Biological Nanomachines
|
|
- Theresa Park
- 6 years ago
- Views:
Transcription
1 Biological Nanomachines Yann R Chemla Dept. of Physics, University of Illinois at Urbana Champaign Saturday Physics for Everyone, Sept. 14, 2013
2 Biophysics at Illinois
3 Part I: WHAT IS BIOPHYSICS?
4 Physicists doing biology? Q: Why are physicists interested in biology? A: Physicists want to understand the world around us DNA E. coli cells A cat Simple Complex
5 What is biophysics? Applying techniques or ideas from physics to biological problems Central problems in biology will become accessible to analysis through basic physical laws. A biophysicist s description of biological phenomena aims to be: Quantitative (mathematical) Simple (captures enough detail but not too much) General (applicable to more than one system) Physics in a New Era NRC(2001) Grand challenges: Applying Physics to Biology Understanding Complex Systems
6 Part II: MOLECULAR NANOMACHINES
7 The cellular factory The cell =a nano scale factory of molecular machines DNA genetic blueprint to allcomponents of the cell Proteins carry out cellular tasks Molecular machine Drawing courtesy of M. Spies
8 Molecular machines Molecular machines move cargo around the cell inner life of the cell/
9 Molecular machines Molecular machines copy the cell s DNA mechanism of replication basic.html
10 Molecular machines Molecular machines propel cells
11 Molecular distances Strand of hair Bacterial cell (E. coli) > > 01mm micron = 1/100 X Strand of DNA 1 nanometer = 1/100,000 X Limit of light microscope
12 Molecular forces Weight of a small apple 1 Newton > Force exerted by a molecular nanomachine 1 piconewton (pn) = 1/1,000,000,000,000 X The apple that fell on Newton s head
13 Molecular energies Gallon of gasoline Calories in apple 100 MegaJoules 50 Calories = 1/1,000 X ATP: fuel of the cell > > 100 pn nm = 1/100,000,000,000,000, 000,000,000,000 X Adenosine Diphosphate Triphosphate (ADP) (ATP) + Phosphate (P i )
14 Measurement How do you measure anything? Too small to see Forces & energies too small to detect Traditional biochemistry Test lots of molecules together in a test tube
15 Bulk biochemistry Individual proteins move stochastically (= at random) This is a problem when doing traditional bulk biochemistry This one went slow Ideally, we want to study these This one one molecule paused at a time This one stopped START FINISH
16 Measurement How do you measure anything? Too small to see Forces & energies too small to detect Single molecule techniques to the rescue! 280 center Photons width 250 nm 80 Optical traps Y axis Sensitive to individual molecules! X Data Single molecule fluorescence
17 Part II: SINGLE MOLECULE TECHNIQUES
18 Optical tweezers Gradient force: F = (p E) = α E 2 Linear spring K ~ 0.1pN/nm measure pn, nm Ashkin et al., Opt. Lett. 11, 288 (1986)
19 The optical trap......a really expensive LEGO set 19
20 High resolution traps Optical tweezers can access Ångstrom length scales! 1 Ångstrom = 1/10 nanometer CAGT... Temperature controlled, noise free environment GTCA... 1 DNA basepair = 3.4Å 1Å 59 Loomis
21 Typical geometries Typical trap experiments involve tethering a single molecule & detecting changes to its length: Surface based (kinesin) Visscher et al. Nature (1999) But tthere are many others...
22 Example experiment Stretching a DNA hairpin : 3 biotin 3 digoxigenin Hairpin DNA handle DNA handle Streptavidin bead Anti digoxigenin bead Hairpin see also: Woodside et al., PNAS (2006)
23 Traps in action
24 Gone fishing 24
25 DNA Hairpin Transition Force ~15 pn Red = stretching Green = relaxing Hairpin protocol: Woodside et al., PNAS (2006) 25
26 Part III: DNA MOTORS
27 DNA Helicases Helicases unwind the strands of DNA Fuel: ATP ADP + P i Uses ATP fuel to move on one strand of DNA Unwinds double stranded DNA ahead Critical role in replication, recombination and repair 3 Review of helicase: Lohman et al., Nat. Rev. Mol. Cell Biol
28 Repair helicase Helicases are involved in repairing damaged DNA XPDhelicase atomic structure XPB TFIIH RPA XPD Fan et al., Cell (2008) Nucleotide excision repair
29 Hairpin Assay Monitor unwinding of a DNA hi hairpin i (under constant force) Δx Change (Δx) in tether extension reveals unwinding activity Qi et al., elife 2013
30 XPD Stepping Dynamics AT TA 6 10 AT GC 9 7 TA 8 CG GC GC DNA sequence affects reversals Time (s) Average step size is 1 bp Backstepping is frequent Step size (bp) Qi et al. elife (2013) Step finding: Kerssemakers et al., Nature (2006)
31 Helicase mechanism Conclusions XPD unwinds 1 bp at a time 2. Unwinds & slips DNA repetitively 3. Stalling & backstepping related to DNA sequence New model 1. Helicase unwinds by passive mechanism 2. Repetitive mechanism related to role in repair ATP 3 ADP + P i 5 31
32 Fishing... in the dark Wouldn t it be nice to see what s on the fishing line? 32
33 Single molecule fluorescence It is possible to see measure light from distances a single with molecule! pairs of fluorescent molecules FRET Photons Spectroscopic ruler Y axis X Data 5 0 Courtesy of Paul Selvin Roy, Hohng & Ha, Nat. Meth. (2008)
34 Fluorescence & Trap Bead 1 Bead 2 Photo ons/s 1 μm Fluor. Comstock et al., Nat. Meth. (2011) 34
35 UvrD 2B domain orientation Open ON moving? 2B ~160 rotation Closed Off stalled? 2B Low FRET High FRET UvrD helicase atomic structure Conformation switches function? Crystal structure: Closed at junction (presumed unwinding). Biochemistry and single molecule: Open during motion. Closed at junction stalled. FRET + Trap Jia, Lohman et al., JMB Park, Ha et al., Cell Lee and Yang, Cell Singleton et al., Ann. Rev. Biochem
36 Measuring UvrD conformation Dual labeled UvrD DNA Unwo ound (bp) Photo ons (khz) I Donor 0 I Acceptor FR RET Efficien cy Comstock et al., in preparation 1 Closed 0.5 Open Time (s) 36
37 Conformation & directionality Velociity (bp/s) Correlation between: conformation (closed/open) & directionality (unwinding/annealing) FRET Comstock et al., in preparation
38 Strand reversal? Conclusions 1. Closed when unwinding hairpin 2. Open when reannealing Open 3 5 Closed New model B domain remains anchored to dsdna 2. Motor domains switch strands* Open Closed 3 *Dessinges, et. al., PNAS
39 Part IV: OUTLOOK
40 Biophysicists wear many hats... Molecular biology Nature of research Experimentalist build instruments Biologist develop the biological system Theorist model the data Optics Data collection and analysis
41 Take home message Hey You put physics into my biology! No You put biology into my physics! BIOLOGY PHYSICS Quantification of Biological Systems TAKE HOME MESSAGE These advances present new directions for BOTH biology and physics. 41
42 Acknowledgements XPD Helicase stepping Zhi Qi Maria Spies & Robert Pugh (Univ. of Iowa) UvrD trap & fluorescence: Matt Comstock* Kevin Whitley Taekjip Ha (Univ. of Illinois) Tim Lohman & Haifeng Jia (Washington Univ.) Now at: Columbia Univ. * Michigan State Univ. Funding:
Maria Spies, Mark S. Dillingham, and Stephen C. Kowalczykowski. Sections of Microbiology, and of Molecular and Cellular Biology, Center for
DNA HELICASES Maria Spies, Mark S. Dillingham, and Stephen C. Kowalczykowski Sections of Microbiology, and of Molecular and Cellular Biology, Center for Genetics and Development, University of California,
More informationLab 5: Optical trapping and single molecule fluorescence
Lab 5: Optical trapping and single molecule fluorescence PI: Matt Lang Lab Instructor: Jorge Ferrer Summary Optical tweezers are an excellent experimental tool to study the biophysics of single molecule
More informationFork sensing and strand switching control antagonistic activities of. RecQ helicases. Supplementary Information
Fork sensing and strand switching control antagonistic activities of RecQ helicases Daniel Klaue, Daniela Kobbe, Felix Kemmerich, Alicja Kozikowska, Holger Puchta, Ralf Seidel Supplementary Information
More informationMasayoshi Honda, Jeehae Park, Robert A. Pugh, Taekjip Ha, and Maria Spies
Molecular Cell, Volume 35 Supplemental Data Single-Molecule Analysis Reveals Differential Effect of ssdna-binding Proteins on DNA Translocation by XPD Helicase Masayoshi Honda, Jeehae Park, Robert A. Pugh,
More informationLecture 13. Motor Proteins I
Lecture 13 Motor Proteins I Introduction: The study of motor proteins has become a major focus in cell and molecular biology. Motor proteins are very interesting because they do what no man-made engines
More informationBiosensors. DNA Microarrays (for chemical analysis) Protein Sensors (for identifying viruses)
Biosensors DNA Microarrays (for chemical analysis) Protein Sensors (for identifying viruses) DNA Microarrays 40 000 detectors in parallel, each detecting a specific DNA sequence. Combinatorial Chemistry
More informationIntroduction and Techniques
Single-Molecule Manipulation Experiments of Biological Molecules I: Introduction and Techniques Department of Physics & Astronomy Rice University chkiang@rice.edu www.chkiang.rice.edu Outline Single-molecule
More informationBionanomechanics with Optical Tweezers: Molecular Machines under Tension
Bionanomechanics with Optical Tweezers: Molecular Machines under Tension Erik Schäffer Center for Plant Molecular Biology (ZMBP) University of Tübingen, Germany www.zmbp.uni-tuebingen.de/nano 16 April
More informationRotary DNA Motors INTRODUCTION THE FLASHING FIELD MODEL
Biophysical Journal Volume 69 December 1995 2256-2267 Rotary DNA Motors Charles Doering,* Bard Ermentrout,* and George 0ster "Center for Nonlinear Studies, Los Alamos National Laboratory, Los Alamos, New
More informationUniversity of York. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular machines. Time Allowed: 2 hours
Examination Candidate Number: Desk Number: University of York BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular machines Time Allowed: 2 hours Marking Scheme: Total
More information(a) Overview of the 2-helix bundle (2HB) nanospring design used in this study. The
1 Supplementary Figure 1 Design of the DNA origami spring (nanospring). (a) Overview of the 2-helix bundle (2HB) nanospring design used in this study. The scheme was produced by cadnano software 1. Scaffold,
More informationSupplementary Information. Synergistic action of RNA polymerases in overcoming the nucleosomal barrier
Supplementary Information Synergistic action of RNA polymerases in overcoming the nucleosomal barrier Jing Jin, Lu Bai, Daniel S. Johnson, Robert M. Fulbright, Maria L. Kireeva, Mikhail Kashlev, Michelle
More information2006 Nobel Prize in Chemistry and Medicine
2006 Nobel Prize in Chemistry and Medicine Lin Wang and Xianfeng Song Adviser: Sima Setayeshgar Outline o Background: transcription of genes into proteins o 2006 Nobel prizes in chemistry and medicine
More informationInvestigating Protein Stability with the Optical Tweezer
Investigating Protein Stability with the Optical Tweezer I. Introduction. Various experimental and computational techniques have been developed to study the process by which proteins go from a linear sequence
More informationRNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA
RNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA that it has a hydroxyl group at the 2 position of the
More informationStorage and Expression of Genetic Information
Storage and Expression of Genetic Information 29. DNA structure, Replication and Repair ->Ch 25. DNA metabolism 30. RNA Structure, Synthesis and Processing ->Ch 26. RNA metabolism 31. Protein Synthesis
More informationIf you like us, please share us on social media. The latest UCD Hyperlibrary newsletter is now complete, check it out.
Sign In Forgot Password Register username username password password Sign In If you like us, please share us on social media. The latest UCD Hyperlibrary newsletter is now complete, check it out. ChemWiki
More informationNano-Scale Engineering III Bio-Molecular Motors for Engineering
Nano-Scale Engineering III Bio-Molecular Motors for Engineering Y. C. Lee Department of Mechanical Engineering University of Colorado Boulder, CO 80309-0427 leeyc@colorado.edu March 4, 2014 1 MLD of Hybrid
More informationDNA Replication II Biochemistry 302. January 25, 2006
DNA Replication II Biochemistry 302 January 25, 2006 Following in Dad s footsteps Original A. Kornberg E. coli DNA Pol I is a lousy replicative enzyme. 400 molecules/cell but ~2 replication forks/cell
More informationUse of a Single Ion Channel to Analyze the Structure & Dynamics of Individual DNA Molecules. Mark Akeson
Use of a Single Ion Channel to Analyze the Structure & Dynamics of Individual DNA Molecules Mark Akeson Biophysics Laboratory Dept. of Biomolecular Science & Engineering University of California, Santa
More informationReading for lecture 11
Reading for lecture 11 1. Optical Tweezers, Myosin 2. Atomic Force Microscopy (AFM) 3. Single-Molecule Fluorescence Microscopy 4. Patch-Clamp 5. Genetic Techniques Key references are included in italics
More informationWhy does this matter?
Background Why does this matter? Better understanding of how the nucleosome affects transcription Important for understanding the nucleosome s role in gene expression Treats each component and region of
More informationSupplementary material of: Human Upf1 is a highly processive RNA helicase and translocase with RNP remodelling activities
Supplementary material of: Human Upf1 is a highly processive RNA helicase and translocase with RNP remodelling activities By Francesca Fiorini, Debjani Bagchi, Hervé Le Hir and Vincent Croquette Supplementary
More informationOptical traps for single molecule biophysics: a primer
Laser & Photon. Rev. 3, No. 1 2, 203 220 (2009) / DOI 10.1002/lpor.200810014 203 Abstract Optical trapping experiments of different complexities are making a significant impact in biology. This review
More informationRepetitive shuttling of a motor protein on DNA
Vol 437 27 October 2005 doi:10.1038/nature04049 Repetitive shuttling of a motor protein on DNA Sua Myong 1, Ivan Rasnik 1, Chirlmin Joo 1, Timothy M. Lohman 3 & Taekjip Ha 1,2 Many helicases modulate recombination,
More informationSupplementary Information. Single-molecule analysis reveals multi-state folding of a guanine. riboswitch
Supplementary Information Single-molecule analysis reveals multi-state folding of a guanine riboswitch Vishnu Chandra 1,4,#, Zain Hannan 1,5,#, Huizhong Xu 2,# and Maumita Mandal 1,2,3,6* Department of
More informationReading for lecture 2
Reading for lecture 2 1. Structure of DNA and RNA 2. Information storage by DNA 3. The Central Dogma Voet and Voet, Chapters 28 (29,30) Alberts et al, Chapters 5 (3) 1 5 4 1 3 2 3 3 Structure of DNA and
More informationStretching DNA as a template for molecular construction
title Workshop " DNA-Based Molecular Electronics" Jena, May 13-15, 2004 Stretching DNA as a template for molecular construction Masao Washizu 1, Yuji Kimura 1, Takuya Kobayashi 1, Osamu Kurosawa 1,2 Sayoko
More informationNanotechnological Applications of Biomolecular Motor Systems. Stefan Diez Max-Planck-Institute of Molecular Cell Biology and Genetics Dresden
Nanotechnological Applications of Biomolecular Motor Systems Stefan Diez Max-Planck-Institute of Molecular Cell Biology and Genetics Dresden Max-Planck-Institute of Molecular Cell Biology and Genetics
More informationBiochemistry 111. Carl Parker x A Braun
Biochemistry 111 Carl Parker x6368 101A Braun csp@caltech.edu Central Dogma of Molecular Biology DNA-Dependent RNA Polymerase Requires a DNA Template Synthesizes RNA in a 5 to 3 direction Requires ribonucleoside
More informationMCB 110 Spring 2017 Exam 1 SIX PAGES
MCB 110 Spring 2017 Exam 1 SIX PAGES NAME: SID Number: Question Maximum Points Your Points I 28 II 32 III 32 IV 30 V 28 150 PLEASE WRITE your NAME or SID number on each page. This exam must be written
More informationWhat is Nano-Bio? Non-Covalent Interactions
- - What is Nano-Bio? Physicist: Biotech: Biologists: -study of molecular interactions -application of nano-tools to study biological systems. -application of nano-tools to detect, treat, and prevent disease
More informationSingle Molecules Trapped for Study
Single Molecules Trapped for Study Michelle D. Wang PHYSICS To help us understand some of life s mysteries, we have developed precision optical instruments and techniques to look at important molecules
More informationChapter 4 Fluorescence Resonance Energy Transfer (FRET) by Minor Groove-Associated Cyanine-Polyamide Conjugates
Chapter 4 Fluorescence Resonance Energy Transfer (FRET) by Minor Groove-Associated Cyanine-Polyamide Conjugates The work described in this chapter was accomplished in collaboration with V. Rucker (Dervan
More informationDYNAMICBIOSENSORS. Chip functionalization DNA-encoded addressing and chip configuration. Technology Information #120
Technology Information #120 Chip functionalization DNA-encoded addressing and chip configuration The switchsense biochip features 24 detection spots, which are arranged in 2 or 4 seperate flow channels.
More informationDirect imaging of single UvrD helicase dynamics on long single-stranded DNA
Washington University School of Medicine Digital Commons@Becker Open Access Publications 213 Direct imaging of single UvrD helicase dynamics on long single-stranded DNA Kyung Suk Lee University of Illinois
More informationWhat is Life? David Martin Degner Degner Scientific and Engineering Anchorage, Alaska
What is Life? David Martin Degner Degner Scientific and Engineering Anchorage, Alaska davidmartindegner@gmail.com A static and dynamic physical model is presented for the Gram (+) prokaryotic cell, the
More informationHigh-throughput single-dna molecule microscopy using automated micropatterning
Laurence Salomé High-throughput single-dna molecule microscopy using automated micropatterning enjamin Berteloite BIOSOFT October 2016 B I O S O F T Innopsys/CNRS joint lab: BIOSOFT Biosoft is: An open
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/317/5837/513/dc1 Supporting Online Material for Spring-Loaded Mechanism of DNA Unwinding by Hepatitis C Virus NS3 Helicase Sua Myong,* Michael M. Bruno, Anna M. Pyle,
More informationPCR and recombinant DNA techniques
PCR and recombinant DNA techniques Cristiano V. Bizarro Joan Camuñas Felix Ritort Group Small Biosystems Lab Universitat de Barcelona Topics to be covered Introduction (DNA isolation, modification enzymes)
More informationDrug DNA interaction. Modeling DNA ligand interaction of intercalating ligands
Drug DNA interaction DNA as carrier of genetic information is a major target for drug interaction because of the ability to interfere with transcription (gene expression and protein synthesis) and DNA
More informationDNA Structure and Function
DNA Structure and Function DNA Structure DNA Replication Ch 4: Nucleic Acids and the Origin of LIfe Ch 13: DNA and its role in heredity Discussion Summary: Week 12 Stirring the Simmering Designer Baby
More informationBIOLOGY 101. CHAPTER 16: The Molecular Basis of Inheritance: Life s Operating Instructions
BIOLOGY 101 CHAPTER 16: The Molecular Basis of Inheritance: Life s Operating Instructions Life s Operating Instructions CONCEPTS: 16.1 DNA is the genetic material 16.2 Many proteins work together in DNA
More informationRNA synthesis/transcription I Biochemistry 302. February 6, 2004 Bob Kelm
RNA synthesis/transcription I Biochemistry 302 February 6, 2004 Bob Kelm Overview of RNA classes Messenger RNA (mrna) Encodes protein Relatively short half-life ( 3 min in E. coli, 30 min in eukaryotic
More informationMolecular Biology (2)
Molecular Biology (2) DNA replication Mamoun Ahram, PhD Second semester, 2018-2019 Resources This lecture Cooper, pp. 191-207 2 Some basic information The entire DNA content of the cell is known as genome.
More informationSTORM/PALM. Super Resolution Microscopy 10/31/2011. Looking into microscopic world of life
Super Resolution Microscopy STORM/PALM Bo Huang Department of Pharmaceutical Chemistry, UCSF CSHL Quantitative Microscopy, 1/31/211 Looking into microscopic world of life 1 µm 1 µm 1 nm 1 nm 1 nm 1 Å Naked
More informationBiophysics of Macromolecules
Biophysics of Macromolecules Lecture 18: In vivo Methods Braun/Lipfert SS 2015 How to create methods to probe macromolecules in vivo? 6. July 2015 Crowding alters Biochemical Equilibria Excluded volume
More informationsingle-molecule fluorescence spectroscopy
single-molecule fluorescence spectroscopy 5 dynamics of a single molecule by FRET michael börsch 18/07/2003 topics theory of fluorescence resonance energy transfer solvent effects and fluorescence quenching
More informationDnaB Helicase Activity Is Modulated by DNA Geometry and Force
2170 Biophysical Journal Volume 99 October 2010 2170 2179 DnaB Helicase Activity Is Modulated by DNA Geometry and Force Noah Ribeck, Daniel L. Kaplan, Irina Bruck, and Omar A. Saleh * Department of Physics,
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature08627 Supplementary Figure 1. DNA sequences used to construct nucleosomes in this work. a, DNA sequences containing the 601 positioning sequence (blue)24 with a PstI restriction site
More informationDNA Recombination Biochemistry 302. Bob Kelm February 2, 2005
DNA Recombination Biochemistry 302 Bob Kelm February 2, 2005 Homologous recombination: Why is it advantageous to a cell? Bacterial cell Information exchange during bacterial conjugation (mating) between
More information3.1 Introduction. 78 Generating ssdna in optical tweezers
3 A T O O L B O X F O R G E N E R AT I N G S I N G L E - S T R A N D E D D N A I N O P T I C A L T W E E Z E R S Abstract Essential genomic transactions such as DNA-damage repair and DNA replication take
More informationReal-Time PCR Principles and Applications
Real-Time PCR Principles and Applications Dr Esam Ibraheem Azhar (BSc, MSc, Ph.D Molecular Medical Virology) Asst. Prof. Medical Laboratory Technology Department Objectives Real-Time PCR Principles and
More informationChapter 12. DNA Replication and Recombination
Chapter 12 DNA Replication and Recombination I. DNA replication Three possible modes of replication A. Conservative entire original molecule maintained B. Semiconservative one strand is template for new
More informationMEMS based sensors for cellular studies
MEMS based sensors for cellular studies Taher Saif Mechanical Science and Engineering University of Illinois at Urbana-Champaign Part of GEM4 Summer School lectures on instruments for cell mechanics studies
More informationDelve AP Biology Lecture 7: 10/30/11 Melissa Ko and Anne Huang
Today s Agenda: I. DNA Structure II. DNA Replication III. DNA Proofreading and Repair IV. The Central Dogma V. Transcription VI. Post-transcriptional Modifications Delve AP Biology Lecture 7: 10/30/11
More informationAll This For Four Letters!?! DNA and Its Role in Heredity
All This For Four Letters!?! DNA and Its Role in Heredity What Is the Evidence that the Gene Is DNA? By the 1920s, it was known that chromosomes consisted of DNA and proteins. A new dye stained DNA and
More informationSupplemental Information. Single-Molecule Imaging Reveals How. Mre11-Rad50-Nbs1 Initiates DNA Break Repair
Molecular Cell, Volume 67 Supplemental Information Single-Molecule Imaging Reveals How Mre11-Rad50-Nbs1 Initiates DNA Break Repair Logan R. Myler, Ignacio F. Gallardo, Michael M. Soniat, Rajashree A. Deshpande,
More informationF* techniques: FRAP, FLIP, FRET, FLIM,
F* techniques: FRAP, FLIP, FRET, FLIM, FCS Antonia Göhler March 2015 Fluorescence explained in the Bohr model Absorption of light (blue) causes an electron to move to a higher energy orbit. After a particular
More informationFluorescence Imaging with One Nanometer Accuracy Lab
I. Introduction. Fluorescence Imaging with One Nanometer Accuracy Lab Traditional light microscope is limited by the diffraction limit of light, typically around 250 nm. However, many biological processes
More informationTowards Single Molecule Detection of SEB A Mobile Sandwich Immunoassay on Gliding Microtubules. Dr. Carissa M. Soto
Towards Single Molecule Detection of SEB A Mobile Sandwich Immunoassay on Gliding Microtubules Dr. Carissa M. Soto March 8, 2008 Dr. Kim E. Sapsford, Dr. Brett D. Martin, Dr. Amy Szuchmacher Blum, and
More informationNanotechnology for Molecular and Cellular Manipulation
Nanotechnology for Molecular and Cellular Manipulation Logan Liu Micro and Nano Technology Lab Department of Electrical & Computer Engineering University of Illinois Physical Systems Nano vs. Bio Micro
More informationMolecular biology lecture #2
Molecular biology lecture #2 In the previous lecture, we got to chapter 12. We talked about DNA structure and reached the Watson and Crick model and the double helix. Today, we are going to finish chapter
More informationMolecular Biology: General Theory
Molecular Biology: General Theory Author: Dr Darshana Morar Licensed under a Creative Commons Attribution license. DNA REPLICATION DNA replication is the process of duplicating the DNA sequence in the
More informationMolecular Biology: General Theory
Molecular Biology: General Theory Author: Dr Darshana Morar Licensed under a Creative Commons Attribution license. DNA REPLICATION DNA replication is the process of duplicating the DNA sequence in the
More informationSUPPLEMENTAL MATERIAL. Supplemental material contains Supplemental Figure Legends and Supplemental Figures 1 to
SUPPLEMENTAL MATERIAL Supplemental material contains Supplemental Figure Legends and Supplemental Figures 1 to 6. SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Overview of the mechanisms by which
More informationThe Computational Microscope. Main funding: simulation of an entire virus
The Computational Microscope Klaus Schulten Dept. Physics / Beckman Institute, U. Illinois NIH., October 2007 Main funding: simulation of an entire virus The Computational Microscope Computational Microscope
More informationBIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 11 DNA Replication
BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 11 DNA Replication 2 3 4 5 6 7 8 9 Are You Getting It?? Which characteristics will be part of semi-conservative replication? (multiple answers) a) The
More informationARUNAI ACADEMY FOR PG TRB-BOTANY DHARMAPURI REPLICATION - ENZYMES.
ARUNAI ACADEMY FOR PG TRB-BOTANY DHARMAPURI.9500244679 REPLICATION - ENZYMES DNA HELICASE Sparation of two strands- DNA helicase enzyme functions Unwinds DNA. DNA double helix by breaking the hydrogen
More informationIntroduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationWe can now identify three major pathways of information flow in the cell (in replication, information passes from one DNA molecule to other DNA
1 We can now identify three major pathways of information flow in the cell (in replication, information passes from one DNA molecule to other DNA molecules; in transcription, information passes from DNA
More informationDNA Replication II Biochemistry 302. Bob Kelm January 28, 2004
DNA Replication II Biochemistry 302 Bob Kelm January 28, 2004 Conceptual model for proofreading based on kinetic considerations Fig. 24.44 stalling transient melting exonuclease site occupancy Following
More informationDiscoveries Through the Computational Microscope Accuracy Speed-up Unprecedented Scale
Discoveries Through the Computational Microscope Accuracy Speed-up Unprecedented Scale Investigation of drug (Tamiflu) resistance of the swine flu virus demanded fast response! Klaus Schulten Department
More informationMCB 110:Biochemistry of the Central Dogma of MB. MCB 110:Biochemistry of the Central Dogma of MB
MCB 110:Biochemistry of the Central Dogma of MB Part 1. DNA replication, repair and genomics (Prof. Alber) Part 2. RNA & protein synthesis. Prof. Zhou Part 3. Membranes, protein secretion, trafficking
More informationNucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t.
BC 4054 Spring 2001 Chapter 11 & 12 Review Lecture otes Slide 1 ucleic Acid Structure Linear polymer of nucleotides Phosphodiester linkage between 3 and 5 positions See Figure 11.17 Slide 2 ucleic Acid
More informationDNA Replication AP Biology
DNA Replication 2007-2008 Double helix structure of DNA It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material.
More informationDNA Structures. Biochemistry 201 Molecular Biology January 5, 2000 Doug Brutlag. The Structural Conformations of DNA
DNA Structures Biochemistry 201 Molecular Biology January 5, 2000 Doug Brutlag The Structural Conformations of DNA 1. The principle message of this lecture is that the structure of DNA is much more flexible
More informationBIOL 5304 Molecular Biology Fall 2018 Name. Homework #1 Due Monday, September 10 at 10:00 AM. 80 points - 1 -
BIOL 5304 Molecular Biology Fall 2018 ame omework #1 Due Monday, September 10 at 10:00 AM 80 points - 1 - 1. (20 points-maximum) For each item at the left, find all the descriptions on the right that apply
More informationGene and DNA structure. Dr Saeb Aliwaini
Gene and DNA structure Dr Saeb Aliwaini 2016 DNA during cell cycle Cell cycle for different cell types Molecular Biology - "Study of the synthesis, structure, and function of macromolecules (DNA, RNA,
More informationDNA Recombination II Biochemistry 302. Bob Kelm February 4, 2004
DNA Recombination II Biochemistry 302 Bob Kelm February 4, 2004 Core interactions at junction crossover (A 6 C 7 C 8 or R 6 -C 7 -Y 8 motif) parallel stacked-x WC H-bonds red dots ACC H-bonds blue dots
More informationUniversity of Groningen. Single-molecule studies of DNA replication Geertsema, Hylkje
University of Groningen Single-molecule studies of DNA replication Geertsema, Hylkje IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please
More informationUniversity of Groningen. Single-molecule studies of DNA replication Geertsema, Hylkje
University of Groningen Single-molecule studies of DNA replication Geertsema, Hylkje IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please
More informationCanonical B-DNA CGCGTTGACAACTGCAGAATC GC AT CG TA AT GC TA TA CG AT 20 Å. Minor Groove 34 Å. Major Groove 3.4 Å. Strands are antiparallel
DNA Canonical B-DNA 20 Å GC AT CG TA CGCGTTGACAACTGCAGAATC 34 Å AT GC TA Minor Groove 3.4 Å TA CG AT Major Groove Strands are antiparallel CG GC GC Canonical B DNA First determined experimentally by fiber
More informationFluorescent protein. Origin of fluorescent proteins. Structural and biophysical analysis of FPs. Application in molecular biology and biotechnology
Origin of fluorescent proteins types of FPs mechanism of fluorescence Fluorescent protein Structural and biophysical analysis of FPs Application in molecular biology and biotechnology Variety of organisms
More informationFlow of Genetic Information
Flow of Genetic Information DNA Replication Links to the Next Generation Standards Scientific and Engineering Practices: Asking Questions (for science) and Defining Problems (for engineering) Developing
More informationDNA Replication AP Biology
DNA Replication 2007-2008 Watson and Crick 1953 article in Nature Double helix structure of DNA It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible
More informationDiscoveries Through the Computational Microscope
Discoveries Through the Computational Microscope Accuracy Speed-up Unprecedented Scale Investigation of drug (Tamiflu) resistance of the swine flu virus demanded fast response! Klaus Schulten Department
More informationChapter 9: DNA: The Molecule of Heredity
Chapter 9: DNA: The Molecule of Heredity What is DNA? Answer: Molecule that carries the blueprint of life General Features: DNA is packages in chromosomes (DNA + Proteins) Gene = Functional segment of
More informationA photoprotection strategy for microsecond-resolution single-molecule fluorescence spectroscopy
Nature Methods A photoprotection strategy for microsecond-resolution single-molecule fluorescence spectroscopy Luis A Campos, Jianwei Liu, Xiang Wang, Ravishankar Ramanathan, Douglas S English & Victor
More informationFig. 16-7a. 5 end Hydrogen bond 3 end. 1 nm. 3.4 nm nm
Fig. 16-7a end Hydrogen bond end 1 nm 3.4 nm 0.34 nm (a) Key features of DNA structure end (b) Partial chemical structure end Fig. 16-8 Adenine (A) Thymine (T) Guanine (G) Cytosine (C) Concept 16.2: Many
More informationMIDTERM I NAME: Student ID Number: I 32 II 33 III 24 IV 30 V
MIDTERM I NAME: Student ID Number: Question Maximum Points Your Points I 32 II 33 III 24 IV 30 V 31 150 Please write your name/student ID number on each of the following five pages. This exam must be written
More informationDNA REPLICATION. Third Stage. Lec. 12 DNA Replication. Lecture No.: 12. A. Watson & Crick (1952) C. Cairns (1963) autoradiographic experiment
Lec. 12 DNA Replication A. Watson & Crick (1952) Proposed a model where hydrogen bonds break, the two strands separate, and DNA synthesis occurs semi-conservatively in the same net direction. While a straightforward
More informationWatson & Crick. DNA Replication. Directionality of DNA. Double helix structure of DNA. The DNA backbone. Anti-parallel strands
Watson and Crick 1953 article in Nature Replication 2007-2008 Double helix structure of Directionality of You need to number the carbons! it matters! P 4 nucleotide N base This will be IMPRTANT!! 4 ribose
More informationTowards DNA-AddAB Interactions In Magnetic Tweezers
Towards DNA-AddAB Interactions In Magnetic Tweezers M. A. Otte September 2007 - February 2008 Supervisors: Dr. F. Moreno - Herrero Dr. N. H. Dekker Centro de Investigacion de Nanociencia y Nanotecnologia
More informationDetection of local protein structures along DNA using solid-state nanopores
Detection of local protein structures along DNA using solid-state nanopores nanopore Stefan Kowalczyk Adam Hall Cees Dekker RecA-DNA filament (Nano Letters cover September 2009) Bremen 29-06-2009 Main
More informationChapter 11 DNA Replication and Recombination
Chapter 11 DNA Replication and Recombination Copyright Copyright 2009 Pearson 2009 Pearson Education, Education, Inc. Inc. 11.1 DNA is reproduced by Semiconservative Replication The complementarity of
More informationQuestions from chapters in the textbook that are relevant for the final exam
Questions from chapters in the textbook that are relevant for the final exam Chapter 9 Replication of DNA Question 1. Name the two substrates for DNA synthesis. Explain why each is necessary for DNA synthesis.
More information