DYNAMICBIOSENSORS. Chip functionalization DNA-encoded addressing and chip configuration. Technology Information #120

Size: px
Start display at page:

Download "DYNAMICBIOSENSORS. Chip functionalization DNA-encoded addressing and chip configuration. Technology Information #120"

Transcription

1 Technology Information #120 Chip functionalization DNA-encoded addressing and chip configuration The switchsense biochip features 24 detection spots, which are arranged in 2 or 4 seperate flow channels. The microelectrodes are individually functionalized with capture molecules through DNA encoded addressing. Before a switchsense chip can be exposed to target molecules of interest, the chip surface needs to be functionalized with one of the interaction partners. A versatile and parallel strategy employing DNA-DNA recognition is used for coupling capture molecules to the electrically actuated nanolevers. The microlectrodes on a switchsense chip come prefunctionalized with single-stranded DNA. One end of the oligonucleotides is covalently tethered to the surface via gold-sulfur bonds, while the opposing distal end features a fluorescent dye for optical detection. After hybridization with their complementary sequences (cdna), the DNAs become double-stranded helices ideal rod-like nanolevers for efficient switching. Functionalization methods The complementary strand is modified with a reactive group for conjugating capture molecules (small molecules or proteins) to it. A number of modifiers and bifunctional cross-linkers are available for addressing a wide variety of different chemical groups on the capture molecule. Reactive group on capture molecule Cross linker Modifier on cdna Amino NHS Amino NHS X maleimid Thiol Amino NHS X azide Alkyne Thiol Maleimid Thiol maleimid X NHS Amino Thiol maleimid X azide Alkyne Alkyne Azide Alkyne azide X maleimid Thiol Alkyne azide X NHS Amino His-tag Ni 2+ Tris-NTA GST-tag Glutathione Biotin Streptavidin Strep-tag Streptavidin Streptavidin Biotin Dig-binding Digoxigenin Fc part of IgG Protein A Fc part of IgG Protein G Fab part of IgG Protein L X different types of linkers and lengths are available Figure 1 Bio-layer architecture of the chip. The standard DNA nanolever has 48bp and is 16 nm long. 1

2 Two alternative strategies can be used for functionalizing the nanolevers with capture molecules: (i) on-chip conjugation or (ii) in-vitro conjugation, cf. Figures 2 and 3. During the on-chip conjugation method, the reaction between the capture molecule and the cdna strand takes place in the flow channel whilst the chip is installed in the switchsense instrument. The in-vitro conjugation is carried out in vials ex-situ, which is advantageous during chip regeneration as the previously prepared stock solution of the conjugate can be used to regenerate the chip in two automated steps with Figure 2 On-chip conjugation of capture molecules to double-stranded DNA. Complementary DNA with a suitable modifier for conjugation is hybridized to the pre-immobilized tethered strand (3 min). Upon incubation of the microelectrodes with capture molecules, a covalent linkage between reactive groups on the capture molecule and the modifier is established (1-10 min). The interaction between the target protein and the capture molecule is measured. The surface is regenerated by denaturing the DNA duplex, which removes the cdna strand along with the capture and target molecules (1 min). Figure 3 In-vitro conjugation of capture molecules to cdna using provided kits and protocols, followed by hybridization of cdna conjugates to the detection surface. After the interaction measurement, the surface can be regenerated by denaturing the DNA duplex, which removes the cdna-conjugate and resets the electrode to its initial single-stranded state. 2

3 exceptional reproducibility. In addition, it is more straightforward to individually address several electrodes in parallel with different capture molecules, thereby taking advantage of the DNA encoded addressing method. As an alternative to the standard 16 nm nanolever, a modular system of short anchor strands (20 bp, 6.5 nm) in conjunction with a generic fluorescent labelsequence is available. It is particularly useful for experiments with DNA-binding proteins, where a large number of DNA sequences needs to be economically tested. distance between two adjacent nanolevers is 30 nm, which provides the levers with enough space to efficiently switch their conformation (standing/lying) while keeping the density of capture molecules presented to the analyte solution favorably low. This is essential for facilitating an unhampered association and dissociation of target molecules and for obtaining accurate, artifact-free binding data. Figure 5 Low density layers for efficient switching and optimal target accessibility. Figure 4 Coupling of variable DNA sequences via anchor strands. The sequences under investigation do not need to be labeled, but are designed with overhangs so that they can be coupled to the anchorand label-strands on their opposing ends. Less is more: nanolever numbers and material consumption There are only 1 million (1.6 attomol) DNA nanolevers on a detection spot, which is an exceptionally low number. It partly results from the small area of the microelectrodes (0.01 mm²), which is comparable to the cross-section of a human hair. Importantly however, the density of nanolevers on the surface is very low (~10 10 levers/cm²), which is carefully adjusted during production of the chip and can be fine-tuned over one order of magnitude by the user through a proprietary desorption process. Hence, the average For a typical functionalization following an in-vitro conjugation, 50 µl of a 100 nm conjugate solution is used to incubate a flow channel for 3 min (step in Fig. 3). This corresponds to a consumption of 5 pmol of capture molecule, or 0.2 µg when assuming a molecular weight of 50 kda. Chip regeneration The switchsense platform uses one consistent regeneration procedure, irrespective of the types of molecules under investigation. There is no need to develop or to optimize regeneration conditions, as the capture molecules used (which might still be be occupied with targets) are simply washed away by a brief treatment with basic ph solution. This treatment denatures the base-pairing between DNA-tether and cdna, whilst leaving the covalently bound DNAtether on the surface for repeated use. The loss of signal during a regeneration cycle is less than 5%, allowing the same flow channel (80 per chip) to be used repeatedly for up to 20 times. It should be noted that, in principle, the measurement accuracy does not suffer due to repeated regeneration cycles, because 3

4 switchsense does not rely on an absolute fluorescence measurement but assesses molecular motion/dynamics instead. However, the time needed to acquire signals of comparable signal-to-noise ratios increases when the DNA layer quality declines, which in practice limits the number of regenerations possible. Getting parallel: DNA encoded addressing In a switchsense experiment, the DNA nanolevers fulfill a dual purpose: to act s negatively charged nano-rods and to use their base-pairing capabilities to direct capture molecules to their designated detection spots. This enables a parallel and selective functionalization of all microelectrodes in a flow channel simultaneously. within one flow channel can be incubated simultaneously with a mixture of the conjugates in step. The specially selected sequences ensure that the conjugates hybridize with the DNA-tethers on the designated electrodes only. The DNA sequences of the standard 48 bp DNA levers as well as the 20 bp anchor strands have been selected for minimal cross-reactivity between the different detection spots, thus unwanted hybridization reactions are practically negligible. Chip layout The number of flow channels on the chip as well as the number of different DNA-tether sequences can be chosen according to the experimental requirements. If only few interactions need to be investigated, the electrode functionalization can feature replicates in favor of better measurement statistics. If a large number of diverse interactions are to be investigated simultaneously, the chip can be configured for maximal parallelization. No. of flow channels No. of electrodes per channel No. of different DNA sequences per channel Examples for chip configurations: Figure 6 DNA encoded addressing. Capture molecules are conjugated to different, unique cdna sequences in step. Subsequently, all electrodes 4 channels with 6 electrodes, each channel is modified with 2 different sequences (4 6-2s) 2 channels with 12 electrodes, each channel is modified with 6 different sequences (2 12-6s) 4

5 5

Enhance Your Protein Interaction Research with A New Level of Bench-Top Productivity

Enhance Your Protein Interaction Research with A New Level of Bench-Top Productivity LAMDAGEN C O R P O R A T I O N Enhance your research with real-time monitoring and quantitation of biomolecular binding with highly sensitive detection in a label-free format 9 Enhance Your Protein Interaction

More information

GE Biacore T Check that the waste bottle is empty.

GE Biacore T Check that the waste bottle is empty. GE Biacore T200 General Care and Maintenance The instrument should be left ON at all times, and in Standby Mode. Report problems immediately in the booking system: https://ppms.us/hms-cmi. Refer to the

More information

Microarray Industry Products

Microarray Industry Products Via Nicaragua, 12-14 00040 Pomezia (Roma) Phone: +39 06 91601628 Fax: +39 06 91612477 info@lifelinelab.com www.lifelinelab.com Microarray Industry Products Page 10 NBT / BCPIP Chromogenic phosphatase

More information

Fluorescent In Situ Hybridization (FISH) Assay

Fluorescent In Situ Hybridization (FISH) Assay Fluorescent In Situ Hybridization (FISH) Assay 1 What is FISH 2 Probes 3 FISH Procedure 4 Application Definition, Principle and Sample Types The core of FISH technology A quick and simple FISH protocol

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

MagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study

MagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study MagSi Beads Magnetic Silica Beads for Life Science and Biotechnology study MagnaMedics Diagnostics B.V. / Rev. 9.2 / 2012 Wide range of products for numerous applications MagnaMedics separation solutions

More information

Supporting Information for: DNA-based delivery vehicles: ph-controlled disassembly and cargo release by Jung-Won Keum and Harry Bermudez

Supporting Information for: DNA-based delivery vehicles: ph-controlled disassembly and cargo release by Jung-Won Keum and Harry Bermudez Supporting Information for: DNA-based delivery vehicles: ph-controlled disassembly and cargo release by Jung-Won Keum and Harry Bermudez DNA sequences Strand Sequence 1- GGGTTAGGGTTAGGGTTAGGGAGGGTTAGGGTTAGGGTTAGGGAGGGTTAGGGTTAGGGTTAGGG

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

Lecture FO7 Affinity biosensors

Lecture FO7 Affinity biosensors Lecture FO7 Affinity biosensors Dr. MAK Wing Cheung (Martin) Biosensors & Bioelectronic Centre, IFM Email: mamak@ifm.liu.se Phone: +4613286921 (21 Feb 2014) Affinity biosensors Affinity biosensors: devices

More information

Multi-well formats. Overview method. Typical applications. 16-well slide. Surveillance chips 96-well SBS microplate

Multi-well formats. Overview method. Typical applications. 16-well slide. Surveillance chips 96-well SBS microplate Multi-well formats Overview Formats Immobilization method Typical applications 16-well slide Various Surveillance chips 96-well SBS microplate Virus or bacterial identification Molecular diagnostics Dose

More information

Supplementary Information. Arrays of Individual DNA Molecules on Nanopatterned Substrates

Supplementary Information. Arrays of Individual DNA Molecules on Nanopatterned Substrates Supplementary Information Arrays of Individual DNA Molecules on Nanopatterned Substrates Roland Hager, Alma Halilovic, Jonathan R. Burns, Friedrich Schäffler, Stefan Howorka S1 Figure S-1. Characterization

More information

Label-free interaction analysis in realtime using surface plasmon resonance

Label-free interaction analysis in realtime using surface plasmon resonance GE Healthcare Technology Note 23 Biacore systems Label-free interaction analysis in realtime using surface plasmon resonance Providing quantitative data on: report point Specificity sensorgram To what

More information

Reflected light a b. prism. flow chamber. flow chamber

Reflected light a b. prism. flow chamber. flow chamber GE Biacore T200 Getting Started Guide Introduction The Biacore T200 is an instrument for Surface Plasmon Resonance (SPR), an optical technique that measures changes in refractive index near a metal surface

More information

Surfaces with added value: Bioengineering for Bioanalysis and Medicine

Surfaces with added value: Bioengineering for Bioanalysis and Medicine Surfaces with added value: Bioengineering for Bioanalysis and Medicine Hans Sigrist :: 24/09/2003 :: Page 2 Molecular and Thin-Film Engineering of Surfaces Material + soluble or solid matter? (adsoptive)

More information

DNA Microarray Technology

DNA Microarray Technology 2 DNA Microarray Technology 2.1 Overview DNA microarrays are assays for quantifying the types and amounts of mrna transcripts present in a collection of cells. The number of mrna molecules derived from

More information

Bioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU.

Bioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU. Introduction to Bioinformatics: Microarray Technology Assc.Prof. Chuchart Areejitranusorn AMS. KKU. ความจร งเก ยวก บ ความจรงเกยวกบ Cell and DNA Cell Nucleus Chromosome Protein Gene (mrna), single strand

More information

Programming cell adhesion for on-chip sequential Boolean logic

Programming cell adhesion for on-chip sequential Boolean logic Supporting Information Programming cell adhesion for on-chip sequential Boolean logic functions Xiangmeng Qu,, Shaopeng Wang,, Zhilei Ge,, Jianbang Wang, Guangbao Yao, Jiang Li, Xiaolei Zuo, Jiye Shi,

More information

Immobilized Streptavidin Resin

Immobilized Streptavidin Resin 438PR-01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Immobilized Streptavidin Resin (Cat. # 786-390, 786-590, 786-591, 786-592) think

More information

πcode TM MicroDisc, Pre-activated (10-plex Sampler Kit) User Manual

πcode TM MicroDisc, Pre-activated (10-plex Sampler Kit) User Manual C03-052 V02 Mar-18 Page 1 / 8 πcode TM MicroDisc, Pre-activated (10-plex Sampler Kit) User Manual 1. INTENDED USE 80134 10-plex; 10,000 MD each For Research Use Only PlexBio Co., Ltd. 6F-1, No. 351, Yangguang

More information

PRODUCT DATA SHEET. Carboxylated Gold Nanoparticles. Description. Features. Storage. Applications. Handling. Characteristics

PRODUCT DATA SHEET. Carboxylated Gold Nanoparticles. Description. Features. Storage. Applications. Handling. Characteristics PRODUCT DATA SHEET Carboxylated Gold Nanoparticles Description Cytodiagnostics carboxylated gold nanoparticles are available with two different lengths of PEG surface spacers, i.e. 3000Da and 5000Da offering

More information

How to run Alpha assay: How to setup an Alpha assay Make your own assay!

How to run Alpha assay: How to setup an Alpha assay Make your own assay! How to run Alpha assay: How to setup an Alpha assay Make your own assay! 1 2009 PerkinElmer AlphaLISA kits - recommendations before starting the assay Samples: Phenol red and hemoglobin: choose AlphaLISA

More information

Overview of Solulink Products. June 2011

Overview of Solulink Products. June 2011 Overview of Solulink Products June 2011 1 Who we are Established in 2003, Solulink develops, patents, manufactures, and sells consumables to over 1,000 customers in life science, diagnostic, and pharmaceutical

More information

Chapter 1. from genomics to proteomics Ⅱ

Chapter 1. from genomics to proteomics Ⅱ Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more

More information

Sensitive Detection of Small Molecules by Competitive Immunomagnetic-Proximity Ligation Assay

Sensitive Detection of Small Molecules by Competitive Immunomagnetic-Proximity Ligation Assay Sensitive Detection of Small Molecules by Competitive Immunomagnetic-Proximity Ligation Assay Shuyan Cheng a, Feng Shi a, Xuecheng Jiang a, Luming Wang a, Weiqing Chen b, Chenggang Zhu a * a College of

More information

Fluorescent in-situ Hybridization

Fluorescent in-situ Hybridization Fluorescent in-situ Hybridization Presented for: Presented by: Date: 2 Definition In situ hybridization is the method of localizing/ detecting specific nucleotide sequences in morphologically preserved

More information

How to Biotinylate with Quantifiable Results

How to Biotinylate with Quantifiable Results How to Biotinylate with Quantifiable Results Introduction The Biotin-Streptavidin system continues to be used in many protein-based biological research applications including; ELISAs, immunoprecipitation,

More information

Product Information. Before you begin. Component A 1 vial of 30 ul vial of 300 ul each Glycerol. Tris

Product Information. Before you begin. Component A 1 vial of 30 ul vial of 300 ul each Glycerol. Tris Glowing Products for Science Mix-n-Stain Antibody Labeling Kits Size: 1 labeling per kit Storage: -20 o C Stability: Stable for at least 1 year from date of receipt when stored as recommended. Components:

More information

Perform reproducible immunoprecipitation in less than 40 minutes

Perform reproducible immunoprecipitation in less than 40 minutes Perform reproducible immunoprecipitation in less than 40 minutes Dynabeads products Immunoprecipitation made easy with low nonspecific binding, high yield, and reproducibility Magnetic beads have become

More information

mrnadembeads Purification Mini Kit (cat #06011) Instruction manual for mrna purification

mrnadembeads Purification Mini Kit (cat #06011) Instruction manual for mrna purification mrnadembeads Purification Mini Kit (cat #06011) Instruction manual for mrna purification Ademtech * Bioparc BioGalien 27 Allée Charles Darwin * 33600 Pessac France Tel : + 33 (0) 57 02 02 01, Fax : + 33

More information

What Are the Chemical Structures and Functions of Nucleic Acids?

What Are the Chemical Structures and Functions of Nucleic Acids? THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic

More information

AnaTag HiLyte Fluor 750 Microscale Protein Labeling Kit

AnaTag HiLyte Fluor 750 Microscale Protein Labeling Kit AnaTag HiLyte Fluor 750 Microscale Protein Labeling Kit Catalog # 72044 Kit Size 3 Conjugation Reactions This kit is optimized to conjugate HiLyte Fluor 750 SE to proteins (e.g., IgG). It provides ample

More information

Basic Biacore Course. Introduction to SPR technology. Biacore Training

Basic Biacore Course. Introduction to SPR technology. Biacore Training Basic Biacore Course Introduction to SPR technology What Biacore measure Biomolecular Interactions Specificity Kinetics How Specific... How Fast & How Strong... Affinity Concentration Thermodynamics How

More information

Methods in virus diagnosis PCR techniques

Methods in virus diagnosis PCR techniques Methods in virus diagnosis PCR techniques 450 MBIO PRACTICAL LESSON 5 Molecular Methods Methods based on the detection of viral genome are also commonly known as molecular methods. It is often said that

More information

PHYS 498 HW3 Solutions: 1. We have two equations: (1) (2)

PHYS 498 HW3 Solutions: 1. We have two equations: (1) (2) PHYS 498 HW3 Solutions: 1. We have two equations: (1) (2) Where Conc is the initial concentration of [B] or [SA] Since [B] = [SA], the second equation simplifies to: (3) Using equation (1) and (3), we

More information

Supplementary Table 1. Oligonucleotide sequences used in the study

Supplementary Table 1. Oligonucleotide sequences used in the study Supplementary Table 1. Oligonucleotide sequences used in the study Oligonucleotides Sequences (5 3 ) Substrate strand Lock -4 Lock -5 Lock -6 Lock -7 Free control DNAzyme DNAzyme strand linked to AuNP

More information

7/24/2012. DNA Probes. Hybridization and Probes. CLS 420 Immunology & Molecular Diagnostics. Target Sequences. Target Sequences. Nucleic Acid Probes

7/24/2012. DNA Probes. Hybridization and Probes. CLS 420 Immunology & Molecular Diagnostics. Target Sequences. Target Sequences. Nucleic Acid Probes Hybridization and Probes CLS 420 Immunology & Molecular Diagnostics Molecular Diagnostics Techniques: Hybridization and Probes Nucleic acid probes: A short, known sequence of DNA or RNA Used to detect

More information

Biomarker Discovery using Surface Plasmon Resonance Imaging

Biomarker Discovery using Surface Plasmon Resonance Imaging F e a t u r e A r t i c l e Feature Article Biomarker Discovery using Surface Plasmon Resonance Imaging Elodie LY-MORIN, Sophie BELLON, Géraldine MÉLIZZI, Chiraz FRYDMAN Surface Plasmon Resonance (SPR)

More information

Development of an Immuno-PCR Assay

Development of an Immuno-PCR Assay Development of an Immuno-PCR Assay Innova Biosciences Guide Innova Biosciences Ltd. Babraham Research Campus, Cambridge, UK, CB22 3AT +44 (0)1223 661000 info@innovabiosciences.com Development of an Immuno-PCR

More information

Supplementary Figure 1. Antibody-induced cargo release studied by native PAGE. A clear band corresponding to the cargo strand (lane 1) is visible.

Supplementary Figure 1. Antibody-induced cargo release studied by native PAGE. A clear band corresponding to the cargo strand (lane 1) is visible. Supplementary Figure 1. Antibody-induced cargo release studied by native PAGE. A clear band corresponding to the cargo strand (lane 1) is visible. Because SYBR Gold is less sensitive to single stranded

More information

Product Specifications & Manual

Product Specifications & Manual Product Specifications & Manual Oligo dt primers, random primers, sequencing primers Custom Oligo Synthesis, antisense oligos, RNA oligos, chimeric oligos, Affinity Ligands, 2-5 linked Oligos Oligo dt

More information

BIAffinity Application Note

BIAffinity Application Note BIAffinity Application Note Rifs analysis of the interaction between antibody mab1 and mab1 binding peptide pep1 1 Introduction The BIAffinity used in these studies is based on the detection principle

More information

NextGen Sequencing Technologies Sequencing overview

NextGen Sequencing Technologies Sequencing overview Outline Conventional NextGen High-throughput sequencing (Next-Gen sequencing) technologies. Illumina sequencing in detail. Quality control. Sequence coverage. Multiplexing. FASTQ files. Shendure and Ji

More information

Ligation Independent Cloning (LIC) Procedure

Ligation Independent Cloning (LIC) Procedure Ligation Independent Cloning (LIC) Procedure Ligation Independent Cloning (LIC) LIC cloning allows insertion of DNA fragments without using restriction enzymes into specific vectors containing engineered

More information

EZ-Link Phosphine-PEG 4 -Desthiobiotin, No-Weigh Format

EZ-Link Phosphine-PEG 4 -Desthiobiotin, No-Weigh Format INSTRUCTIONS EZ-Link Phosphine-PEG 4 -Desthiobiotin, No-Weigh Format 16133 Number Description 16133 EZ-Link Phosphine-PEG 4 -Desthiobiotin, No-Weigh Format, 5 x 1mg Molecular Weight: 778.87 Spacer Arm:

More information

ab Gold Hydrazide Conjugation Kit (40nm, 10OD)

ab Gold Hydrazide Conjugation Kit (40nm, 10OD) ab188284 Gold Hydrazide Conjugation Kit (40nm, 10OD) Instructions for Use For the Covalent Conjugation of Antibodies or Proteins to Gold This product is for research use only and is not intended for diagnostic

More information

Towards Single Molecule Detection of SEB A Mobile Sandwich Immunoassay on Gliding Microtubules. Dr. Carissa M. Soto

Towards Single Molecule Detection of SEB A Mobile Sandwich Immunoassay on Gliding Microtubules. Dr. Carissa M. Soto Towards Single Molecule Detection of SEB A Mobile Sandwich Immunoassay on Gliding Microtubules Dr. Carissa M. Soto March 8, 2008 Dr. Kim E. Sapsford, Dr. Brett D. Martin, Dr. Amy Szuchmacher Blum, and

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

Typical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides

Typical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides Aminosilane coating Nexterion Slide A+ and Slide AStar Overview Type of coating Immobilization method Typical probes Ordering information Nexterion product Barcode option Item number Slides per pack Aminosilane

More information

AnaTag HiLyte Fluor 647 Protein Labeling Kit

AnaTag HiLyte Fluor 647 Protein Labeling Kit AnaTag HiLyte Fluor 647 Protein Labeling Kit Catalog # 72049 Kit Size 3 Conjugation Reactions This kit is optimized to conjugate HiLyte Fluor 647 SE to proteins (e.g., IgG). It provides ample materials

More information

RayBio Human IgG1 ELISA Kit

RayBio Human IgG1 ELISA Kit RayBio Human IgG1 ELISA Kit Catalog #: ELH-IGG1 User Manual Last revised April 15, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite 100 Norcross, GA

More information

Single-molecule imaging of DNA curtains reveals intrinsic energy landscapes for nucleosome deposition

Single-molecule imaging of DNA curtains reveals intrinsic energy landscapes for nucleosome deposition SUPPLEMENTARY INFORMATION Single-molecule imaging of DNA curtains reveals intrinsic energy landscapes for nucleosome deposition Mari-Liis Visnapuu 1 and Eric C. Greene 1 1 Department of Biochemistry &

More information

Biacore X100. GE Healthcare Life Sciences. Biacore X100 Plus Package. Biacore X100 delivers:

Biacore X100. GE Healthcare Life Sciences. Biacore X100 Plus Package. Biacore X100 delivers: GE Healthcare Life Sciences Data file 28-9592-29 AB Biacore label-free interaction analysis Biacore X100 Biacore X100 (Fig 1) is an automated and versatile system for comprehensive, label-free analysis

More information

Bootcamp: Molecular Biology Techniques and Interpretation

Bootcamp: Molecular Biology Techniques and Interpretation Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing

More information

Basic lab techniques

Basic lab techniques Basic lab techniques Sandrine Dudoit Bioconductor short course Summer 2002 Copyright 2002, all rights reserved Lab techniques Basic lab techniques for nucleic acids Hybridization. Cut: restriction enzymes.

More information

Solid Phase cdna Synthesis Kit

Solid Phase cdna Synthesis Kit #6123 v.02.09 Table of Contents I. Description... 2 II. Kit components... 2 III. Storage... 2 IV. Principle... 3 V. Protocol V-1. Preparation of immobilized mrna... 4 Protocol A: Starting from Tissue or

More information

ab Oligonucleotide Conjugation Kit

ab Oligonucleotide Conjugation Kit ab188289 Oligonucleotide Conjugation Kit Instructions for Use For the Covalent Conjugation of Antibodies and Oligonucelotides. This product is for research use only and is not intended for diagnostic use.

More information

Biacore. Sensor Surface Handbook

Biacore. Sensor Surface Handbook Biacore Sensor Surface Handbook Contents 1 Introduction 1.1 Principles of Biacore systems... 7 1.2 Biacore terminology... 7 1.3 Components of Biacore systems... 9 1.3.1 The SPR detection system... 9 1.3.2

More information

Characterization of Small Molecule to Protein Binding

Characterization of Small Molecule to Protein Binding Silicon Kinetics Application Note 11 Characterization of Small Molecule to Protein Binding Summary Label-free technologies are mostly used for detection of biomolecular interactions between proteins or

More information

Supporting Information

Supporting Information Supporting Information Koh et al. 10.1073/pnas.1212917110 SI Materials and Methods Protein Purification. N-terminal His 6 -Dicer was purified as previously described with several modifications (1). After

More information

AnaTag HiLyte Fluor 647 Microscale Protein Labeling Kit

AnaTag HiLyte Fluor 647 Microscale Protein Labeling Kit AnaTag HiLyte Fluor 647 Microscale Protein Labeling Kit Revision number: 1.3 Last updated: May 2018 Catalog # AS-72050 Kit Size 3 Conjugation Reactions This kit is optimized to conjugate HiLyte Fluor 647

More information

Antibody drug conjugate screening and characterization

Antibody drug conjugate screening and characterization Antibody drug conjugate screening and characterization Simple and effective tools for monitoring antibody internalization Antibody drug conjugates Visual confi rmation of internalization Over the past

More information

High Pure RNA Isolation Kit for isolation of total RNA from 50 samples Cat. No

High Pure RNA Isolation Kit for isolation of total RNA from 50 samples Cat. No for isolation of total RNA from 50 samples Cat. No. 1 88 665 Principle A single reagent lyses the sample lysis and inactivates RNase. In the presence of a chaotropic salt (guanidine HCl), the released

More information

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc. Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers

More information

Phage Antibody Selection With Reichert SPR System

Phage Antibody Selection With Reichert SPR System Phage Antibody Selection With Reichert SPR System Reichert Technologies Webinar April 4, 2016 Mark A. Sullivan, Ph.D. Department of Microbiology and Immunology University of Rochester Presentation Outline

More information

ELISA. An introduction to the basic principles and assay formats. Innova Biosciences ltd All rights reserved

ELISA. An introduction to the basic principles and assay formats. Innova Biosciences ltd All rights reserved ELISA An introduction to the basic principles and assay formats Agenda Agenda: Introduction to ELISA The different assay types Assay development tips Data analysis tips Troubleshooting tips Indirect vs.

More information

Product. Ni-NTA His Bind Resin. Ni-NTA His Bind Superflow. His Bind Resin. His Bind Magnetic Agarose Beads. His Bind Column. His Bind Quick Resin

Product. Ni-NTA His Bind Resin. Ni-NTA His Bind Superflow. His Bind Resin. His Bind Magnetic Agarose Beads. His Bind Column. His Bind Quick Resin Novagen offers a large variety of affinity supports and kits for the purification of recombinant proteins containing popular peptide fusion tags, including His Tag, GST Tag, S Tag and T7 Tag sequences.

More information

Please purchase PDFcamp Printer on to remove this watermark. DNA microarray

Please purchase PDFcamp Printer on  to remove this watermark. DNA microarray DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of

More information

TECHNICAL NOTE. microrna Profiling with FirePlex mirselect: A Technical Overview and Cross-Cytometer Comparison

TECHNICAL NOTE. microrna Profiling with FirePlex mirselect: A Technical Overview and Cross-Cytometer Comparison TECHNICAL NOTE microrna Profiling with FirePlex mirselect: A Technical Overview and Cross-Cytometer Comparison FirePlex mirselect is a high-throughput, customizable solution for microrna profiling across

More information

AnaTag HiLyte Fluor 488 Microscale Protein Labeling Kit

AnaTag HiLyte Fluor 488 Microscale Protein Labeling Kit AnaTag HiLyte Fluor 488 Microscale Protein Labeling Kit Revision number: 1.3 Last updated: April 2018 Catalog # AS-72048 Kit Size 3 Conjugation Reactions This kit is optimized to conjugate HiLyte Fluor

More information

Deoxyribonucleic Acid DNA

Deoxyribonucleic Acid DNA Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

IgG1 (Human) ELISA Kit

IgG1 (Human) ELISA Kit IgG1 (Human) ELISA Kit Catalog Number KA1730 96 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay... 3 General

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Supporting Information

Supporting Information Copyright WILEY-VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 2014. Supporting Information for Small, DOI: 10.1002/smll.201303558 Ultraspecific and Highly Sensitive Nucleic Acid Detection by Integrating

More information

Factors affecting PCR

Factors affecting PCR Lec. 11 Dr. Ahmed K. Ali Factors affecting PCR The sequences of the primers are critical to the success of the experiment, as are the precise temperatures used in the heating and cooling stages of the

More information

Surface Plasmon Resonance Analyzer

Surface Plasmon Resonance Analyzer Surface Plasmon Resonance Analyzer 5 6 SPR System Based on Microfluidics Wide Dynamic Range Kinetic Analysis by Detection of Association /Dissociation of Bio-Molecules Measuring of Mass Change below

More information

Comparison of different methods for purification analysis of a green fluorescent Strep-tag fusion protein. Application

Comparison of different methods for purification analysis of a green fluorescent Strep-tag fusion protein. Application Comparison of different methods for purification analysis of a green fluorescent Strep-tag fusion protein Application Petra Sebastian Meike Kuschel Stefan Schmidt Abstract This Application Note describes

More information

Product Specifications & Manual

Product Specifications & Manual Product Specifications & Manual Custom Oligo Synthesis, antisense oligos, RNA oligos, chimeric oligos, Fluorescent dye labeled oligos, Molecular Beacons, sirna, phosphonates Affinity Ligands, 2-5 linked

More information

TARGETS Anti-Biotin Anti-Streptavidin Anti-FITC Anti-Phycoerythrin Anti-Mouse IgG Anti-Rabbit IgG (H+L) Anti-Human IgG (H+L)

TARGETS Anti-Biotin Anti-Streptavidin Anti-FITC Anti-Phycoerythrin Anti-Mouse IgG Anti-Rabbit IgG (H+L) Anti-Human IgG (H+L) Signal Amplifiers Genisphere s UltraAmp reagents are 3DNA dendrimers customized with a variety of labels and targeting moieties, to increase the sensitivity in any immunoassay or nucleic acid detection

More information

Masayoshi Honda, Jeehae Park, Robert A. Pugh, Taekjip Ha, and Maria Spies

Masayoshi Honda, Jeehae Park, Robert A. Pugh, Taekjip Ha, and Maria Spies Molecular Cell, Volume 35 Supplemental Data Single-Molecule Analysis Reveals Differential Effect of ssdna-binding Proteins on DNA Translocation by XPD Helicase Masayoshi Honda, Jeehae Park, Robert A. Pugh,

More information

ab Oligonucleotide Conjugation Kit

ab Oligonucleotide Conjugation Kit Version 2 Last updated 6 April 2017 ab218260 Oligonucleotide Conjugation Kit For the covalent conjugation of antibodies to oligonucleotides. This product is for research use only and is not intended for

More information

ab Oligonucleotide Conjugation Kit

ab Oligonucleotide Conjugation Kit Version 2 Last updated 6 April 2017 ab218260 Oligonucleotide Conjugation Kit For the covalent conjugation of antibodies to oligonucleotides. This product is for research use only and is not intended for

More information

DNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT.

DNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. DNA/RNA MICROARRAYS This protocol is based on the EDVOTEK protocol DNA/RNA Microarrays. 10 groups of students NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. 1. EXPERIMENT OBJECTIVE The objective of this

More information

BIOSENOSRS BIO 580. Nanobiosensors WEEK-13 Fall Semester. Faculty: Dr. Javed H. Niazi KM Faculty of Engineering & Natural Sciences Sabanci University

BIOSENOSRS BIO 580. Nanobiosensors WEEK-13 Fall Semester. Faculty: Dr. Javed H. Niazi KM Faculty of Engineering & Natural Sciences Sabanci University BIOSENOSRS BIO 580 Nanobiosensors WEEK-13 Fall Semester Faculty: Dr. Javed H. Niazi KM Faculty of Engineering & Natural Sciences Sabanci University Topics that will be covered in the course History of

More information

High Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Tuesday December 16, 2014

High Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Tuesday December 16, 2014 High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Tuesday December 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion

More information

Aims: -Purification of a specific protein. -Study of protein-protein interactions

Aims: -Purification of a specific protein. -Study of protein-protein interactions Aims: -Purification of a specific protein -Study of protein-protein interactions This is a reliable method for purifying total IgG from crude protein mixtures such as serum. Protein A (linked to resin

More information

Supplementary Figure 1. Binding capacity of the nanoparticles. Protein A-coated magnetic nanoparticles were mixed with FITC-antibody (antibody

Supplementary Figure 1. Binding capacity of the nanoparticles. Protein A-coated magnetic nanoparticles were mixed with FITC-antibody (antibody Supplementary Figure 1. Binding capacity of the nanoparticles. Protein A-coated magnetic nanoparticles were mixed with FITC-antibody (antibody conjugated with FITC) and PE-antibody (antibody conjugated

More information

Nanobiotechnology. Place: IOP 1 st Meeting Room Time: 9:30-12:00. Reference: Review Papers. Grade: 50% midterm, 50% final.

Nanobiotechnology. Place: IOP 1 st Meeting Room Time: 9:30-12:00. Reference: Review Papers. Grade: 50% midterm, 50% final. Nanobiotechnology Place: IOP 1 st Meeting Room Time: 9:30-12:00 Reference: Review Papers Grade: 50% midterm, 50% final Midterm: 5/15 History Atom Earth, Air, Water Fire SEM: 20-40 nm Silver 66.2% Gold

More information

Polymerase Chain Reaction PCR

Polymerase Chain Reaction PCR Polymerase Chain Reaction PCR What is PCR? An in vitro process that detects, identifies, and copies (amplifies) a specific piece of DNA in a biological sample. Discovered by Dr. Kary Mullis in 1983. A

More information

Characterization of Aptamer Binding using SensíQ SPR Platforms

Characterization of Aptamer Binding using SensíQ SPR Platforms Characterization of Aptamer Binding using SensíQ SPR Platforms APPLICATION NOTE INTRODUCTION Aptamers have the potential to provide a better solution in diagnostics and other research areas than traditional

More information

Elecrtonic Supplementary Information. Application of quantum dot barcodes prepared using biological self-assembly to multiplexed immunoassays

Elecrtonic Supplementary Information. Application of quantum dot barcodes prepared using biological self-assembly to multiplexed immunoassays Elecrtonic Supplementary Information Application of quantum dot barcodes prepared using biological self-assembly to multiplexed immunoassays Sakandar Rauf, Andrew Glidle and Jonathan M Cooper Department

More information

UltraFast Molecular Diagnostic System

UltraFast Molecular Diagnostic System UltraFast Molecular Diagnostic System CONTENTS 01 PCR vs Real-time PCR 02 NANOBIOSYS Sample Prep G2-16TU 03 NANOBIOSYS Real-time PCR G2-4 01 PCR vs Real-time PCR What is DNA & What is PCR? NANOBIOSYS 4

More information

SURFACE PLASMON RESONANCE-BASED SYSTEMS

SURFACE PLASMON RESONANCE-BASED SYSTEMS SURFACE PLASMON RESONANCE-BASED SYSTEMS ADVANCED METHODS IN BIOENGINEERING LABORATORY 3/1/2011 1 Schedule Week 1: Introduction Reagents preparation Ligand immobilization of Protocol 1 Week 2: Kinetics

More information

High Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014

High Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014 High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion

More information

Supplementary Figure S1 Supplementary Figure S2 Supplementary Figure S3. Supplementary Figure S4

Supplementary Figure S1 Supplementary Figure S2 Supplementary Figure S3. Supplementary Figure S4 Supplementary Figure S1 Supplementary Figure S2 Supplementary Figure S3 Supplementary Figure S4 Supplementary Figure S5 Supplementary Figure S6 Supplementary Figure S7 Supplementary Figure S8 Supplementary

More information

λ-terminase Cat. Nos. LT4450 and LT44200

λ-terminase Cat. Nos. LT4450 and LT44200 Cat. Nos. LT4450 and LT44200 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 056 11/201 1 EPILIT056

More information

EpiQuik General Protein-DNA Binding Assay Kit (Fluorometric)

EpiQuik General Protein-DNA Binding Assay Kit (Fluorometric) EpiQuik General Protein-DNA Binding Assay Kit (Fluorometric) Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik General Protein-DNA Binding Assay Kit (Fluorometric) is suitable for

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

High Resolution Microarray Scanner used to Compare CGH Labeling Methods

High Resolution Microarray Scanner used to Compare CGH Labeling Methods High Resolution Microarray Scanner used to Compare CGH Labeling Methods Jack Coleman 1, Wini Luty 1,Marie-Laure Schneider 2 1 Enzo Life Sciences, Farmingdale, NY USA, 2 Innopsys, Toulouse, France CYTAG

More information

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA LECTURE-29 Cell-free synthesis based protein microarrays TRANSCRIPT Welcome to the proteomics course. In today s lecture we will talk about protein microarrays based on cell-free synthesis. So cell-free

More information