Defining the Activities and Specificities of CRISPR Nucleases in Human Cells

Transcription

1 Defining the Activities and Specificities of CRISPR Nucleases in Human Cells CRISPR Congress Ben Kleinstiver Joung Lab Massachusetts General Hospital Harvard Medical School February 21 st, 2017

2 Areas of interest in the Joung lab 1) Genome editing Zinc-finger nucleases TALENs CRISPR/Cas9 Homing endonucleases 2) Epigenome engineering VP64 / KRAB / Tet1, etc. TALENs & CRISPR/Cas92 3) Safety and broad utility of nucleases Characterizing specificity (tools to define it) Improving genome-wide specificity Expanding targeting range Enhancing efficiency

3 For engineered nucleases to be broadly useful, some considerations: Activity Specificity Targeting Edit outcome Delivery etc.

4 GUIDE-seq to assess genome-wide specificity S. pyogenes Cas9 Tsai and Zheng et al., Nature Biotechnology, 2015 S. pyogenes Cas9 PAM variants Kleinstiver et al., Nature, 2015 S. aureus Cas9 Friedland et al., Genome Biology, 2015 S. aureus Cas9 PAM variants Kleinstiver et al., Nature Biotechnology, 2015 S. pyogenes Cas9 zinc-finger fusions Bolukbasi et al., Nature Methods, 2015 S. pyogenes Cas9 high-fidelity Kleinstiver and Pattanayak et al., Nature, 2016 AsCpf1 and LbCpf1 Kleinstiver and Tsai et al., Nature Biotechnology, 2016

5 Cas9 engineering 1. Improve specificity Kleinstiver and Pattanayak et al., Nature, 2016 Kleinstiver & Pattanayak et al., Nature, 2016

6 Nucleases with altered / improved properties 1. Improve specificity Kleinstiver and Pattanayak et al., Nature, Alter PAM recognition SpCas9 Kleinstiver et al., Nature, 2015 SaCas9 Kleinstiver et al., Nature Biotechnology, 2015

7 CRISPR Cas9 vs. Cpf1 nucleases 1. PAM preference and polarity 2. DNA break (PAM distal and staggered) 3. Single short crrna

8 AsCpf1 and LbCpf1 activity at 19 endogenous sites Kleinstiver & Tsai et al., Nature Biotechnology, 2016

9 AsCpf1 and LbCpf1 activity on matched SpCas9 sites Kleinstiver & Tsai et al., Nature Biotechnology, 2016

10 As/LbCpf1 crrna length tolerance Kleinstiver & Tsai et al., Nature Biotechnology, 2016

11 Cpf1 Specificity PAM On-target Off-targets or

12 Methods to assess specificity 1) Assess mismatch 2) Off-target potential via GUIDE-seq tolerance / intolerance z Deliver nuclease and variant crrna(s) to cells Modification at intended site? TTTCCCTCACTCCTGCTGGTGAATTT TTTCCCTCACTCCTGCTGGT--ATTT TTTCCCTCACTCCTGC T

13 Double mismatch tolerance of As/LbCpf1 Cpf1s are intolerant of pairs of mismatches in most of the spacer sequence Kleinstiver & Tsai et al., Nature Biotechnology, 2016

14 Single mismatch tolerance of As/LbCpf1 Cpf1s are intolerant of single mismatches across much of the spacer sequence Kleinstiver & Tsai et al., Nature Biotechnology, 2016

15 Single mismatch tolerance of tru-crrnas

16 Single mismatch tolerance of tru-crrnas

17 PAM distal end of crrna not paired with DNA Kleinstiver & Tsai et al., Nature Biotechnology, 2016 Yamano et al., Cell, 2016

18 GUIDE-seq determined specificities of As/LbCpf1 Kleinstiver & Tsai et al., Nature Biotechnology, 2016

19 As/LbCpf1 GUIDE-seq (19/20 sites) Kleinstiver & Tsai et al., Nature Biotechnology, 2016

20 As/LbCpf1 GUIDE-seq (20 th site) Kleinstiver & Tsai et al., Nature Biotechnology, 2016

21 As/LbCpf1 off-targets sites detected by GUIDE-seq GUIDE-seq with SpCas9 and SpCas9-HF1 Kleinstiver & Tsai et al., Nature Biotechnology, 2016 Kleinstiver & Parranayak et al., Nature, 2016

22 Multiplex targeting with AsCpf1 and LbCpf1

23 Multiplex targeting with AsCpf1 and LbCpf1

24 Summary Cas9 engineering Improved genome-wide specificity with high-fidelity variants Improved targeting range with SpCas9 / SaCas9 PAM variants Cpf1 characterization Activity Robust on-target activity for a wide range of sites in U2OS, HEK293, Jurkat cells, etc. Specificity General intolerance to pairs of mismatches Single mismatch intolerance in parts of the spacer sequence Few off-targets detected by GUIDE-seq Targetability Non-canonical PAMs can be targeted (more so with LbCpf1) Other properties of interest Multiplex capability DNA overhangs

25 Acknowledgements J. Keith Joung Martin Aryee Michelle Prew Jose Lopez Moira Welch Shengdar Tsai Nhu Nguyen Alexander Sousa Vikram Pattanayak Ved Topkar Current/former members of the Joung lab