Supplementary methods Shoc2 In Vitro Ubiquitination Assay
|
|
|
- Adela Townsend
- 5 years ago
- Views:
Transcription
1 Supplementary methods Shoc2 In Vitro Ubiquitination Assay 35 S-labelled Shoc2 was prepared using a TNT quick Coupled transcription/ translation System (Promega) as recommended by manufacturer. For the ubiquitination assay 5 µl of synthesized 35 S- Shoc2 was combined with GST-HECT (2 µg), Mg-ATP (4µM), His-Ub (5µg), His6 UbE1 ( nm), GST-UbcH5a (200 nm) in a buffer ( mm Tris-HCl ph 7.5, 2.5 mm MgCl2, 0.2 mm DTT and 2 mm ATP) and incubated for 90 min at 37 C. Shoc2 was immunoprecipitated using anti-shoc2 antibody (Proteintech) and eluted into 2X Laemmli sample buffer. Samples were resolved by SDS-PAGE and immunoblotted anti-ubiquitin antibody (Covance). His-Ub was detected using enhanced chemiluminescence detection, followed by Shoc2 detection using phosphor imaging system Typhoon FLA 90 (GE). Fluorescence Imaging of Living Cells: Cells were plated 24 hours before the experiment onto 35-mm glass-bottom dishes (Mattek). All images were acquired using a Mariannas Imaging system consisting of a Zeiss inverted microscope equipped with a cooled CCD CoolSnap HQ (Roper, CA), dual filter wheels and a Xenon 1 W light source, all controlled by SlideBook 5.32 software (Intelligent Imaging Innovations, Denver, CO). The detection of tag YFP fluorescence was performed using a YFP channel. Images were acquired using 2x2 binning mode. Image analysis was performed using the SlideBook 5.32 software. The final arrangement of images was performed using adobe Photoshop (Adobe Systems, Mountain View, CA). Supplementary Figures Legends Supplementary Figure 1 (A) 293FT cells were co-transfected with HA-HECT (W/T), HA-HECT (C/A) and GST-Shoc2. GST- Shoc2 immunoprecipitates were analyzed by immune-blot using HA and GST antibodies. (B) GST-HECT proteins were affinity purified, separated by SDS-PACE and visualized by SYPRO Ruby Protein Gel Staining. (C) MBP-Shoc2 proteins were affinity purified, separated by SDS-PACE, visualized by SYPRO Ruby Protein Gel Staining (left panel; SR), and detected with anti-shoc2 antibody (right panel; IB). Supplementary Figure 2
2 (A) GST-Shoc2 was immunoprecipitated from 293FT cells in presence of SDS. Shoc2 ubiquitination was detected with anti-ub antibody. (B) GST-Shoc2 was immunoprecipitated from 293FT cells co-transfected with HA-Ub. Cells were treated with the proteasome inhibitor MG132. Shoc2 ubiquitination was detected with anti-ha antibody. (C) 35 S-labeled, in vitro translated Shoc2 ( 35 S-Shoc2) was monitored by autoradiography. (D) in vitro ubiquitination assays were performed with 35 S -labeled, in vitro translated Shoc2 ( 35 S- Shoc2). Shoc2 was immunoprecipitated using anti-shoc2 antibody and separated by SDS-PACE. 35 S- Shoc2 ubiquitination was detected with anti-ub antibody. Supplementary Figure 3 Cos-NT, Cos-LV1 and Cos-SR cells were transiently transfected with HUWE1 sirna. 48 hours posttransfection cells were treated with MG132. RAF-1 was precipitated using anti-raf-1 antibody. RAF- 1 ubiquitination was detected with anti-ub antibody. The expression of HUWE1, RAF-1 and Shoc2 was analyzed using specific antibodies. IP-immunoprecipitation, IB-immuno-blot, NT-non-targeting sirna, H-HUWE1 sirna. Supplementary Figure 4 T47D cells were transiently transfected with HUWE sirna as indicated. 48 hours after transfection cells were starved for 16 hours, then treated with EGF and harvested for immunoblotting. The expression of Shoc2, HUWE1, RAF-1, perk1/2, total ERK1/2 and GAPDH was analyzed using specific antibodies. Supplementary Figure 5 (A) A representative spectra that demonstrate ubiquitination at Lys 369 of Shoc2. (B) 293FT cells were co-transfected with Shoc2(WT)-YFP, Shoc2(7KR)-YFP, HA-M-RAS or GST- RAF-1. Both of Shoc2(WT)-YFP and Shoc2(7KR)-YFP were detected in HA-M-RAS and GST-RAF- 1 immunoprecipitates. Immunoprecipitates were analyzed by immunoblot using HA, RAF-1 and Shoc2 antibodies. (C) Cellular distribution of the Shoc2(WT)-YFP and Shoc2(7KR)-YFP in HeLa cells constitutively expressing Shoc2, scale bar, 10 µm.
3 (D) HeLa cells constitutively expressing Shoc2-YFP or the Shoc2 (7KR)-YFP were treated with cycloheximide (30µM) for 4, 8, 15 and 24 hours. Protein levels were verified by western blot using anti-shoc2, anti-cyclin D1 and anti-gapdh antibodies. Supplementary Figure 6 (A) Cos-SY cells stably expressing either Shoc2(WT)-YFP or Shoc2(7KR)-YFP were transiently transfected with HUWE1 sirna. 48 hours post-transfection cells were serum-starved for 16 hours and stimulated with EGF. The expression of indicated proteins was analyzed using specific antibodies. NTnon-targeting sirna. (B) Cos-SY cells stably expressing either Shoc2(WT)-YFP or Shoc2(7KR)-YFP were serum starved and treated with EGF. The cell lysates were probed for phosphorylated RAF-1(p338), phosphorylated MEK1/2, phosphorylated ERK1/2, RAF-1 and GAPDH. The experiment is representative of three independent experiments. (C) Cos-SR cells were transfected with GST-RAF hours post-transfection cells were serumstarved for 16 hours and stimulated with EGF for 7 min. The expression of RAF-1, perk1/2 and GAPDH was analyzed using specific antibodies (D) Equal numbers of Cos-SY cells constitutively expressing either Shoc2(WT)-YFP or Shoc2(7KR)- YFP mutant of Shoc2 were plated onto 24 wells, and the numbers were counted 24, 48, 72 hours after seeding. The graph depicts the mean number of triplicate experiments ±SD. (E) Cell viability of Cos-SY cells constitutively expressing either Shoc2(WT)-YFP or Shoc2(7KR)- YFP mutant of Shoc2 was measured using the MTS assay 24, 48, 72, 96 hours after seeding. Cell viability was measured using the CellTiter 96 Aqueous One Solution Cell Proliferation Assay. The graph depicts the mean number of triplicate experiments ±SD.
4 input IP: GST Supplemental Figure 1 A. WT C/A HA-HECT Shoc2-GST B. C. MW GST-HECT MBP-Shoc2 IB:HA IB:GST MBP-Shoc2 Shoc2 IB:HA IB:GST SR IB
5 Supplemental Figure 2 A. tor ec v MW ST 2-G c ho B. S MW IP: GST IB: Ub IP: GST MG-132 HA-Ub Shoc2-GST 200 IB:HA IB: GST Input IB: GST IB: GST Input C. D. MW MW 35 S-Shoc2 IP: Shoc2 1.5 ml 2 IB: Ub 35 S-Shoc2 GST-HECT Shoc2 E1E2ATP Ub
6 IP: RAF-1 Supplemental Figure 3 Cos-NT Cos-LV1 Cos-SR NT H NT H NT H sirna fold IB: Ub lysate 2 IB: HUWE fold
7 Supplemental Figure 4 HUWE1 NT sirna HUWE1 Shoc2 RAF-1 perk1/2 terk1/2 GAPDH min EGF
8 lysate IP:GST or HA Supplemental Figure 5 A. y K GG y y y 4 y y y y Relative Abundance b b b b 6 b b 6 -NH₃ y 10 y 9 y 8 y 7 y 6 y 5 y 4 y 3 y 2 I N K GG I P F G I F S R b 2 b 3 b 4 b 5 b 6 b 7 b 8 b 9 b m/z b b b B Shoc2(WT) Shoc2(7KR) HA-M-Ras GST-RAF-1 C. Shoc2-Y IB: HA Shoc2(7KR)-Y IB: HA D. Shoc2(WT)-Y Shoc2(7KR)-Y hrs (CHX 30mM) IB: Cyclin D1
9 Supplemental Figure 6 A. WT NT HUWE1 NT 7KR HUWE1 sirna IB: HUWE1 B. Cos-SY WT 7KR fold min IB: perk1/ fold (p338) IB: pmek1/ fold IB: perk1/ min D. E. C. - - GST-RAF-1 RAF-1 perk1/2 Cell Number ( 10 4 ) Shoc2-7KR Shoc2-WT Cos-SY OD Shoc2-7KR Shoc2-WT Cos-SY GAPDH min Time (hours) Time (hours)
Supplementary information
Supplementary information The E3 ligase RNF8 regulates KU80 removal and NHEJ repair Lin Feng 1, Junjie Chen 1 1 Department of Experimental Radiation Oncology, The University of Texas M. D. Anderson Cancer
SUPPLEMENTARY INFORMATION
doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Nakajima and Tanoue, http://www.jcb.org/cgi/content/full/jcb.201104118/dc1 Figure S1. DLD-1 cells exhibit the characteristic morphology
Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
Supplementary Figure S1 Purification of deubiquitinases HEK293 cells were transfected with the indicated DUB-expressing plasmids.
Supplementary Figure S1 Purification of deubiquitinases HEK293 cells were transfected with the indicated DUB-expressing plasmids. The cells were harvested 72 h after transfection. FLAG-tagged deubiquitinases
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently
Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide,
Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, conjugated with either TAT or Myristic acid and biotin for
SUPPLEMENTARY INFORMATION
The Supplementary Information (SI) Methods Cell culture and transfections H1299, U2OS, 293, HeLa cells were maintained in DMEM medium supplemented with 10% fetal bovine serum. H1299 and 293 cells were
Supplemental Materials and Methods
Supplemental Materials and Methods Co-immunoprecipitation (Co-IP) assay Cells were lysed with NETN buffer (20 mm Tris-HCl, ph 8.0, 0 mm NaCl, 1 mm EDT, 0.5% Nonidet P-40) containing 50 mm β-glycerophosphate,
At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
supplementary information
DOI: 10.1038/ncb2116 Figure S1 CDK phosphorylation of EZH2 in cells. (a) Comparison of candidate CDK phosphorylation sites on EZH2 with known CDK substrates by multiple sequence alignments. (b) CDK1 and
Supplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells.
Supplementary Fig. 1 Supplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells. (a) FRTL-5 cells were treated with 1 mm dibutyryl camp for 24 h, and the lysates
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/429/ra54/dc1 Supplementary Materials for Dephosphorylation of the adaptor LAT and phospholipase C by SHP-1 inhibits natural killer cell cytotoxicity Omri Matalon,
Supplementary Materials
Supplementary Materials Supplementary Figure 1. PKM2 interacts with MLC2 in cytokinesis. a, U87, U87/EGFRvIII, and HeLa cells in cytokinesis were immunostained with DAPI and an anti-pkm2 antibody. Thirty
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2271 Supplementary Figure a! WM266.4 mock WM266.4 #7 sirna WM266.4 #10 sirna SKMEL28 mock SKMEL28 #7 sirna SKMEL28 #10 sirna WM1361 mock WM1361 #7 sirna WM1361 #10 sirna 9 WM266. WM136
MEFs were treated with the indicated concentrations of LLOMe for three hours, washed
Supplementary Materials and Methods Cell Fractionation MEFs were treated with the indicated concentrations of LLOMe for three hours, washed with ice-cold PBS, collected by centrifugation, and then homogenized
seminal vesicle thymus kidney lung liver
a 1 HEK293 1 B 3 3 T GFPSMAD TGFβ (T)/ BMP (B) IB: SMAD1/3TP IB: GFP b wild type mouse tissue kidney thymus seminal vesicle liver lung brain adipose tissue muscle pancreas heart uterus spleen testis IB:
Coleman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
Regulation of autophagic activity by ζ proteins associated with class III. phosphatidylinositol-3 kinase. Mercedes Pozuelo Rubio
ONLINE SUPPORTING INFORMATION Regulation of autophagic activity by 14-3-3ζ proteins associated with class III phosphatidylinositol-3 kinase Mercedes Pozuelo Rubio entro Andaluz de Biología Molecular y
Supplementary Material
Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated
Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.
Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of
Supplementary material for: Materials and Methods:
Supplementary material for: Iron-responsive degradation of iron regulatory protein 1 does not require the Fe-S cluster: S.L. Clarke, et al. Materials and Methods: Fe-S Cluster Reconstitution: Cells treated
JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Hong et al.,
Supplemental material JCB Hong et al., http://www.jcb.org/cgi/content/full/jcb.201412127/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Analysis of purified proteins by SDS-PAGE and pull-down assays. (A) Coomassie-stained
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/404/ra120/dc1 Supplementary Materials for The subcellular localization and activity of cortactin is regulated by acetylation and interaction with Keap1 Akihiro
Post-translational modification
Protein expression Western blotting, is a widely used and accepted technique to detect levels of protein expression in a cell or tissue extract. This technique measures protein levels in a biological sample
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
SUPPLEMENTARY INFORMATION FILE
SUPPLEMENTARY INFORMATION FILE Existence of a microrna pathway in anucleate platelets Patricia Landry, Isabelle Plante, Dominique L. Ouellet, Marjorie P. Perron, Guy Rousseau & Patrick Provost 1. SUPPLEMENTARY
Supplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after
Supplementary Information: Materials and Methods Recombinant protein expression and in vitro kinase assay. GST and GST-p53 were purified according to standard protocol after induction with.5mm IPTG for
Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr
Supplemental figure legends Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr A, LβT2 cells were transfected with either scrambled or PEA-15 sirna. Cells were then
Supporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
Hossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
Supplementary Information
Supplementary Information Supplementary Figures Supplementary Figure 1. MLK1-4 phosphorylate MEK in the presence of RAF inhibitors. (a) H157 cells were transiently transfected with Flag- or HA-tagged MLK1-4
Supplemental Figure Legends:
Supplemental Figure Legends: Fig S1. GFP-ABRO1 localization. U2OS cells were infected with retrovirus expressing GFP- ABRO1. The cells were fixed with 3.6% formaldehyde and stained with antibodies against
Sarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/304/ra104/dc1 Supplementary Materials for Lysine Methylation Promotes VEGFR-2 Activation and Angiogenesis Edward J. Hartsough, Rosana D. Meyer, Vipul Chitalia,
This is the author's accepted version of the manuscript.
This is the author's accepted version of the manuscript. The definitive version is published in Nature Communications Online Edition: 2015/4/16 (Japan time), doi:10.1038/ncomms7780. The final version published
pt7ht vector and over-expressed in E. coli as inclusion bodies. Cells were lysed in 6 M
Supplementary Methods MIG6 production, purification, inhibition, and kinase assays MIG6 segment 1 (30mer, residues 334 364) peptide was synthesized using standard solid-phase peptide synthesis as described
HPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,
1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung
MCF10A cells were trypsinized and attached onto fibronectin-coated petri dishes
Supplemental Information Supplemental figure legends Figure S. Supplemental figure for Fig... Different methods of cell detachment similarly induce YP phosphorylation. MCF0 cells were trypsinized and attached
Supplemental Figure 1
Supplemental Fig. 1. Kinetics of,,, AKT and ERK activation in BMMCs following SCF stimulation. Starved BMMCs were stimulated with 250ng/mL of SCF for the indicated time. Soluble Cell Lysates (SCLs) were
Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells
Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells Ryosuke Horie. Kagawa University of medecine, Kita-gun, Japan. Disclosures: R. Horie: None.
Cdc42 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Cdc42 Activation Assay Kit Catalog Number: 80701 20 assays 1 Table of Content Product Description 3 Assay
Supplementary Figure Legend
Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss
Supporting Information
Supporting Information Üstün and Börnke, 2015 Figure S1: XopJ does not display acetyltransferase activity. Autoacetylation activity in vitro. Acetylation reactions using MBP, MBP-XopJ, GST and GST-HopZ1a
Journal of Cell Science Supplementary Material
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal
monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in
Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal
SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION
SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,
Figure S1. GST-MDA-7 toxicity in GBM cells is dependent on cathepsin proteases, and weakly
Supplemental Figure Legends. Figure S1. GST-MDA-7 toxicity in GBM cells is dependent on cathepsin proteases, and weakly dependent on caspase 8. GBM6 and GBM12 cells were treated 24 h after plating with
RheB Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based RheB Activation Assay Kit Catalog Number: 81201 20 assays NewEast Biosciences 1 FAX: 610-945-2008 Table
Figure S1. USP-46 is expressed in several tissues including the nervous system
Supplemental Figure legends Figure S1. USP-46 is expressed in several tissues including the nervous system Transgenic animals expressing a transcriptional reporter (P::GFP) were imaged using epifluorescence
Supplementary Materials and Methods
Supplementary Materials and Methods sirna sequences used in this study The sequences of Stealth Select RNAi for ALK and FLOT-1 were as follows: ALK sense no.1 (ALK): 5 -AAUACUGACAGCCACAGGCAAUGUC-3 ; ALK
Supplementary Fig.1 Luton
Supplementary Fig.1 Luton a 175 Brain Thymus Spleen Small Intestine Kidney Testis HeLa b 250 Lung Kidney MDCK c EFA6B si Control si Mismatch #637 #1564 #1770 83 62 47.5 175 IB: anti-efa6b #B1 130 66 Lysates
Supplementary Figure S1. N-terminal fragments of LRRK1 bind to Grb2.
Myc- HA-Grb2 Mr(K) 105 IP HA 75 25 105 1-1163 1-595 - + - + - + 1164-1989 Blot Myc HA total lysate 75 25 Myc HA Supplementary Figure S1. N-terminal fragments of bind to Grb2. COS7 cells were cotransfected
Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered
Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rainero et al., http://www.jcb.org/cgi/content/full/jcb.201109112/dc1 Figure S1. The expression of DGK- is reduced upon transfection
M X 500 µl. M X 1000 µl
GeneGlide TM sirna Transfection Reagent (Catalog # M1081-300, -500, -1000; Store at 4 C) I. Introduction: BioVision s GeneGlide TM sirna Transfection reagent is a cationic proprietary polymer/lipid formulation,
Supplementary Figure 1. Immunoprecipitation of synthetic SUMOm-remnant peptides using UMO monoclonal antibody. (a) LC-MS analyses of tryptic
Supplementary Figure 1. Immunoprecipitation of synthetic SUMOm-remnant peptides using UMO 1-7-7 monoclonal antibody. (a) LC-MS analyses of tryptic digest from HEK293 cells spiked with 6 SUMOmremnant peptides
Supplementary Information
Supplementary Information Supplementary Figure 1. Elevated Smurf1 expression is associated with the progression of colorectal cancer. (a) The tumor microarray analysis with anti-smurf1 antibody. (b) Box
Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the
Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the prey clones identified in the yeast two hybrid screen.
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION SUPPLEMENTARY MATERIALS AND METHODS Antibodies and sirna The antibodies against BAF170, BAF155, BAF60a, BAF57 and BAF53 were purchased from Santa Cruz (TX), and the antibodies
Supplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions.
Supplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions. 1 (a) Etoposide treatment gradually changes acetylation level and co-chaperone
Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated
Supplementary Figure Legends Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated with either vehicle (left; n=3) or CCl 4 (right; n=3) were co-immunostained for NRP-1 (green)
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2743 Figure S1 stabilizes cellular protein level, post-transcriptionally. (a, b) and DDR1 were RNAi-depleted from HEK.293.-CBG cells. Western blots with indicated antibodies (a). RT-PCRs
Supplemental Figure 1
Supplemental Figure 1 A C19 B Mα p27 TL p27-/- p27-/- Supplemental Figure 1: Altered expression of p27 and p27 in the brain. Immunostaining for p27 was performed on brain frozen sections. Brain sections
Supplementary Figure 1.
Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed
Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of
Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated
VCP adaptor interactions are exceptionally dynamic and subject to differential modulation by a VCP inhibitor
VCP adaptor interactions are exceptionally dynamic and subject to differential modulation by a VCP inhibitor Liang Xue 1, Emily E. Blythe 1, Elyse C. Freiberger 2, Jennifer Mamrosh 1, Alexander S. Hebert
Flag-Rac Vector V12 V12 N17 C40. Vector C40 pakt (T308) Akt1. Myc-DN-PAK1 (N-SP)
a b FlagRac FlagRac V2 V2 N7 C4 V2 V2 N7 C4 p (T38) p (S99, S24) p Flag (Rac) NIH 3T3 COS c +Serum p (T38) MycDN (NSP) Mycp27 3 6 2 3 6 2 3 6 2 min p Myc ( or p27) Figure S (a) Effects of Rac mutants on
Androgen Receptor (Phospho-Tyr363) Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG02138
Androgen Receptor (Phospho-Tyr363) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02138 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research
Supplementary information
Supplementary information Table of Content: Supplementary Results... 2 Supplementary Figure S1: Experimental validation of AP-MS results by coimmunprecipitation Western blot analysis.... 3 Supplementary
Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3
ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated
ab Ubiquitylation Assay Kit
ab139467 Ubiquitylation Assay Kit Instructions for Use For the activation of ubiquitin for use in ubiquitylation experiments This product is for research use only and is not intended for diagnostic use.
SUPPLEMENTARY INFORMATION
Figure S1 The effect of T198A mutation on p27 stability. a, Hoechst 33342 staining for nuclei (see Fig 1d). Scale bar, 100 μm. b, Densitometric analysis of wild type and mutant p27 protein levels represented
DOI: 10.1038/ncb3259 A Ismail et al. Supplementary Figure 1 B 60000 45000 SSC 30000 15000 Live cells 0 0 15000 30000 45000 60000 FSC- PARR 60000 45000 PARR Width 30000 FSC- 15000 Single cells 0 0 15000
Ubiquitin (76 aa) UB genes encode linear fusions of UB either to itself (poly-ub genes) or to other proteins these fusions are cleaved by
Ubiquitin (76 aa) UB genes encode linear fusions of UB either to itself (poly-ub genes) or to other proteins these fusions are cleaved by deubiquitylases (DUBs) yielding mature Ub deubiquitylase FLAG 3
Supplemental Data Supplementary Figure Legends and Scheme Figure S1.
Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,
Erk activation drives intestinal tumorigenesis in Apc min/+ mice
correction notice Nat. Med. 16, 665 670 (2010) Erk activation drives intestinal tumorigenesis in Apc min/+ mice Sung Hee Lee, Li-Li Hu, Jose Gonzalez-Navajas, Geom Seog Seo, Carol Shen, Jonathan Brick,
Nature Structural & Molecular Biology: doi: /nsmb.1583
Acetylation by GCN5 regulates CDC6 phosphorylation in the S-phase of the cell cycle Roberta Paolinelli 1,2, Ramiro Mendoza-Maldonado 2, Anna Cereseto 1 and Mauro Giacca 2 1 Molecular Biology Laboratory,
Rab5 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Rab5 Activation Assay Kit Catalog Number: 83701 20 assays 24 Whitewoods Lane 1 Table of Content Product
Supplementary Figures
Supplementary Figures 11 1 1 Supplementary Figure 1. Clinical features of EBS cases with KLHL mutations. (a) Photo of Patient 1 s hands showing mild atrophic skin and unaffected finger nails. (b) The skin
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1 Effect of ROCK inhibition on lumen abnormality in MDCK cysts. (A) MDCK cells as indicated cultured in Matrigel were treated with and without Y27632 (10
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2386 Figure 1 Src-containing puncta are not focal adhesions, podosomes or endosomes. (a) FAK-/- were stained with anti-py416 Src (green) and either (in red) the focal adhesion protein paxillin,
Supplementary Fig. 1
a FL (1-2266) NL (1-1190) CL (1191-2266) HA-ICE1: - HA-ICE1: - - - FLAG-ICE2: + + + + FLAG-ELL: + + + + + + IP: anti-ha FLAG-ICE2 HA-ICE1-FL HA-ICE1-NL HA-ICE1-CL FLAG-ICE2 b IP: anti-ha FL (1-2266) NL
Nanog-Luc. R-Luc. 40 HA-Klf Relative protein level of Klf USP21. Vector USP2 USP21 *** *** *** ***
:Flag Relative protein level of Relative protein level of : Flag Vec 21LV 21SV 2 : HA HA- HA- HA- HA-Klf4 Relative mrna expression Relative protein level of Relative protein level of Relative protein level
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Moutin et al., http://www.jcb.org/cgi/content/full/jcb.201110101/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Tagged Homer1a and Homer are functional and display different
Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.
Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length
Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated
Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated reporter luciferase constructs, HEK293T cells were stimulated
Sapphire. Biomolecular Imager THE NEXT GENERATION OF LASER-BASED IMAGING
Sapphire Biomolecular Imager THE NEXT GENERATION OF LASER-BASED IMAGING Breakthrough image capture and analysis The Sapphire Biomolecular Imager is a next generation laser scanning system that provides
Supplemental Data. Zhang et al. Plant Cell (2014) /tpc
Supplemental Data. Zhang et al. Plant Cell (214) 1.115/tpc.114.134163 55 - T C N SDIRIP1-GFP 35-25 - Psb 18 - Histone H3 Supplemental Figure 1. Detection of SDIRIP1-GFP in the nuclear fraction by Western
supplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
Supplemental Information: Phosphorylation of CLIP-170 by Both Plk1 and CK2 Is Involved in the Timely Formation of Kinetochore-microtubule Attachments
Supplemental Information: Phosphorylation of CLIP-170 by Both Plk1 and CK2 Is Involved in the Timely Formation of Kinetochore-microtubule Attachments Hongchang Li, X. Shawn Liu, Xiaoming Yang, Yingmin
Supplementary Fig. 1 Kinetics of appearence of the faster migrating form of Bcl-10.
α-cd3 + α-cd28: Time (min): + + + + + + + + + 0 5 15 30 60 120 180 240 300 360 360 n.s. Supplementary Fig. 1 Kinetics of appearence of the faster migrating form of. Immunoblot of lysates from Jurkat cells
Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and
Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary
Supplemental Data. Furlan et al. Plant Cell (2017) /tpc
Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Figure.