HIGH-QUALITY ASSEMBLY OF THE DURUM WHEAT GENOME CV. SVEVO
|
|
|
- Quentin Anderson
- 5 years ago
- Views:
Transcription
1 HIGH-QUALITY ASSEMBLY OF THE DURUM WHEAT GENOME CV. SVEVO Luigi Cattivelli, The International Durum Wheat Genome Sequencing Consortium 31/01/2017 1
2 Durum wheat Durum wheat with a total production of about 35 million tons is the 10 th most important crops worldwide. Durum wheat is a tetraploid wheat with 12 Gb genome (80% repetive elements), domesticated from wild emmer in the Fertile Crescent about 10,000 years ago. The domestication process and the subsequent breeding activity have selected the modern durum wheat fixing the typical domestication traits (e.g. brittle rachis, naked seeds and threshability), agronomic traits (e.g. short straw and disease resistances) as well as specific pasta quality traits (grain hardness, pigment content, protein content). 31/01/2017 2
3 An international initiative to sequence the genome of the durum wheat Luigi Cattivelli P. Faccioli, C Crosatti Nicola Pecchioni Aldo Ceriotti Luciano Milanesi Gabriella Sonnante University of Bologna M. Maccaferri, S.Salvi, Roberto Tuberosa Curtis Pozniak Nils Stein Martin Mascher Hikmet Budak Klaus Mayer Sven Twardziok Heidrun Gundlach University of Tel Aviv Assaf Distelfeld 31/01/2017 3
4 Svevo, the first high-quality durum wheat Svevo (1996): CIMMYT line Zenit High protein content and high yellow pigment 31/01/2017 4
5 Sequencing the durum wheat variety SVEVO Whole genome shotgun with Illumina technology: pair end and mate pair libraries, about 270x coverage. Jan Assembly with the DeNovoMAGIC software by NRGene. Scaffolds anchored to a high-density genetic map (Svevo x Zavitan), and merged into super-scaffolds using Chromosome conformation capture (Hi-C ). July 2016 Genome annotations and analysis. 31/01/2017 5
6 High quality assembly of the Svevo genome: main statistics The assembly has produced 129,464 scaffolds covering a total of Gb. 50% of the genome has been assembled in 493 scaffolds, with the smallest scaffold of 5.97 Mb. 90% of the genome has been assembled in 2,019 scaffolds, with the smallest scaffold of 1.09 Mb. Total scaffolds 129,464 Assembly size Gb Gaps size 149 Mb Gaps 1.42% L50 (length) 5.97 Mb N50 (sequences) 493 L90 (length) 1.09 Mb N90 (sequences) 2,019 31/01/2017 6
7 Anchoring the scaffolds to the chromosomes 95.3% of the scaffolds has been placed along the chromosomes and 90.0% has been oriented. Total scaffolds 129,464 Assembly size Gb Gaps size 149 Mb Gaps 1.42% L50 (length) 5.97 Mb N50 (sequences) 493 L90 (length) 1.09 Mb N90 (sequences) 2,019 31/01/2017 7
8 Durum wheat genome annotation The durum wheat assembly has been annotated for genes, small RNAs and transposable elements. Genes and mirnas annotation were based on: extensive transcriptomic analysis from Svevo based on more than 60 treatment x tissue combinations. Triticum diccocoides samples (provided by A. Distelfeld) Triticum aestivum CS samples (published data sets) Annotated protein sequences from grass species Triticeae protein sequences from Uniprot Triticeae full length cdna sequences (TriFLDB) CS PacBio Iso-Seq data from leaf, root, seed, seedling, spike, stem (published by Earlham Institute) 31/01/2017 8
9 Transcript confidence classification High confidence transcripts 66,559 Coding sequence with annotated start and stop codon and significant match to reference protein sequence (query coverage > 90 % and subject coverage > 90 % and e-value < ) HC1: match to validated protein sequence (Magnoliophyta) HC2: match to predicted protein sequence (Poaceae) Low confidence transcripts 303,404 LC1: incomplete coding sequence but significant match to reference protein sequence LC2: no significant match to reference protein sequence but complete coding sequence REP: match to transposon elements database 31/01/2017 9
10 Durum wheat genome annotation: mirnas 774 putative mirna coding loci have been identified based on expression data 438 are homologous to annotated plant mirnas and correspond to 79 MIR families [Blast precursors vs mirbase v.21 (only plants) threshold: best hit, e-value 1.0e-5] 31/01/
11 Durum wheat genome annotation: transposable elements LTR-retrotransposons A 71.5% % of genome Mb Mobile Element ,419 Class I: Retroelement ,244 Class II: DNA Transposon ,174 DNA-transposons B 69.0% A 10.3% B 12.4% B genome has some more DNA-TEs and slightly less retrotransposons 31/01/
12 Conclusions We provide a high quality assembly of the genome of the durum wheat cultivar Svevo, a contribution to the wheat pangenome analysis. Since the wild emmer wheat (acc. Zavitan) has been recently sequenced by A. Distelfeld, the comparison between wild emmer and durum wheat genomes (same high quality level) will shed light on wheat domestication and on selective sweeps (pasta quality trait). More information of the sequence of durum wheat genome in the presentation of Marco Maccaferri (Leveraging the assembly of the durum wheat genome) at the NRGene workshop on Tuesday 17h, 2.10pm. 31/01/
13 31/01/
Durum Wheat Genomics and Breeding EWG Annual report and action plan
Coordinating global research for wheat Durum Wheat Genomics and Breeding EWG Annual report and action plan NAME OF EXPERT WORKING GROUP EWG on DURUM WHEAT GENOMICS AND BREEDING LEADERSHIP & AUTHORSHIP
Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline
Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline Xi Wang Bioinformatics Scientist Computational Life Science Page 1 Bayer 4:3 Template 2010 March 2016 17/01/2017
Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro
Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Philip Morris International R&D, Philip Morris Products S.A., Neuchatel, Switzerland Introduction Nicotiana sylvestris
Odyssey of the IWGSC Reference Genome Sequence: 12 years 1 month 28 days 11 hours 10 minutes and 14 seconds.
Odyssey of the IWGSC Reference Genome Sequence: 12 years 1 month 28 days 11 hours 10 minutes and 14 seconds. Kellye Eversole IWGSC Executive Director Plant Genomics and Gene Editing Congress Amsterdam,
A Whole Genome Assembly of Rye (Secale cereale)
A Whole Genome Assembly of Rye (Secale cereale) M. Timothy Rabanus-Wallace Leibniz Institute of Plant Genetics and Crop Plant Research (IPK) Why rye? QTL analysis for Survival After Winter (SAW) scores
A draft sequence of bread wheat chromosome 7B based on individual MTP BAC sequencing using pair end and mate pair libraries.
A draft sequence of bread wheat chromosome 7B based on individual MTP BAC sequencing using pair end and mate pair libraries. O. A. Olsen, T. Belova, B. Zhan, S. R. Sandve, J. Hu, L. Li, J. Min, J. Chen,
Functional genomics to improve wheat disease resistance. Dina Raats Postdoctoral Scientist, Krasileva Group
Functional genomics to improve wheat disease resistance Dina Raats Postdoctoral Scientist, Krasileva Group Talk plan Goal: to contribute to the crop improvement by isolating YR resistance genes from cultivated
Anchoring and ordering NGS contig assemblies by population sequencing (POPSEQ)
Anchoring and ordering NGS contig assemblies by population sequencing (POPSEQ) Martin Mascher IPK Gatersleben PAG XXII January 14, 2012 slide 1 Proof-of-principle in barley Diploid model for wheat 5 Gb
Improving barley and wheat germplasm for changing environments
AWARD NUMBER: 2011-68002-30029 Improving barley and wheat germplasm for changing environments Triticeae CAP (T-CAP) 56 participants, 28 institutions, 21 states Integration of wheat and barley research
A tutorial introduction into the MIPS PlantsDB barley&wheat databases. Manuel Spannagl&Kai Bader transplant user training Poznan June 2013
A tutorial introduction into the MIPS PlantsDB barley&wheat databases Manuel Spannagl&Kai Bader transplant user training Poznan June 2013 MIPS PlantsDB tutorial - some exercises Please go to: http://mips.helmholtz-muenchen.de/plant/genomes.jsp
Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly
Supplementary Tables Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly Library Read length Raw data Filtered data insert size (bp) * Total Sequence depth Total Sequence
Genomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
The international effort to sequence the 17Gb wheat genome: Yes, Wheat can!
ACTTGTGCATAGCATGCAATGCCAT ATATAGCAGTCTGCTAAGTCTATAG CAGACCCTCAACGTGGATCATCCGT AGCTAGCCATGACATTGATCCTGAT TTACACCATGTACTATCGAGAGCAG TACTACCATGTTACGATCAAAGCCG TTACGATAGCATGAACTTGTGCATA GCATGCAATGCCATATATAGCAGTC
Triticeae genome MIPS PlantsDB. Manuel Spannagl transplant workshop Versailles Nov 2012
Triticeae genome resources @ MIPS PlantsDB Manuel Spannagl transplant workshop Versailles Nov 2012 What is MIPS PlantsDB? Generic database schema+system for the integration, management and (comparative)
Variation. Evolution Lectures 3
Variation Evolution Lectures 3 What is variation? Inspiration of Darwin was individuals are different and these are the steps of evolution. Today we think the variation at the population level is the source
Welcome to the Future: Global Wheat Genome Sequencing Efforts
Welcome to the Future: Global Wheat Genome Sequencing Efforts Crop Development Centre Durum Wheat Breeding and Genetics Program Dr. Curtis J. Pozniak Use and/or distribution of these slides is prohibited
Cereal endosperm; lessons learnt from molecular biology, cell biology, genomics and transcriptomics analysis.
Cereal endosperm; lessons learnt from molecular biology, cell biology, genomics and transcriptomics analysis. Odd-Arne Olsen Department of plant sciences Norwegian university of life sciences The cereal
Progress in genomics applications in investigating abiotic stresses influencing perennial forage and biomass grasses
Progress in genomics applications in investigating abiotic stresses influencing perennial forage and biomass grasses Dr. Susanne Barth Teagasc Crops Research Centre Oak Park Carlow Irland Global challenges
CHAPTER 14 Genetics and Propagation
CHAPTER 14 Genetics and Propagation BASIC GENETIC CONCEPTS IN PLANT SCIENCE The plants we cultivate for our survival and pleasure all originated from wild plants. However, most of our domesticated plants
Excerpts from a Seminar at Bayer CropScience February 2015
Excerpts from a Seminar at Bayer CropScience February 2015 Kellye Eversole IWGSC Executive Director Seminar Ghent, Belgium 12 February 2015 Update on the International Wheat Genome Sequencing Consortium
Wheat Genomic Resources in a post reference sequence era: a road map to establish priorities, timelines and outcomes
Wheat Genomic Resources in a post reference sequence era: a road map to establish priorities, timelines and outcomes Prospects in Wheat Genomics -- what is needed from a research perspective Rudi Appels,
High quality reference genome of the domestic sheep (Ovis aries) Yu Jiang and Brian P. Dalrymple
High quality reference genome of the domestic sheep (Ovis aries) Yu Jiang and Brian P. Dalrymple CSIRO Livestock Industries on behalf of the International Sheep Genomics Consortium Outline of presentation
Exploiting novel rice baseline datasets: WGS, BAC-based platinum genome sequencing and full-length transcriptomics
Exploiting novel rice baseline datasets: WGS, BAC-based platinum genome sequencing and full-length transcriptomics Dario Copetti, PhD Arizona Genomics Institute The University of Arizona International
Toward a better understanding of plant genomes structure: combining NGS and optical mapping technology to improve the sunflower assembly
Toward a better understanding of plant genomes structure: combining NGS and optical mapping technology to improve the sunflower assembly Céline CHANTRY-DARMON 1 CNRGV The French Plant Genomic Center Created
NGS developments in tomato genome sequencing
NGS developments in tomato genome sequencing 16-02-2012, Sandra Smit TATGTTTTGGAAAACATTGCATGCGGAATTGGGTACTAGGTTGGACCTTAGTACC GCGTTCCATCCTCAGACCGATGGTCAGTCTGAGAGAACGATTCAAGTGTTGGAAG ATATGCTTCGTGCATGTGTGATAGAGTTTGGTGGCCATTGGGATAGCTTCTTACC
DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.
DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private
Triticeae Gene Nomenclature
A Wheat Initiative workshop Triticeae Gene Nomenclature 11-13 October 2016, Munich (Germany) Report 1 Background A number of high quality genome sequences have been completed in recent years for species
Integrating and Leveraging Cereal and Grass Genome Resources. David Marshall Information and Computational Sciences Group
Integrating and Leveraging Cereal and Grass Genome Resources David Marshall Information and Computational Sciences Group David.Marshall@hutton.ac.uk What I m going to cover Brief overview of the new barley
Advances in Breeding for Resistance to Stem Rust Caused by Ug99 and Ethiopian Pgt Races in Durum Wheat
Borlaug Global Rust Initiative Technical Workshop 2014 Session: Rust Resistance in Tetraploids Ciudad Obregon, March 23, 2014 Advances in Breeding for Resistance to Stem Rust Caused by Ug99 and Ethiopian
A barley root mutant collection for NGS-based fast-forward genetics
A barley root mutant collection for NGS-based fast-forward genetics Roberto Tuberosa Dept. of Agricultural Sciences University of Bologna, Italy 2 nd Plant Genomics Congress Kuala Lumpur, 19-20 March,
The genome of Fraxinus excelsior (European Ash)
The genome of Fraxinus excelsior (European Ash) Elizabeth Sollars, Laura Kelly, Bernardo Clavijo, David Swarbreck, Jasmin Zohren, David Boshier, Jo Clark, Anika Joecker, Sarah Ayling, Mario Caccamo, Richard
Plant Breeding and Agri Genomics. Team Genotypic 24 November 2012
Plant Breeding and Agri Genomics Team Genotypic 24 November 2012 Genotypic Family: The Best Genomics Experts Under One Roof 10 PhDs and 78 MSc MTech BTech ABOUT US! Genotypic is a Genomics company, which
Next-generation sequencing technologies
Next-generation sequencing technologies Illumina: Summary https://www.youtube.com/watch?v=fcd6b5hraz8 Illumina platforms: Benchtop sequencers https://www.illumina.com/systems/sequencing-platforms.html
Two Mark question and Answers
1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three
Sequence-based assembly of chromosome 7A and comparison to diploid progenitors
Sequence-based assembly of chromosome 7A and comparison to diploid progenitors Gabriel Keeble-Gagnere1 J Nystrom-Persson1, C Cavanagh2, D Fleury3, H Webster1, R Appels1 1 Veterinary and Life Sciences,
RNA-Seq data analysis course September 7-9, 2015
RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive
A tutorial introduction into the MIPS PlantsDB barley&wheat database instances
transplant 2 nd user training workshop Poznan, Poland, June, 27 th, 2013 A tutorial introduction into the MIPS PlantsDB barley&wheat database instances TUTORIAL ANSWERS Please direct any questions related
Genome sequencing in Senecio squalidus
Genome sequencing in Senecio squalidus Outline of project A new NERC funded grant, the genomic basis of adaptation and species divergence in Senecio in collaboration with Richard Abbott and Dmitry Filatov
Identifying the functional bases of trait variation in Brassica napus using Associative Transcriptomics
Brassica genome structure and evolution Genome framework for association genetics Establishing marker-trait associations 31 st March 2014 GENOME RELATIONSHIPS BETWEEN SPECIES U s TRIANGLE 31 st March 2014
Genome evolution on the allotetraploid Xenopus laevis
Genome evolution on the allotetraploid Xenopus laevis Taejoon Kwon Department of Biomedical Engineering, School of Life Sciences Ulsan National Institute of Science & Technology (UNIST) Xenopus Bioinformatics
DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN. (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN
DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN ... 2014 2015 2016 2017 ... 2014 2015 2016 2017 Synthetic
Anker P Sørensen Crop innovation through novel NGS applications
nker P Sørensen Crop innovation through novel NGS applications Session 1: NGS / Omic Technologies for Plant Research 19 e March 2015, Kuala Lumpur Malaysia KeyGene s corporate profile Wageningen NL Rockville
Genome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)
Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA
Introduction into single-cell RNA-seq. Kersti Jääger 19/02/2014
Introduction into single-cell RNA-seq Kersti Jääger 19/02/2014 Cell is the smallest functional unit of life Nucleus.ATGC.UACG. A Cell KLTSH. The complexity of biology How many cell types? How many cells?
Microbially Mediated Plant Salt Tolerance and Microbiome based Solutions for Saline Agriculture
Microbially Mediated Plant Salt Tolerance and Microbiome based Solutions for Saline Agriculture Contents Introduction Abiotic Tolerance Approaches Reasons for failure Roots, microorganisms and soil-interaction
Structure and Dynamics of the Hexaploid Wheat Genome
TGAC 2016 March 30 th Structure and Dynamics of the Hexaploid Wheat Genome Frédéric CHOULET Genetics Diversity Ecophysiology of Cereals INRA U. Clermont-Ferrand, France Structure, evolution of wheat genome
Molecular and Applied Genetics
Molecular and Applied Genetics Ian King, Iain Donnison, Helen Ougham, Julie King and Sid Thomas Developing links between rice and the grasses 6 Gene isolation 7 Informatics 8 Statistics and multivariate
Technologies, resources and tools for the exploitation of the sheep and goat genomes.
Technologies, resources and tools for the exploitation of the sheep and goat genomes. B. P. Dalrymple, G. Tosser-Klopp, N. Cockett, A. Archibald, W. Zhang and J. Kijas. The plan The current state of the
COMPUTATIONAL PREDICTION AND CHARACTERIZATION OF A TRANSCRIPTOME USING CASSAVA (MANIHOT ESCULENTA) RNA-SEQ DATA
COMPUTATIONAL PREDICTION AND CHARACTERIZATION OF A TRANSCRIPTOME USING CASSAVA (MANIHOT ESCULENTA) RNA-SEQ DATA AOBAKWE MATSHIDISO, SCOTT HAZELHURST, CHRISSIE REY Wits Bioinformatics, University of the
ChIP-seq and RNA-seq. Farhat Habib
ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions
Phenotypic response conferred by the Lr22a leaf rust resistance gene against ten Swiss P. triticina isolates.
Supplementary Figure 1 Phenotypic response conferred by the leaf rust resistance gene against ten Swiss P. triticina isolates. The third leaf of Thatcher (left) and RL6044 (right) is shown ten days after
ChIP-seq and RNA-seq
ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)
Bio5488 Practice Midterm (2018) 1. Next-gen sequencing
1. Next-gen sequencing 1. You have found a new strain of yeast that makes fantastic wine. You d like to sequence this strain to ascertain the differences from S. cerevisiae. To accurately call a base pair,
De novo whole genome assembly
De novo whole genome assembly Qi Sun Bioinformatics Facility Cornell University Sequencing platforms Short reads: o Illumina (150 bp, up to 300 bp) Long reads (>10kb): o PacBio SMRT; o Oxford Nanopore
TABLE OF CONTENTS. Abbreviations List of figures List of Tables Acknowledgements Abstract..1-2
TABLE OF CONTENTS Abbreviations List of figures List of Tables Acknowledgements Abstract..1-2 Chapter 1: Introduction and Review of literature......3-30 1.1. Introduction: Wheat 1.1.1. Economic importance
Utilization of the IWGSC Resources: Application to Wheat Breeding
Utilization of the IWGSC Resources: Application to Wheat Breeding Wheat Breeding: Securing Tomorrow s Profitability. Dr. Curtis J. Pozniak IWGSC Workshop, PAG, Jan 2014 Use and/or distribution of these
Massive Analysis of cdna Ends for simultaneous Genotyping and Transcription Profiling in High Throughput
Next Generation (Sequencing) Tools for Nucleotide-Based Information Massive Analysis of cdna Ends for simultaneous Genotyping and Transcription Profiling in High Throughput Björn Rotter, PhD GenXPro GmbH,
Rice Structural and Functional Genome Research in ASPGC, Academia Sinica
Journal of Genetics and Molecular Biology Vol. 14, No. 4, 201-206, December 1, 2003 Rice Structural and Functional Genome Research in ASPGC, Academia Sinica Ya-Ting Chao 1, Chin-San Chen 1, Hong-Hwa Chen
DNA. bioinformatics. epigenetics methylation structural variation. custom. assembly. gene. tumor-normal. mendelian. BS-seq. prediction.
Epigenomics T TM activation SNP target ncrna validation metagenomics genetics private RRBS-seq de novo trio RIP-seq exome mendelian comparative genomics DNA NGS ChIP-seq bioinformatics assembly tumor-normal
Mate-pair library data improves genome assembly
De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate
De Novo Transcript Discovery using Long and Short Reads
De Novo Transcript Discovery using Long and Short Reads December 4, 2018 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com
Nature Biotechnology: doi: /nbt.3943
Supplementary Figure 1. Distribution of sequence depth across the bacterial artificial chromosomes (BACs). The x-axis denotes the sequencing depth (X) of each BAC and y-axis denotes the number of BACs
De novo assembly in RNA-seq analysis.
De novo assembly in RNA-seq analysis. Joachim Bargsten Wageningen UR/PRI/Plant Breeding October 2012 Motivation Transcriptome sequencing (RNA-seq) Gene expression / differential expression Reconstruct
Biol 478/595 Intro to Bioinformatics
Biol 478/595 Intro to Bioinformatics September M 1 Labor Day 4 W 3 MG Database Searching Ch. 6 5 F 5 MG Database Searching Hw1 6 M 8 MG Scoring Matrices Ch 3 and Ch 4 7 W 10 MG Pairwise Alignment 8 F 12
How much sequencing do I need? Emily Crisovan Genomics Core
How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing run is best?
How much sequencing do I need? Emily Crisovan Genomics Core September 26, 2018
How much sequencing do I need? Emily Crisovan Genomics Core September 26, 2018 How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing
Supplementary Online Material. the flowchart of Supplemental Figure 1, with the fraction of known human loci retained
SOM, page 1 Supplementary Online Material Materials and Methods Identification of vertebrate mirna gene candidates The computational procedure used to identify vertebrate mirna genes is summarized in the
Title: High-quality genome assembly of channel catfish, Ictalurus punctatus
Author s response to reviews Title: High-quality genome assembly of channel catfish, Ictalurus punctatus Authors: Qiong Shi (shiqiong@genomics.cn) Xiaohui Chen (xhchenffri@hotmail.com) Liqiang Zhong (lqzhongffri@hotmail.com)
Sequencing and assembly of the sheep genome reference sequence
Sequencing and assembly of the sheep genome reference sequence Yu Jiang Kunming Institute of Zoology, CAS, China the International Sheep Genomics Consortium (ISGC) ISGC Presentations Yu Jiang, Kunming
Genomics-based approaches to improve drought tolerance of crops
Review TRENDS in Plant Science Vol.11 No.8 Full text provided by www.sciencedirect.com Genomics-based approaches to improve drought tolerance of crops Roberto Tuberosa and Silvio Salvi Department of Agroenvironmental
Pattern Formation via Small RNA Mobility SUPPLEMENTAL FIGURE 1 SUPPLEMENTAL INFORMATION. Daniel H. Chitwood et al.
SUPPLEMENTAL INFORMATION Pattern Formation via Small RNA Mobility Daniel H. Chitwood et al. SUPPLEMENTAL FIGURE 1 Supplemental Figure 1. The ARF3 promoter drives expression throughout leaves. (A, B) Expression
Wesley T. Barber, Wei Zhang, Hlaing Win, Kranthi K. Varala, Jane E. Dorweiler, Matthew E. Hudson and Stephen P. Moose
Repeat associated small RNAs vary among parents and following hybridization in maize Wesley T. Barber, Wei Zhang, Hlaing Win, Kranthi K. Varala, Jane E. Dorweiler, Matthew E. Hudson and Stephen P. Moose
Bioinformatics, in general, deals with the following important biological data:
Pocket K No. 23 Bioinformatics for Plant Biotechnology Introduction As of July 30, 2006, scientists around the world are pursuing a total of 2,126 genome projects. There are 405 published complete genomes,
Eucalyptus gene assembly
Eucalyptus gene assembly ACGT Plant Biotechnology meeting Charles Hefer Bioinformatics and Computational Biology Unit University of Pretoria October 2011 About Eucalyptus Most valuable and widely planted
less sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput
Chapter 11: Gene Expression The availability of an annotated genome sequence enables massively parallel analysis of gene expression. The expression of all genes in an organism can be measured in one experiment.
Supplement to: The Genomic Sequence of the Chinese Hamster Ovary (CHO)-K1 cell line
Supplement to: The Genomic Sequence of the Chinese Hamster Ovary (CHO)-K1 cell line Table of Contents SUPPLEMENTARY TEXT:... 2 FILTERING OF RAW READS PRIOR TO ASSEMBLY:... 2 COMPARATIVE ANALYSIS... 2 IMMUNOGENIC
KnetMiner USER TUTORIAL
KnetMiner USER TUTORIAL Keywan Hassani-Pak ROTHAMSTED RESEARCH 10 NOVEMBER 2017 About KnetMiner KnetMiner, with a silent "K" and standing for Knowledge Network Miner, is a suite of open-source software
CURRICULUM VITAE. Current Position: Post-Doctoral research associate at Colorado State University.
CURRICULUM VITAE Name: Walid El-Feki Current address: 500 W Prospect Rd, Fort Collins, Apt 7-D CO-80526 Phone: 970-492-9317 e-mail: walid@rams.colostate.edu Current Position: Post-Doctoral research associate
de novo sequencing of the sunflower genome
de novo sequencing of the sunflower genome Stéphane Muños LIPM INRA Toulouse stephane.munos@toulouse.inra.fr @stephane_munos @SUNRISE_France 39 Sunflower, an important cropfor Europe Million tons of seed
Genetics & The Work of Mendel
Genetics & The Work of Mendel He studied at the University of Vienna from 1851 to 1853 where he was influenced by a physicist who encouraged experimentation and the application of mathematics to science
Protein Synthesis: From Gene RNA Protein Trait
Protein Synthesis: From Gene RNA Protein Trait Human Genome The human genome contains about genes. Each gene is a of DNA (sequence of nitrogen bases) contained within each chromosome. Each chromosome contains
Analysis of structural variation. Alistair Ward USTAR Center for Genetic Discovery University of Utah
Analysis of structural variation Alistair Ward USTAR Center for Genetic Discovery University of Utah What is structural variation? What differentiates SV from short variants? What are the major SV types?
Collect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
Genetics Transcription Translation Replication
Genetics Transcription Translation Replication 1. Which statement best describes the relationship between an allele and a gene? A. An allele is a variation of a gene that can be expressed as a phenotype.
Analysis of QTL for High Grain Protein Content in Canadian Durum Wheat
Analysis of QTL for High Grain Protein Content in Canadian Durum Wheat Suprayogi 1, C.J. Pozniak 1, J.M. Clarke 2, F.R. Clarke2 and R.E. Knox 2 1 Dept. of Plant Science and Crop Development Centre, University
Advances in Genetics Lesson 5
Advances in Genetics Lesson 5 May 16 6:43 PM How can organisms be produced with desired traits? May 16 6:44 PM 1 I. How can organisms be produced with desired traits A. With advance in genetics, DNA evidence
Satellite Education Workshop (SW4): Epigenomics: Design, Implementation and Analysis for RNA-seq and Methyl-seq Experiments
Satellite Education Workshop (SW4): Epigenomics: Design, Implementation and Analysis for RNA-seq and Methyl-seq Experiments Saturday March 17, 2012 Orlando, Florida Workshop Description: This full day
Genome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
Transcriptome Assembly, Functional Annotation (and a few other related thoughts)
Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types
Optimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University
Optimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University my background Undergraduate Degree computer systems engineer (ASU
Sbmenu: Blog.nwsource.com
Sbmenu: Blog.nwsource.com phh4@le.ac.uk www.molcyt.com Repetitive DNA and its evolution in the Musa genome Polymorphisms DNA Evolution Breeding Conservation W067: Banana (Musa) Genomics Plant and Animal
Introduction to Bioinformatics
Introduction to Bioinformatics Bas E. Dutilh Systems Biology: Bioinformatic Data Analysis Utrecht University, February 8 th 2016 Info and documentation http://tbb.bio.uu.nl/bda/ http://www.google.com/
Rapid Transcriptome Characterization for a nonmodel organism using 454 pyrosequencing
Rapid Transcriptome Characterization for a nonmodel organism using 454 pyrosequencing "#$%&'()*+,"(-*."#$%&/.,"*01*0.,(%-*.&0("2*01*3,$,45,"-*4#66&*71** 3"#)(82,"-*2&9:)($*)1*"(03&"2-*#)66(*.(8$6#*;
The IWGSC: Strategies & Activities to Sequence the Bread Wheat Genome Jane Rogers IWGSC Deputy Executive Director
The IWGSC: Strategies & Activities to Sequence the Bread Wheat Genome Jane Rogers IWGSC Deputy Executive Director ACPFG Seminar University of Adelaide 1st May 2014 The International Wheat Genome Sequencing
RNASEQ WITHOUT A REFERENCE
RNASEQ WITHOUT A REFERENCE Experimental Design Assembly in Non-Model Organisms And other (hopefully useful) Stuff Meg Staton mstaton1@utk.edu University of Tennessee Knoxville, TN I. Project Design Things
Genome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does
Molecular methods to characterize the microbiota in the mouse tissues
Molecular methods to characterize the microbiota in the mouse tissues Olivier Bouchez, GeT-PlaGe, INRA Toulouse @GeT_Genotoul Who are we? Genomic and transcriptomic core facility spreads on 5 sites GeT
From Infection to Genbank
From Infection to Genbank How a pathogenic bacterium gets its genome to NCBI Torsten Seemann VLSCI - Life Sciences Computation Centre - Genomics Theme - Lab Meeting - Friday 27 April 2012 The steps 1.
Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018
Outline Overview of the GEP annotation projects Annotation of Drosophila Primer January 2018 GEP annotation workflow Practice applying the GEP annotation strategy Wilson Leung and Chris Shaffer AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCT
The tomato genome re-seq project
The tomato genome re-seq project http://www.tomatogenome.net 5 February 2013, Richard Finkers & Sjaak van Heusden Rationale Genetic diversity in commercial tomato germplasm relatively narrow Unexploited