Fig S10. Immunohistochemical analysis of mammary epithelial cell proliferation. Immunohistochemistry was performed to detect BrdU incorporation in mammary epithelial cells of in E6-AP transgenic mice, E6-AP C833S transgenic mice and E6-AP KO mice. Positive nuclei are stained brown, and negative nuclei are purple. Fig S11. Immunohistochemical analysis of apoptosis in mammary epithelial cells. TUNEL assay was performed to detect apoptosis in mammary epithelial cells of in E6-AP transgenic mice, E6-AP C833S transgenic mice and E6-AP KO mice. Positive nuclei are stained brown, and negative nuclei are purple. Fig S12. E6-AP influences cell proliferation through regulation of PR-B: a. Propidium iodide staining/fac Scan analysis of T47D cells treated with control sirna and sie6-ap for 48 hrs followed by progesterone or vehicle or both progesterone and RU486 treatment for 18 hrs. The graph represents the summarized percentage of cells in S phase from three independent experiments (mean ± SD, 3 separate experiments). b. BrdU incorporation in T47D cells treated with control sirna and sie6-ap for 48 hrs followed by progesterone or vehicle or both progesterone and RU486 treatment for 18 hrs. The data is represented as mean ± standard deviation.

11 Ramamoorthy-Supplementary Figures S1. E6-AP 15D pregnant E6-AP 10D Lactating E6-AP 8 weeks Involuting

12 Ramamoorthy-Supplementary Figures S2. E6-AP C833S 15D pregnant E6-AP C833S 10D Lactating E6-AP C833S 8 weeks Involuting

13 Ramamoorthy-Supplementary Figures S3. E6-AP KO KO 15D pregnant E6-AP KO 10D Lactating E6-AP KO 8 weeks Involuting

14 S4. Ramamoorthy-Supplementary Figures E6-AP ER-α PR E6-AP S5. E6-AP C833S ER-α E6-AP C833S PR

15 Ramamoorthy-Supplementary Figures S6. E6-AP (+/+) E6-AP (-/-) ER-α E6-AP (+/+) E6-AP (-/-) PR

16 Ramamoorthy-Supplementary Figures S7. 16 HSDIIB2 siscramble Relative mrna level sie6-ap Hours after progesterone treatment S8. Relative mrna level FKBP51 siscramble sie6-ap Hours after progesterone treatment S9. Relative mrna level Wnt-4 siscramble sie6-ap Hours after progesterone treatment

17 Ramamoorthy-Supplementary Figures S10. E6-AP E6-AP C833S E6-AP KO

18 Ramamoorthy-Supplementary Figures S11. E6-AP E6-AP C833S E6-AP KO

19 Ramamoorthy-Supplementary Figures S12. a. Percentage of BrdU positive cells P +P +P & RU486 n = 3 siscramble sie6-ap b. Percentage of cells in S phase P +P +P & RU486 n = 3 siscramble sie6-ap