Genome-wide Target Specificity of CRISPR

Transcription

1 Genome-wide Target Specificity of CRISPR Jin-Soo Kim Dept of Chemistry, Seoul National Univ. Center for Genome Engineering, Institute for Basic Science 1

2 Programmable Nucleases CRISPR/Cas-derived RNA-guided endonuclease (RGEN)

3 Comparison of Programmable Nucleases ZFN TALEN CRISPR RGEN Success rate ~24% >99% ~90% Average mutation <10% ~20% ~20% rate Length of target site 20 to 36 bp 30 to 40 bp 23 bp Restriction in target site Guanine-rich Start with T and end with A End with GG (PAM) Design density One per ~100 bp One per every bp One per 8 bp Off-target effects High Low Variable Size 2 x ~2 kbp 2 x ~3 kbp 4.2 kbp + grna Kim H & Kim JS, Nat. Rev. Genet. (2014) 3

4 CRISPR: Adaptive Immune System in Bacteria Clusters of Regularly Interspaced Palindromic Repeats CRISPR-Cas9: RNA-guided programmable nucleases 4

5 CRISPR-Cas9 RNA-Guided Endonuclease Cas9 Guide RNA GG GG

6 Genome Editing in Human Cells via CRISPR-Cas9 Filed a patent application in Oct with evidences of human genome editing CRISPR genome editing patents issued in South Korea and Australia 6

7 Off-target Effects ZFNs, TALENs, and CRISPR-Cas9 can cleave off-target sites Off-target mutations can - Inactivate essential genes - Activate oncogenes - Cause chromosomal rearrangements Wu et al. Quant. Biol. (2014)

8 Unexpected Off-target Effects in vivo? Schaefer et al. Nat Methods 14, (2017).

9 No Evidence for CRISPR Off-target Mutations in Mice SNVs SNVs Indels Kim et al. Nature Methods, in press Schaefer et al. (Nature Methods, 2017) did not validate off-target effects Neglected SNVs and indels unique to the co-housed control mouse 9

10 Undetectable CRISPR Off-target Mutations No detectable off-target mutations at sites with 2- or 3-nucleotide mismatches Confirmed by targeted deep sequencing in Cho et al. Genome Res

11 Cas9 RNPs Reduce Off-target Effects AAVS1-S3 On Target S3 Off-1 S3 Off-2 GGGAGGGAGAGCTTGGCAGGgGG GGGAAGGGGAGCTTGGCAGGtGG GGGAAGGTGAGCTTGGCAGGtGG On Target S3 Off-1 S3 Off-2 Indel (%) < < Ratio (On/Off) > > Kim et al. Genome Res. (2014) Purified Cas9 ribonucleoproteins (RNPs) were transfected into cells. REGN RNPs are less prone to induce off-target mutations fold reductions are observed at several sites.

12 Rapid Turnover of Cas9 RNPs in Cells via Plasmid via RNP Time (h) Indel (%) Time (h) Anti-HA GAPDH RGEN RNPs cut target DNA immediately after transfection. RNPs are degraded rapidly in cells; - reducing off-target effects and mosaicism

13 RNA-Guided Gene KO in Animals Prof. Han-Woong Lee at Yonsei Univ. Purified Cas9 protein complexed w/ guide RNA was tested in vitro first. Active RGEN RNPs were injected into one-cell embryos. Not limited by promoters, mrna stability, codon usage, etc. RGEN RNPs induced mutations in mice, zebrafish, fruitfly, nematodes, etc. 13

14 DNA-free RNA-guided Genome Editing in Lettuce Woo & Kim et al. Nat. Biotechnol. (2015) Lettuce protoplasts were treated with purified Cas9 protein and grna Whole plants were regenerated from genome-edited protoplasts No exogenous DNA used: Possibly exempted from GMO regulation 14

15 DNA-free Genome Editing in Cabbage GSL-ALK Brassica oleracea Glucoraphanin Progoitrin 100 Control Da 1.10e6 m/z e6 100 Control Da 1.40e4 m/z e4 % % % mutation 1.81 m/z e Da 9.74e % 0.78 mutation Da 709 m/z Glucoraphanin Progoitrin Unpublished

16 How to Assess Genome-wide Off-target Effects Whole genome sequencing: Limited by sequencing depth Digenome-seq: Nuclease-digested whole genome seq. Cell-based methods: GUIDE-seq, Translocation seq., BLESS Kim et al. Nat. Methods (2015) Gabriel et al. Nat. Biotechnol. (2015)

17 Overview of Digenome-seq Kim et al. Nat. Methods (2015) 17

18 Staggered Alignment vs Straight Alignment (-) RGEN (+) RGEN After WGS, sequence reads were mapped to the reference human genome. Straight alignments of sequence reads are observed at the on-target site. 18

19 DNA Cleavage Score Sequence reads with the same 5 end are counted across the genome. DNA cleavage scores are assigned to each nucleotide position. 19

20 Genome-wide Cleavage Scores Genome (-) RGEN Digenome (+) RGEN Kim et al. Genome Res. (2016)

21 Off-target Sites Validated by Deep Sequencing 74 Digenome-captured sites were validated by targeted deep sequencing. Only five sites were mutated at frequencies ranging from 0.1 to 87%. 21

22 SpCas9 vs. Cpf1 SpCas9 Cpf1 NGG Guide RNA PAM sequence Cleavage pattern Cleavage position crrna + tracrrna (or sgrna) NGG Blunt ends PAM-proximal region crrna TTTN or TTN Staggered ends PAM-distal region Zetsche et al. Cell (2015)

23 Cpf1 specificity revealed by Digenome-seq SpCas9: 48 sites cleaved in vitro LbCpf1: 1 site cleaved in vitro AsCpf1: 1 site cleaved in vitro Cpf1 is a highly specific programmable nuclease in human cells. Kim & Kim et al. NBT (2016)

24 Cpf1 is more specific than SpCas9 Kim et al. NBT (2016) Kim et al. Genome Res. (2016) On average, SpCas9 cleaved 90 sites, on average, in the human genome. LbCpf1 and AsCpf1 cleaved 6 and 12 sites, respectively. 24

25 Cpf1 RNPs Reduce Off-target Effects Cpf1 RNPs did not induce any indels at four off-target sites 25

26 Digenome-seq vs Other Methods GUIDE-seq HTGTS

27 Digenome-seq Advantages Highly sensitive; Captures off-target sites w/ <0.1% indel freq. Not limited by chromatin accessibility Pinpoint off-target sites; no NHEJ-mediated indels in vitro Easy to carry out; no PCR steps prior to WGS Free form naturally-occurring DSBs in cells and PCR artifacts Compatible with RNA-guided programmable deaminases

28 Programmable Nuclease vs. Deaminase dcas9 or D10A Cas9 Deamination of target C Cystidine deaminase Komor et al. Nature (2016) Nishida et al. Science (2016) 28

29 Programmable Deaminases First-generation base editor (BE1) Second-generation base editor (BE2) Third-generation base editor (BE3) UGI APOBEC1 dcas9 APOBEC dcas9 UGI APOBEC ncas9 UGI Komor et al. Nature (2016) 29

30 DNA cleavage at uracil-containing sites 30

31 Digenome-seq of BE3-treated genomic DNA 31

32 Genome-wide BE3 off-target sites n = 13 n = 143 n = 3 n = 20 Kim et al. NBT (2017) 32

33 Cas9 and BE3 Off-target Sites EMX1 DNA seq at a cleavage sites Bulge EMX1_5 GAaTCCaAG-AGAAGAAGAATGG RNA bulge EMX1_8 GtGTCCtAG-AGAAGAAGAAGGG RNA bulge EMX1_12 GAGTCCacaCAGAAGAAGAAAGA x EMX1_13 GAGTCCaAG-AGAAGAAGtgAGG RNA bulge HEK293-4 DNA seq at a cleavage sites Bulge HEK4_3 GGCACTGCa-CTGGAGGTtGTGG RNA bulge HEK4_8 GGCACT-gGGCTGaAGGTaGAGG RNA bulge HEK4_19 GGCACTG-GGCTGGAGGcGGGGG RNA bulge HEK4_24 GGCACTG-GGCTGGAGaTGGAGG RNA bulge 33

34 Reducing BE3 off-target effects via modified sgrnas 34

35 Base editing in mouse embryos BE3 mrna or RNP delivery into one-cell embryos via electroporation No mosaicism and no off-target mutations in some F0 animals C to T conversion is highly efficient; C to A or G conversion is possible Missense and nonsense mutations can be induced RNP electroporation BE3 + sgrna 50 embryos in a chamber

36 Base editing in mouse embryos: DMD Dmd Exon 20 +/+ D108 Gln CAATTAAAAGCCAGTTAAAAATTTGTAAGG CAATTAAAAGCTAGTTAAAAATTTGTAAGG Stop Laminin Wt A A G C C A G T T A A A A A T T T G T A A G G Gln Dystrophin D108 A A G C T A G T T A A A A A T T T G T A A G G Stop Mutant mice were obtained at a frequency of 60% (= 5/9) No evidence of mosaicism was detected in some F0 mice F0 Mice with a missense mutation showed dystrophin deficiency Kim & Ryu et al. NBT (2017)

37 Herbicide-resistant plants WT Edited plants + Pyrazosulfuron-ethyl Herbicide-resistant tobacco was produced using BE3 A single amino-acid residue was altered via a C-to-T conversion Unpublished

38 CONCLUSIONS Cas9/Cpf1/BE3 RNPs can be used for genome editing in cells and organisms Digenome-seq is a method for profiling genome-wide off-target effects CRISPR off-target effects can be avoided using RNPs and modified grnas

39 Join Us for the 2018 Keystone Symposia conference on: Precision Genome Editing with Programmable Nucleases January 28 February 1, 2018 Keystone, Colorado USA Scientific Organizers: Jin-Soo Kim Feng Zhang Daniel F. Voytas Scholarship/Discounted Abstract Deadline: October 3, 2017 Abstract Deadline: November 1, 2017 Discounted Registration Deadline: December 5,

40 Acknowledgments Collaborators Center for Genome Engineering Dr. Seokjoong Kim, ToolGen, Inc. Prof. Sunghwa Choe, Seoul Nat. Univ. Prof. Dong Wook Kim, Yonsei Univ. Prof. Han-Woong Lee, Yonsei Univ. Prof. Sangsoo Bae, Hanyang Univ. Prof. Jeong Hun Kim, Seoul National Univ. Hospital Prof. Hyongbum Kim, Yonsei Univ. Prof. Emery Bresnick, Univ. of Wisconsin Prof. Dana Carroll, Univ. of Utah Prof. Shoukhrat Mitalipov, Oregon H&S Univ. Research Fellows Sang-Gyu Kim, Ph.D. Jee-Young An, Ph.D. Kyoung-Mi Kim, Ph.D. Sang-Tae Kim, Ph.D. Eunji Kim, Ph.D. Graduate students Annie Kim Heon Seok Kim Euihwan Jeong Sejong Choi Daesik Kim, Ph.D. Sojung Kim, Ph.D. Taeyoung Koo, Ph.D. Sang-Wook Park, Ph.D. Jae-Young Yun, Ph.D. Seuk-min Ryu Da-eun Kim Kayeong Lim Eugene Chung 40