de novo sequencing of the sunflower genome
|
|
|
- Cora May
- 6 years ago
- Views:
Transcription
1 de novo sequencing of the sunflower genome Stéphane Muños LIPM
2 39 Sunflower, an important cropfor Europe Million tons of seed produced worldwide 30 Million hectares worldwilde 80% in Europe 71% in Europe Societal challenge The global production of sunflowerseedshas to increase to meet growing demand (human food, animal feed, green chemistry...)
3 The french region Midi-pyrénées, a key player in global sunflower production ha in France Home to the world s leader sunflower breeding companies The foremost sunflowerproducing region in France ha An unique multidisciplinary research cluster Agronomists Geneticists and plant breeders Bio informaticians Mathematicians Pathologists
4 Sequencing of the sunflower genome P. Vincourt Jérôme Gouzy, Baptiste Mayjonade, Christopher J. Grassa, Sébastien Carrère, Erika Sallet, Ludovic Legrand, Hélène Badouin, Nicolas Pouilly, Marie-Claude Boniface, Nicolas Blanchet, Brigitte Mangin, Cécile Donnadieu, Hélène Bergès, Stéphane Muños, Patrick Vincourt, Nicolas Langlade N. Langlade INRA Toulouse Christopher J. Grassa, Navdeep Gill, Thuy Nguyen, Nolan Kane, Loren H. Rieseberg UBC Vancouver L. Rieseberg John E. Bowers, John M. Burke UGA Athens J. Burke
5 Sunflower genome background Diploid 2n=2x17 chromosomes Size : Mb Species Rice Rapeseed Maize Size 430 Mb 1100 Mb Mb H. sapiens Mb Sunflower Mb Wheat Mb
6 Sunflower genome contains long repeated sequences Length distribution of LTR retrotransposons Sunflower J. Gouzy Occuren nce Human Repeats= 33% of the sunflower genome Repeats= 8% of the Human genome Retrotransposon length(bp) LTRharvest(Ellinghaus et al. 2008, default parameters) Twomajor repeatsin the sunflower genome: 8kb and 11.5kb The repeats make the assembling very difficult
7 2014: Sunflower genome Ha412.v1.1 Sunflower line : HA412 International Consortium UBC Vancouver, INRA Toulouse, UGA Athens Produced from 454 and Illumina sequencing Mb (55% of 3.6Gb) Ha412 2v1.1 (80% N) kb Genome browser and annotation on Good at macro scale but local assembly problems HA412 BAC sequences (No N) 700kb
8 2014: Sunflower genome Ha412.v1.1 Sunflower line : HA412 International Consortium UBC Vancouver, INRA Toulouse, UGA Athens A lot of genetic and genomic ressources produced: BAC libraries, physical map, high-density genetic maps, SNPs from re-sequenced genomes Difficulties were due to the short length of the sequences used for assembly that cannot span the long repeats
9 At the end of 2014 : a technological breakthrough PacBio RSII (Pacific Biosciences) A movie(fluorescence incorporation during the synthesis) is recorded and then converted to DNA sequence
10 At the end of 2014 : a technological breakthrough PacBio produces sequences longer than the known repeats (in 4 hours)
11 2015: Acquisition of the PacBio RSII at INRA Toulouse in march 2015 SUNRISE Project ( ) INRA Toulouse (LIPM, CNRGV, Genomic Platform) First PacBio in France (GeT-PlaGe) Sunflower line: XRQ 100% PacBio data used for the assembling.
12 Development of long-fragment librairies The longer the PacBio sequences are, the better it is to span LTR : - New DNA extraction protocole (submitted to BioTechniques) - Optimisation of fragmentation, purification, loading - Increase run time to 4 6h (movie-length) «Filtered_subreads»distribution depending on librairy preparation protocole Enrichmentfor long fragments (>20kb) B. Mayjonade
13 Production of contigs 1) Correction of the raw sequences J. Gouzy 1.1: Pairwise comparison of raw sequences (PBcR/MHAP, minimap, falcon) 1.2: The sequences are corrected 2) Assembling of the corrected sequences 2.1: Pairwise comparison of the corrected sequences (WGS/Falcon) 2.2: Sequences are aligned (based on the overlap between sequences), the contig is breaked on the point where the repeat is not spanned. 2.3: consensus sequences of the contigs 3) «Polishing» of the consensus contigs sequences 3.1: mapping of the raw data on the consensus sequences (Blasr) 3.2: correction of the consensus sequence based on the error rate model of the polymerase (quiver)
14 PacBio raw data produced (April July 2015) Raw data (407 SMRT cells) B. Mayjonade # MAX N50 BP MEAN Gb 37,5M 80,9kb 13,7kb 10,3kb 367 (102x) Corrected reads (PBcR) /3 # MAX N50 BP MEAN Gb CR1 11,2M 59kb 13,6kb 11,2kb 125 Gb (34x) Third of the raw data are conserved after correction and used for assembling
15 WORLD WINNER nucleotides
16 New challenge vs
17 Assembly result of the contigs #ctg MAX N50 BP # > N50 MEDIAN Gb M 498 kb kb % of genomein the contigs (No Ns) 20% not assembled(likely concatemeres of rdna, TE, telomeres, centromeres)
18 From contigs to chromosome sequences? Sunflower Genome Genome assembly Chris Grassa Reference Genome 17 chromosomes 3.6G base pairs 12,318 Contigs (putative chimeric contigs discarded) 2.93 Gb FROM CONTIGS TO PSEUDO-MOLECULES 17 pseudomolecules +chloroplast and mitochondrion
19 Chromosome production strategy SNP markers Linkage group High-density genetic maps BACs Sequence-based physical map BAC Sequence-tags every 5-6 kb PacBio Contigs PacBio contigs BAC Sequence contigsaligned against genetic & physical map
20 Integration of High-Density Genetic Maps INRA (Muños) UGA (Bowers) USDA (Talduker) UBC (Grassa) 86,223 markers 10,080 markers 5,019 RAD-tag markers Sequenced-based (~2.5M SNPs) 3 Populations: 4 Populations: 3 F2 Populations: 1 Population: - HA89 x LR1 - XRQ x PSC XRQ x PSC HA412 x RHA415 - HA412 x ANN NMS373 Hopi - RHA280 x RHA801 - HA89 x RHA464 - B-line x RHA464 - CR29 x RHA468 - RHA280 x RHA801
21 Complementarity of genetic maps UBC map #contigs: bpplaced: Mb INRA 2015 map #contigs: bpplaced: Mb 984Mbp 749Mbp 770Mbp Other maps (INRA 2014, UGA, USDA): 415Mbp
22 Build Consensus Map Units Machine-learn consensus units: C. Grassa Raw Maps Mostly agree Minor orderering differences Some LGs inverted Recombination rate varies 1) Loose fit curve using contigs with markers in both maps 2) Drop outliers 3) Train model 4) Predict positions in consensus units Consensus Map Near colinearity Common map units
23 Physical Map Scaffolding Tags aligned to physical map with simple scoring scheme Reciprocal best hits seed the scaffold position +/-1 cm Successive matches searched +/- 1cM from seed
24 Sunflower reference genome (XRQ line) Mb (3.38 % de N) Chr Mitochondrion 301 kb Chloroplast 151 kb Size (Mb) % of contigs in the pseudomolecules
25 Gene content and genome annotation 61 RNA-Seq librairies on the sequenced genotype (XRQ) Organ-specific expression (12 organs) Abiotic stress response: drought, osmotic stress, salt stress (in roots and leaves) Hormone regulation: (9 hormones in roots and leaves) Gene annotation protein coding genes (mrna) lncrna genes 88 pre-mirna genes (351 mature mirna) 862 trna and rrna genes 98% of transcripts mapped on pseudo-molecules
26 User interface and data visualization Expression data Maintain access to raw count data Integrate visualization on
27 User interface and data visualization Gene expression map N. Langlade
28 User interface and data visualization Examples of organ-specific genes CYC1 Glutenin pre-mirna GAPDH
29 What next for sunflower? Improving the sunflower assembly. Optical mapping CNRGV-INRA Toulouse (N. Rodde, C. Chantry, H. Bergès) Irys system (Bionano) acquired in March 2016 NRGene on HA412 line
30 What Next for sunflower? Several reference genomes are needed because, nor XRQ nor HA412 represent the averall genetic variations in sunflower A first step: PSC8 sunflower line de novo sequenced(50x PacBio data, HeliOr project) #ctg MAX N50 BP # > N50 MEDIAN Gb M 223kb kb 3.15
31 XRQ vs PSC8: some conserved regions
32 XRQ vs PSC8: regions with structural variations
33 XRQ vs PSC8: highly divergent regions
34 Summary A high quality genome sequence produced (XRQ line) Sunflower could be a model plant like tomato became for fleshy fruits! But breeding and genetic research need more genomes to be sequenced and more tools and data.
35 Many thanks to our colleagues now retired Felicity Vear (INRA Clermont-Ferrand) Patrick Vincourt (INRA Toulouse)
36 Thank you for your attention Fundings Partners
Toward a better understanding of plant genomes structure: combining NGS and optical mapping technology to improve the sunflower assembly
Toward a better understanding of plant genomes structure: combining NGS and optical mapping technology to improve the sunflower assembly Céline CHANTRY-DARMON 1 CNRGV The French Plant Genomic Center Created
Large insert library preparation
Large insert library preparation User Group Meeting Barcelona 9-10th November Baptiste Mayjonade - INRA Toulouse (France) PacBio large insert library prep workflow High Molecular Weight gdna Extraction
Toward a better understanding of plant genomes structure : Combining NGS, optical mapping technology and CRISPR-CATCH approach
Toward a better understanding of plant genomes structure : Combining NGS, optical mapping technology and CRISPR-CATCH approach Hélène BERGES Director of the Plant Genomic Center Global warming effects,
Genomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
Exploiting novel rice baseline datasets: WGS, BAC-based platinum genome sequencing and full-length transcriptomics
Exploiting novel rice baseline datasets: WGS, BAC-based platinum genome sequencing and full-length transcriptomics Dario Copetti, PhD Arizona Genomics Institute The University of Arizona International
MinION, GridION, how does Nanopore technology meet the needs of our users?
MinION, GridION, how does Nanopore technology meet the needs of our users? Journée Long Reads GeT 28 Novembre 2017 Catherine Zanchetta & Maxime Manno get@genotoul.fr @get_genotoul 1 Wet Lab Nanopore technology
De novo whole genome assembly
De novo whole genome assembly Qi Sun Bioinformatics Facility Cornell University Sequencing platforms Short reads: o Illumina (150 bp, up to 300 bp) Long reads (>10kb): o PacBio SMRT; o Oxford Nanopore
From the genome to the field : how to improve the isolation of genomic regions of interest for plant breeding.
From the genome to the field : how to improve the isolation of genomic regions of interest for plant breeding. Hélène BERGES Director of the French Plant Genomic Center INRA Toulouse The French Plant Genomic
Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly
Supplementary Tables Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly Library Read length Raw data Filtered data insert size (bp) * Total Sequence depth Total Sequence
Sequence Assembly and Alignment. Jim Noonan Department of Genetics
Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome
RNA sequencing with the MinION at Genoscope
RNA sequencing with the MinION at Genoscope Jean-Marc Aury jmaury@genoscope.cns.fr @J_M_Aury December 13, 2017 RNA workshop, Genoscope Overview Genoscope Overview MinION sequencing at Genoscope RNA-Seq
The international effort to sequence the 17Gb wheat genome: Yes, Wheat can!
ACTTGTGCATAGCATGCAATGCCAT ATATAGCAGTCTGCTAAGTCTATAG CAGACCCTCAACGTGGATCATCCGT AGCTAGCCATGACATTGATCCTGAT TTACACCATGTACTATCGAGAGCAG TACTACCATGTTACGATCAAAGCCG TTACGATAGCATGAACTTGTGCATA GCATGCAATGCCATATATAGCAGTC
HIGH-QUALITY ASSEMBLY OF THE DURUM WHEAT GENOME CV. SVEVO
HIGH-QUALITY ASSEMBLY OF THE DURUM WHEAT GENOME CV. SVEVO Luigi Cattivelli, The International Durum Wheat Genome Sequencing Consortium 31/01/2017 1 Durum wheat Durum wheat with a total production of about
Introduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph
Introduction to Plant Genomics and Online Resources Manish Raizada University of Guelph Genomics Glossary http://www.genomenewsnetwork.org/articles/06_00/sequence_primer.shtml Annotation Adding pertinent
Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline
Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline Xi Wang Bioinformatics Scientist Computational Life Science Page 1 Bayer 4:3 Template 2010 March 2016 17/01/2017
DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN. (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN
DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN ... 2014 2015 2016 2017 ... 2014 2015 2016 2017 Synthetic
Biol 478/595 Intro to Bioinformatics
Biol 478/595 Intro to Bioinformatics September M 1 Labor Day 4 W 3 MG Database Searching Ch. 6 5 F 5 MG Database Searching Hw1 6 M 8 MG Scoring Matrices Ch 3 and Ch 4 7 W 10 MG Pairwise Alignment 8 F 12
Nature Biotechnology: doi: /nbt.3943
Supplementary Figure 1. Distribution of sequence depth across the bacterial artificial chromosomes (BACs). The x-axis denotes the sequencing depth (X) of each BAC and y-axis denotes the number of BACs
Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro
Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Philip Morris International R&D, Philip Morris Products S.A., Neuchatel, Switzerland Introduction Nicotiana sylvestris
De Novo and Hybrid Assembly
On the PacBio RS Introduction The PacBio RS utilizes SMRT technology to generate both Continuous Long Read ( CLR ) and Circular Consensus Read ( CCS ) data. In this document, we describe sequencing the
Figure S1. Data flow of de novo genome assembly using next generation sequencing data from multiple platforms.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Supplemental Figures Figure S1. Data flow of de novo genome assembly using next generation sequencing data from
Mate-pair library data improves genome assembly
De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate
Data Basics. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis
Data Basics Josef K Vogt Slides by: Simon Rasmussen 2017 Generalized NGS analysis Sample prep & Sequencing Data size Main data reductive steps SNPs, genes, regions Application Assembly: Compare Raw Pre-
Genome Sequence of Medicago sativa: Cultivated Alfalfa at the Diploid Level (CADL)
Genome Sequence of Medicago sativa: Cultivated Alfalfa at the Diploid Level (CADL) Maria J. Monteros, Joann Mudge, Andrew D. Farmer, Nicholas P. Devitt, Diego A. Fajardo, Thiru Ramaraj, Xinbin Dai, Zhaohong
Wheat CAP Gene Expression with RNA-Seq
Wheat CAP Gene Expression with RNA-Seq July 9 th -13 th, 2018 Overview of the workshop, Alina Akhunova http://www.ksre.k-state.edu/igenomics/workshops/ RNA-Seq Workshop Activities Lectures Laboratory Molecular
Sequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing project Unknown sequence { experimental evidence result read 1 read 4 read 2 read 5 read 3 read 6 read 7 Computational requirements
Deep Sequencing technologies
Deep Sequencing technologies Gabriela Salinas 30 October 2017 Transcriptome and Genome Analysis Laboratory http://www.uni-bc.gwdg.de/index.php?id=709 Microarray and Deep-Sequencing Core Facility University
The Genome Analysis Centre. Building Excellence in Genomics and Computa5onal Bioscience
Building Excellence in Genomics and Computa5onal Bioscience Resequencing approaches Sarah Ayling Crop Genomics and Diversity sarah.ayling@tgac.ac.uk Why re- sequence plants? To iden
The Irys System. Rapid Genome Wide Mapping for de novo Assembly and Structural Variation Analysis. Jack Peart, Ph.D. Director of Sales EMEA
The Irys System Rapid Genome Wide Mapping for de novo Assembly and Structural Variation Analysis Jack Peart, Ph.D. Director of Sales EMEA BioNano Snapshot Developed & Commercialized the Irys System for
High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center
High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina Still-imaging of clusters (~1000
Contact us for more information and a quotation
GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA
Wet-lab Considerations for Illumina data analysis
Wet-lab Considerations for Illumina data analysis Based on a presentation by Henriette O Geen Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina
Chapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
Validation of synthetic long reads for use in constructing variant graphs for dairy cattle breeding
Validation of synthetic long reads for use in constructing variant graphs for dairy cattle breeding M Keehan and C Couldrey Research and Development, Livestock Improvment Corporation, Hamilton, New Zealand
Understanding Accuracy in SMRT Sequencing
Understanding Accuracy in SMRT Sequencing Jonas Korlach, Chief Scientific Officer, Pacific Biosciences Introduction Single Molecule, Real-Time (SMRT ) DNA sequencing achieves highly accurate sequencing
NGS developments in tomato genome sequencing
NGS developments in tomato genome sequencing 16-02-2012, Sandra Smit TATGTTTTGGAAAACATTGCATGCGGAATTGGGTACTAGGTTGGACCTTAGTACC GCGTTCCATCCTCAGACCGATGGTCAGTCTGAGAGAACGATTCAAGTGTTGGAAG ATATGCTTCGTGCATGTGTGATAGAGTTTGGTGGCCATTGGGATAGCTTCTTACC
3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome
Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts
Transcriptome analysis
Statistical Bioinformatics: Transcriptome analysis Stefan Seemann seemann@rth.dk University of Copenhagen April 11th 2018 Outline: a) How to assess the quality of sequencing reads? b) How to normalize
NGS technologies approaches, applications and challenges!
www.supagro.fr NGS technologies approaches, applications and challenges! Jean-François Martin Centre de Biologie pour la Gestion des Populations Centre international d études supérieures en sciences agronomiques
Anker P Sørensen Crop innovation through novel NGS applications
nker P Sørensen Crop innovation through novel NGS applications Session 1: NGS / Omic Technologies for Plant Research 19 e March 2015, Kuala Lumpur Malaysia KeyGene s corporate profile Wageningen NL Rockville
Sequence-based assembly of chromosome 7A and comparison to diploid progenitors
Sequence-based assembly of chromosome 7A and comparison to diploid progenitors Gabriel Keeble-Gagnere1 J Nystrom-Persson1, C Cavanagh2, D Fleury3, H Webster1, R Appels1 1 Veterinary and Life Sciences,
Steps in Genetic Analysis
Molecular Tools Steps in Genetic Analysis 1. Knowing how many genes determine a phenotype, and where the genes are located, is a first step in understanding the genetic basis of a phenotype 2. A second
De novo whole genome assembly
De novo whole genome assembly Lecture 1 Qi Sun Bioinformatics Facility Cornell University Data generation Sequencing Platforms Short reads: Illumina Long reads: PacBio; Oxford Nanopore Contiging/Scaffolding
Next Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
Matthew Tinning Australian Genome Research Facility. July 2012
Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909
Analysing genomes and transcriptomes using Illumina sequencing
Analysing genomes and transcriptomes using Illumina uencing Dr. Heinz Himmelbauer Centre for Genomic Regulation (CRG) Ultrauencing Unit Barcelona The Sequencing Revolution High-Throughput Sequencing 2000
The Journey of DNA Sequencing. Chromosomes. What is a genome? Genome size. H. Sunny Sun
The Journey of DNA Sequencing H. Sunny Sun What is a genome? Genome is the total genetic complement of a living organism. The nuclear genome comprises approximately 3.2 * 10 9 nucleotides of DNA, divided
Experimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis
-Seq Analysis Quality Control checks Reproducibility Reliability -seq vs Microarray Higher sensitivity and dynamic range Lower technical variation Available for all species Novel transcript identification
RNA-Seq data analysis course September 7-9, 2015
RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive
Sequencing and assembly of the sheep genome reference sequence
Sequencing and assembly of the sheep genome reference sequence Yu Jiang Kunming Institute of Zoology, CAS, China the International Sheep Genomics Consortium (ISGC) ISGC Presentations Yu Jiang, Kunming
Assembling a Cassava Transcriptome using Galaxy on a High Performance Computing Cluster
Assembling a Cassava Transcriptome using Galaxy on a High Performance Computing Cluster Aobakwe Matshidiso Supervisor: Prof Chrissie Rey Co-Supervisor: Prof Scott Hazelhurst Next Generation Sequencing
Supplementary Figure 1 Genotyping by Sequencing (GBS) pipeline used in this study to genotype maize inbred lines. The 14,129 maize inbred lines were
Supplementary Figure 1 Genotyping by Sequencing (GBS) pipeline used in this study to genotype maize inbred lines. The 14,129 maize inbred lines were processed following GBS experimental design 1 and bioinformatics
A near perfect de novo assembly of a eukaryotic genome using sequence reads of greater than 10 kilobases generated by the Pacific Biosciences RS II
A near perfect de novo assembly of a eukaryotic genome using sequence reads of greater than 10 kilobases generated by the Pacific Biosciences RS II W. Richard McCombie Disclosures Introduction to the challenge
Genome Assembly of the Obligate Crassulacean Acid Metabolism (CAM) Species Kalanchoë laxiflora
Genome Assembly of the Obligate Crassulacean Acid Metabolism (CAM) Species Kalanchoë laxiflora Jerry Jenkins 1, Xiaohan Yang 2, Hengfu Yin 2, Gerald A. Tuskan 2, John C. Cushman 3, Won Cheol Yim 3, Jason
Isoform sequencing PacBio RSII. Anna Bratus PacBio User Meeting, Barcelona, November 10, 2015
Isoform sequencing PacBio RSII Anna Bratus PacBio User Meeting, Barcelona, November 10, 2015 SCHEDULE I. CASE STUDY II. III. LIBRARY PREPARATION SEQUENCING IV. DATA OUTCOME V. CONCLUSIONS 2 CASE STUDY
Genome Sequencing-- Strategies
Genome Sequencing-- Strategies Bio 4342 Spring 04 What is a genome? A genome can be defined as the entire DNA content of each nucleated cell in an organism Each organism has one or more chromosomes that
RNA-SEQUENCING ANALYSIS
RNA-SEQUENCING ANALYSIS Joseph Powell SISG- 2018 CONTENTS Introduction to RNA sequencing Data structure Analyses Transcript counting Alternative splicing Allele specific expression Discovery APPLICATIONS
1.1 Post Run QC Analysis
Post Run QC Analysis 100 339 200 01 1. Post Run QC Analysis 1.1 Post Run QC Analysis Welcome to Pacific Biosciences' Post Run QC Analysis Overview. This training module will describe the workflow to assess
Next generation sequencing techniques" Toma Tebaldi Centre for Integrative Biology University of Trento
Next generation sequencing techniques" Toma Tebaldi Centre for Integrative Biology University of Trento Mattarello September 28, 2009 Sequencing Fundamental task in modern biology read the information
Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
The Diploid Genome Sequence of an Individual Human
The Diploid Genome Sequence of an Individual Human Maido Remm Journal Club 12.02.2008 Outline Background (history, assembling strategies) Who was sequenced in previous projects Genome variations in J.
Sequencing techniques
Sequencing techniques Workshop on Whole Genome Sequencing and Analysis, 2-4 Oct. 2017 Learning objective: After this lecture, you should be able to account for different techniques for whole genome sequencing
Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
Current'Advances'in'Sequencing' Technology' James'Gurtowski' Schatz'Lab'
Current'Advances'in'Sequencing' Technology' James'Gurtowski' Schatz'Lab' Outline' 1. Assembly'Review' 2. Pacbio' Technology'Overview' Data'CharacterisFcs' Algorithms' Results' 'Assemblies' 3. Oxford'Nanopore'
Genome sequencing in Senecio squalidus
Genome sequencing in Senecio squalidus Outline of project A new NERC funded grant, the genomic basis of adaptation and species divergence in Senecio in collaboration with Richard Abbott and Dmitry Filatov
Taking Advantage of Long RNA-Seq Reads. Vince Magrini Pacific Biosciences User Group Meeting September 18, 2013
Taking Advantage of Long RNA-Seq Reads Vince Magrini Pacific Biosciences User Group Meeting September 18, 2013 Overview Proof-of-Principle SMART-cDNA Synthesis PB-SBL size distributions Gene Annotation
Implementation and Evaluation of 10X Genomics Chromium technology
Implementation and Evaluation of 10X Genomics Chromium technology Claire Kuchly & Olivier Bouchez 28/11/2017 get@genotoul.fr @get_genotoul 1 Chromium evaluation: pilot phase Platform installed in november
Introduction to RNA-Seq
Introduction to RNA-Seq Monica Britton, Ph.D. Bioinformatics Analyst September 2014 Workshop Overview of Today s Activities Morning RNA-Seq Concepts, Terminology, and Work Flows Two-Condition Differential
Genomics and Transcriptomics of Spirodela polyrhiza
Genomics and Transcriptomics of Spirodela polyrhiza Doug Bryant Bioinformatics Core Facility & Todd Mockler Group, Donald Danforth Plant Science Center Desired Outcomes High-quality genomic reference sequence
Analysis Report. Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly
Analysis Report Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly 1 Table of Contents 1. Result of Whole Genome Assembly
Introduction to RNA-Seq
Introduction to RNA-Seq Monica Britton, Ph.D. Sr. Bioinformatics Analyst March 2015 Workshop Overview of RNA-Seq Activities RNA-Seq Concepts, Terminology, and Work Flows Using Single-End Reads and a Reference
A draft sequence of bread wheat chromosome 7B based on individual MTP BAC sequencing using pair end and mate pair libraries.
A draft sequence of bread wheat chromosome 7B based on individual MTP BAC sequencing using pair end and mate pair libraries. O. A. Olsen, T. Belova, B. Zhan, S. R. Sandve, J. Hu, L. Li, J. Min, J. Chen,
High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center
High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center DNA Technologies & Expression Analysis Cores HT Sequencing (Illumina
Parts of a standard FastQC report
FastQC FastQC, written by Simon Andrews of Babraham Bioinformatics, is a very popular tool used to provide an overview of basic quality control metrics for raw next generation sequencing data. There are
NGS-based innovations within the Leiden Network
NGS-based innovations within the Leiden Network A strong bridge between two partners Dr. Mark de Jong 2017-09-29 Design accurate and robust NGS tests and generate data sets essential for Diagnostics &
MI615 Syllabus Illustrated Topics in Advanced Molecular Genetics Provisional Schedule Spring 2010: MN402 TR 9:30-10:50
MI615 Syllabus Illustrated Topics in Advanced Molecular Genetics Provisional Schedule Spring 2010: MN402 TR 9:30-10:50 DATE TITLE LECTURER Thu Jan 14 Introduction, Genomic low copy repeats Pierce Tue Jan
BENG 183 Trey Ideker. Genome Assembly and Physical Mapping
BENG 183 Trey Ideker Genome Assembly and Physical Mapping Reasons for sequencing Complete genome sequencing!!! Resequencing (Confirmatory) E.g., short regions containing single nucleotide polymorphisms
CSE182-L16. LW statistics/assembly
CSE182-L16 LW statistics/assembly Silly Quiz Who are these people, and what is the occasion? Genome Sequencing and Assembly Sequencing A break at T is shown here. Measuring the lengths using electrophoresis
Genomes: What we know and what we don t know
Genomes: What we know and what we don t know Complete draft sequence 2001 October 15, 2007 Dr. Stefan Maas, BioS Lehigh U. What we know Raw genome data The range of genome sizes in the animal & plant kingdoms!
Protein Synthesis: From Gene RNA Protein Trait
Protein Synthesis: From Gene RNA Protein Trait Human Genome The human genome contains about genes. Each gene is a of DNA (sequence of nitrogen bases) contained within each chromosome. Each chromosome contains
Introduction to metagenome assembly. Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014
Introduction to metagenome assembly Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014 Sequencing specs* Method Read length Accuracy Million reads Time Cost per M 454
The Iso-Seq Method: Transcriptome Sequencing Using Long Reads
The Iso-Seq Method: Transcriptome Sequencing Using Long Reads Elizabeth Tseng, Ph.D. Senior Staff Scientist FIND MEANING IN COMPLEXITY For Research Use Only. Not for use in diagnostic procedures. Copyright
Next Generation Sequences & Chloroplast Assembly. 8 June, 2012 Jongsun Park
Next Generation Sequences & Chloroplast Assembly 8 June, 2012 Jongsun Park Table of Contents 1 History of Sequencing Technologies 2 Genome Assembly Processes With NGS Sequences 3 How to Assembly Chloroplast
High quality reference genome of the domestic sheep (Ovis aries) Yu Jiang and Brian P. Dalrymple
High quality reference genome of the domestic sheep (Ovis aries) Yu Jiang and Brian P. Dalrymple CSIRO Livestock Industries on behalf of the International Sheep Genomics Consortium Outline of presentation
Excerpts from a Seminar at Bayer CropScience February 2015
Excerpts from a Seminar at Bayer CropScience February 2015 Kellye Eversole IWGSC Executive Director Seminar Ghent, Belgium 12 February 2015 Update on the International Wheat Genome Sequencing Consortium
The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential
The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential Applications Richard Finkers Researcher Plant Breeding, Wageningen UR Plant Breeding, P.O. Box 16, 6700 AA, Wageningen, The Netherlands,
Usage Cases of GBS. Jeff Glaubitz Senior Research Associate, Buckler Lab, Cornell University Panzea Project Manager
Usage Cases of GBS Jeff Glaubitz (jcg233@cornell.edu) Senior Research Associate, Buckler Lab, Cornell University Panzea Project Manager Cornell CBSU Workshop Sept 15 16, 2011 Some potential applications
Looking Ahead: Improving Workflows for SMRT Sequencing
Looking Ahead: Improving Workflows for SMRT Sequencing Jonas Korlach FIND MEANING IN COMPLEXITY Pacific Biosciences, the Pacific Biosciences logo, PacBio, SMRT, and SMRTbell are trademarks of Pacific Biosciences
COMPUTATIONAL PREDICTION AND CHARACTERIZATION OF A TRANSCRIPTOME USING CASSAVA (MANIHOT ESCULENTA) RNA-SEQ DATA
COMPUTATIONAL PREDICTION AND CHARACTERIZATION OF A TRANSCRIPTOME USING CASSAVA (MANIHOT ESCULENTA) RNA-SEQ DATA AOBAKWE MATSHIDISO, SCOTT HAZELHURST, CHRISSIE REY Wits Bioinformatics, University of the
PBG 430/530 Exam
1 PBG 430/530 Exam 2 2013 1. In a deoxyribonucleotide, 5 and 3 refer to the a. start site for transcription. b. start site for translation. c. carbons where (respectively) the phosphate and hydroxyl groups
Transcriptome Assembly, Functional Annotation (and a few other related thoughts)
Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types
Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
Course summary. Today. PCR Polymerase chain reaction. Obtaining molecular data. Sequencing. DNA sequencing. Genome Projects.
Goals Organization Labs Project Reading Course summary DNA sequencing. Genome Projects. Today New DNA sequencing technologies. Obtaining molecular data PCR Typically used in empirical molecular evolution
Services Presentation Genomics Experts
Services Presentation Genomics Experts Illumina Seminar Marriott May 11th IntegraGen at a glance Autism Oncology Genomics Services Serves the researcher s most complex needs in genomics The n 1 privately-owned
Identifying the functional bases of trait variation in Brassica napus using Associative Transcriptomics
Brassica genome structure and evolution Genome framework for association genetics Establishing marker-trait associations 31 st March 2014 GENOME RELATIONSHIPS BETWEEN SPECIES U s TRIANGLE 31 st March 2014
GBS Usage Cases: Examples from Maize
GBS Usage Cases: Examples from Maize Jeff Glaubitz (jcg233@cornell.edu) Senior Research Associate, Buckler Lab, Cornell University Panzea Project Manager Cornell IGD/CBSU Workshop June 17 18, 2013 Some
Whole Human Genome Sequencing Report This is a technical summary report for PG DNA
Whole Human Genome Sequencing Report This is a technical summary report for PG0002601-DNA Physician and Patient Information Physician name: Vinodh Naraynan Address: Suite 406 222 West Thomas Road Phoenix
The Human Genome Project
The Human Genome Project The Human Genome Project Began in 1990 The Mission of the HGP: The quest to understand the human genome and the role it plays in both health and disease. The true payoff from the
How much sequencing do I need? Emily Crisovan Genomics Core September 26, 2018
How much sequencing do I need? Emily Crisovan Genomics Core September 26, 2018 How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing
Title: High-quality genome assembly of channel catfish, Ictalurus punctatus
Author s response to reviews Title: High-quality genome assembly of channel catfish, Ictalurus punctatus Authors: Qiong Shi (shiqiong@genomics.cn) Xiaohui Chen (xhchenffri@hotmail.com) Liqiang Zhong (lqzhongffri@hotmail.com)