Statistical method for Next Generation Sequencing pipeline comparison

Size: px
Start display at page:

Download "Statistical method for Next Generation Sequencing pipeline comparison"

Transcription

1 Statistical method for Next Generation Sequencing pipeline comparison Pascal Roy, MD PhD EPICLIN 2016 Strasbourg mai 2016 MH Elsensohn 1-4*, N Leblay 1-4, S Dimassi 5,6, A Campan-Fournier 5,6, A Labalme 5, D Sanlaville 5,6, G Lesca 5,6, C Bardel 1-4, P Roy Service de Biostatistique, Hospices Civils de Lyon, Lyon, France. 2 Université de Lyon, Lyon, France. 3 Université Lyon 1, Villeurbanne, France. 4 CNRS UMR 5558, Laboratoire de Biométrie et Biologie Evolutive, Equipe Biostatistique-Santé, Villeurbanne, France. 5 Service de Génétique, Hospices Civils de Lyon, Lyon, France 6 Centre de recherche en Neurosciences de Lyon (CNRS UMR 5292, INSERM U1028, Université Claude Bernard Lyon 1, Université Jean Monnet Saint-Etienne, and Hospices Civils de Lyon) Lyon, France. 1

2 DNA sequencing Sanger method (1977) considered as a Gold Standard New sequencers were designed since 2000 Next Generation Sequencing technologies became available since

3 Pipeline Association of software programs for the various steps of NGS data analyses Academic and commercial softwares are available How To compare two NGS pipelines once with another? Each with the Gold Standard Sanger? 3

4 DNA Sequencing NGS sequencing Sanger technique Genetics Department - Hospices Civils de Lyon Whole blood Informed consent 43 epileptic patients 41 genes (epilepsy / mental retardation) Ion Torrent PGM BWA-GATK and TMAP-NextGENe pipelines 30 epileptic patients 1 to 3 genes according to clinical signs 4

5 Statistical Unit = Chromosomal position on the reference sequence Hg19 Each patient = A single study All patients = A meta-analysis 5

6 2-by-2 pairwise table for agreement p = 1,, P patient z = A, B Pipeline k = 1,, K X pzk nπ pab 1 0 K k 1 otherwise Chromosomal position disagreeme ntwithhg19 I X a I X b,a 0,1,b 0,1 pak pbk 6

7 Agreement on position Agreement on position and nature 7

8 With Gold Standard Sanger variants Sensitivity comparison Sanger non-variants Specificity comparison 8

9 9

10 1 2 P-1 P 10

11 1 2 Saturated model for variant identity A B log(npab )= μp +aλp +bλp +ab(θ p +Iθ ps Alternative approach Fitting mixed-effects log-linear models Random effects for biological variability ) P-1 P 11

12 # of Variants identified by the pipelines and by the gold standard All Types of variants* Variants and pipelines N Mean±SD Min. Max. Regions sequenced by MPS only BWA-GATK ± TMAP-NextGENe ± Region sequenced by MPS +Sanger Sanger ± BWA-GATK ± TMAP-NextGENe ± * Single Nucleotide Variants (SNVs), insertions, and deletions base-pairs per patient 1 to 3 genes and to base-pairs per patient 12

13 # of Variants identified by the pipelines and by the gold standard Only SNVs Variants and pipelines N Mean±SD Min. Max. Regions sequenced by MPS only BWA-GATK ± TMAP-NextGENe ± Region sequenced by MPS +Sanger Sanger ± BWA-GATK ± TMAP-NextGENe ± base-pairs per patient to base-pairs per patient 13

14 Pipeline comparisons - All types of variants Estimation of parameters Variants, pipelines, parameters Value 95% CI 95% BVI Without Gold Standard * # of variants for BWA-GATK ; ; # of variants for TMAP-NextGENe ; ; OR for agreement ; ; Conditional probability of identity ** ; ; 0.28 With Gold Standard Sensitivity of BWA-GATK (%) ; ; Sensitivity of TMAP-NextGENe (%) ; ; FP rate for BWA-GATK ; NA FP rate for TMAP-NextGENe ; NA * Heterogeneous margins and odds-ratios. **Heterogeneous variant identity parameter Heterogeneous margins and odds-ratios for specificity extended to sensitivity analysis for Sanger NV 14

15 Pipeline comparisons - Only SNVs Estimation of parameters Variants, pipelines, parameters Value 95% CI 95% BVI Without Gold Standard * Number of SNVs for BWA-GATK ; ; Number of SNVs for TMAP-NextGENe ; ; OR for agreement ; ; Conditional probability of identity ** ; NA With Gold Standard Sensitivity of BWA-GATK (%) ; NA Sensitivity of TMAP-NextGENe (%) ; NA FP rate for BWA-GATK ; 2.24 NA FP rate for TMAP-NextGENe ; 2.24 NA * Heterogeneous margins and odds-ratios. **Homogeneous variant identity parameter Homogeneous margins and odds-ratios for specificity extended to sensitivity analysis 15 for Sanger NV

16 Discussion Several usual statistical methods may be adapted to NGS analyses More sophisticated experimental designs are needed to analyze the various components of experimental variability, in contrast with biological variability More sophisticated decision rules are needed to select appropriate pipelines, including the respective costs of FP and FN When all variants were analyzed, the performances of the 2 pipelines were low in terms of false sensitivity et specificity In substitution analyses, a better performance was observed, leading to a very high value of the odds-ratio for agreement Extensions of these models are needed to evaluated the performances of NGS 16

17 References Li H. Exploring single-sample SNP and INDEL calling with wholegenome de novo assembly. Bioinformatics 2012;28: Agresti A. Categorical Data Analysis, 3 rd edition. Wiley, Becker MP., Agresti A. Log-linear modelling of pairwise interobserver agreement on a categorical scale. Stat Med 1992;11:

Statistical method to compare massive parallel sequencing pipelines

Statistical method to compare massive parallel sequencing pipelines Statistical method to compare massive parallel sequencing pipelines Delphine Maucort-Boulch MD PhD Mad-Hélénie Elsensohn Msc, Florence Roucher-Boulez PharmD PhD, Claire Bardel PhD, Pascal Roy MD PhD Service

More information

Variant detection analysis in the BRCA1/2 genes from Ion torrent PGM data

Variant detection analysis in the BRCA1/2 genes from Ion torrent PGM data Variant detection analysis in the BRCA1/2 genes from Ion torrent PGM data Bruno Zeitouni Bionformatics department of the Institut Curie Inserm U900 Mines ParisTech Ion Torrent User Meeting 2012, October

More information

The Basics of Understanding Whole Genome Next Generation Sequence Data

The Basics of Understanding Whole Genome Next Generation Sequence Data The Basics of Understanding Whole Genome Next Generation Sequence Data Heather Carleton-Romer, MPH, Ph.D. ASM-CDC Infectious Disease and Public Health Microbiology Postdoctoral Fellow PulseNet USA Next

More information

Introduction to metagenome assembly. Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014

Introduction to metagenome assembly. Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014 Introduction to metagenome assembly Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014 Sequencing specs* Method Read length Accuracy Million reads Time Cost per M 454

More information

Performance of the Newly Developed Non-Invasive Prenatal Multi- Gene Sequencing Screen

Performance of the Newly Developed Non-Invasive Prenatal Multi- Gene Sequencing Screen 1 // Performance of the Newly Developed Non-Invasive Prenatal Multi- Gene Sequencing Screen ABSTRACT Here we describe the analytical performance of the newly developed non-invasive prenatal multi-gene

More information

Targeted Sequencing in the NBS Laboratory

Targeted Sequencing in the NBS Laboratory Targeted Sequencing in the NBS Laboratory Christopher Greene, PhD Newborn Screening and Molecular Biology Branch Division of Laboratory Sciences Gene Sequencing in Public Health Newborn Screening February

More information

Data Basics. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis

Data Basics. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis Data Basics Josef K Vogt Slides by: Simon Rasmussen 2017 Generalized NGS analysis Sample prep & Sequencing Data size Main data reductive steps SNPs, genes, regions Application Assembly: Compare Raw Pre-

More information

Assay Validation Services

Assay Validation Services Overview PierianDx s assay validation services bring clinical genomic tests to market more rapidly through experimental design, sample requirements, analytical pipeline optimization, and criteria tuning.

More information

Alignment methods. Martijn Vermaat Department of Human Genetics Center for Human and Clinical Genetics

Alignment methods. Martijn Vermaat Department of Human Genetics Center for Human and Clinical Genetics Alignment methods Martijn Vermaat Department of Human Genetics Center for Human and Clinical Genetics Alignment methods Sequence alignment Assembly vs alignment Alignment methods Common issues Platform

More information

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel. DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private

More information

THE ERA OF INDIVIDUAL GENOMES. Sandra Viz Lasheras Advanced Genetics ( )

THE ERA OF INDIVIDUAL GENOMES. Sandra Viz Lasheras Advanced Genetics ( ) THE ERA OF INDIVIDUAL GENOMES Sandra Viz Lasheras Advanced Genetics (2017-2018) CONTENTS 1. INTRODUCTION - The genomic era - Sequencing techniques 2. PROJECTS - 1000 genomes project - Individual genome

More information

Analytics Behind Genomic Testing

Analytics Behind Genomic Testing A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical

More information

An innovative approach to genetic testing for improved patient care

An innovative approach to genetic testing for improved patient care An innovative approach to genetic testing for improved patient care Blueprint Genetics Blueprint Genetics is changing diagnostics by providing fast, affordable and comprehensive genetic knowledge Who we

More information

Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4

Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4 WHITE PAPER Oncomine Comprehensive Assay Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4 Contents Scope and purpose of document...2 Content...2 How Torrent

More information

Variant Callers. J Fass 24 August 2017

Variant Callers. J Fass 24 August 2017 Variant Callers J Fass 24 August 2017 Variant Types Caller Consistency Pabinger (2014) Briefings Bioinformatics 15:256 Freebayes Bayesian haplotype caller that can call SNPs, short CNVs / duplications,

More information

Setting Standards and Raising Quality for Clinical Bioinformatics. Joo Wook Ahn, Guy s & St Thomas 04/07/ ACGS summer scientific meeting

Setting Standards and Raising Quality for Clinical Bioinformatics. Joo Wook Ahn, Guy s & St Thomas 04/07/ ACGS summer scientific meeting Setting Standards and Raising Quality for Clinical Bioinformatics Joo Wook Ahn, Guy s & St Thomas 04/07/2016 - ACGS summer scientific meeting 1. Best Practice Guidelines Draft guidelines circulated to

More information

14 March, 2016: Introduction to Genomics

14 March, 2016: Introduction to Genomics 14 March, 2016: Introduction to Genomics Genome Genome within Ensembl browser http://www.ensembl.org/homo_sapiens/location/view?db=core;g=ensg00000139618;r=13:3231547432400266 Genome within Ensembl browser

More information

Agilent NGS Solutions : Addressing Today s Challenges

Agilent NGS Solutions : Addressing Today s Challenges Agilent NGS Solutions : Addressing Today s Challenges Charmian Cher, Ph.D Director, Global Marketing Programs 1 10 years of Next-Gen Sequencing 2003 Completion of the Human Genome Project 2004 Pyrosequencing

More information

Processing Ion AmpliSeq Data using NextGENe Software v2.3.0

Processing Ion AmpliSeq Data using NextGENe Software v2.3.0 Processing Ion AmpliSeq Data using NextGENe Software v2.3.0 July 2012 John McGuigan, Megan Manion, Kevin LeVan, CS Jonathan Liu Introduction The Ion AmpliSeq Panels use highly multiplexed PCR in order

More information

SNP calling and VCF format

SNP calling and VCF format SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide

More information

with drmid Dx for Illumina NGS systems

with drmid Dx for Illumina NGS systems Performance Characteristics BRCA MASTR Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Revision date: July 27, 2017 Page 1 of 8 Table of Contents

More information

Biology Evolution: Mutation I Science and Mathematics Education Research Group

Biology Evolution: Mutation I Science and Mathematics Education Research Group a place of mind F A C U L T Y O F E D U C A T I O N Department of Curriculum and Pedagogy Biology Evolution: Mutation I Science and Mathematics Education Research Group Supported by UBC Teaching and Learning

More information

Personal Genomics Platform White Paper Last Updated November 15, Executive Summary

Personal Genomics Platform White Paper Last Updated November 15, Executive Summary Executive Summary Helix is a personal genomics platform company with a simple but powerful mission: to empower every person to improve their life through DNA. Our platform includes saliva sample collection,

More information

Understanding the science and technology of whole genome sequencing

Understanding the science and technology of whole genome sequencing Understanding the science and technology of whole genome sequencing Dag Undlien Department of Medical Genetics Oslo University Hospital University of Oslo and The Norwegian Sequencing Centre d.e.undlien@medisin.uio.no

More information

DNA polymorphisms and RNA-Seq alternative splicing blow bubbles in de Bruijn Graphs

DNA polymorphisms and RNA-Seq alternative splicing blow bubbles in de Bruijn Graphs DNA polymorphisms and RNA-Seq alternative splicing blow bubbles in de Bruijn Graphs Nadia Pisanti University of Pisa & Leiden University Outline New Generation Sequencing (NGS), and the importance of detecting

More information

Lees J.A., Vehkala M. et al., 2016 In Review

Lees J.A., Vehkala M. et al., 2016 In Review Sequence element enrichment analysis to determine the genetic basis of bacterial phenotypes Lees J.A., Vehkala M. et al., 2016 In Review Journal Club Triinu Kõressaar 16.03.2016 Introduction Bacterial

More information

C3BI. VARIANTS CALLING November Pierre Lechat Stéphane Descorps-Declère

C3BI. VARIANTS CALLING November Pierre Lechat Stéphane Descorps-Declère C3BI VARIANTS CALLING November 2016 Pierre Lechat Stéphane Descorps-Declère General Workflow (GATK) software websites software bwa picard samtools GATK IGV tablet vcftools website http://bio-bwa.sourceforge.net/

More information

Experiences in implementing large-scale biomedical workflows on the cloud: Challenges in transitioning to the clinical domain

Experiences in implementing large-scale biomedical workflows on the cloud: Challenges in transitioning to the clinical domain Experiences in implementing large-scale biomedical workflows on the cloud: Challenges in transitioning to the clinical domain Sehrish KANWAL a,1, Andrew LONIE a, Richard O. SINNOTT a Charlotte ANDERSON

More information

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio

More information

Next-Generation Sequencing. Technologies

Next-Generation Sequencing. Technologies Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062

More information

Fast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing:

Fast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing: Fast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing: Patented, Anti-Correlation Technology Provides 99.5% Accuracy & Sensitivity to 5% Variant Knowledge Base and External Annotation

More information

Welcome to the NGS webinar series

Welcome to the NGS webinar series Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

More information

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio

More information

Analytical verification methods for the Oncomine Lung cfdna Assay using the Ion S5 XL System

Analytical verification methods for the Oncomine Lung cfdna Assay using the Ion S5 XL System WHITE PAPER Oncomine Lung cfdna Assay and Ion S5 XL System Analytical verification methods for the Oncomine Lung cfdna Assay using the Ion S5 XL System Key highlights Investigate tumor heterogeneity and

More information

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio

More information

Introduction to Short Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016

Introduction to Short Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 Introduction to Short Read Alignment UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

More information

Human Genetic Variation. Ricardo Lebrón Dpto. Genética UGR

Human Genetic Variation. Ricardo Lebrón Dpto. Genética UGR Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.

More information

Expected Relationship Between the Silent Substitution Rate and the GC Content: Implications for the Evolution of Isochores

Expected Relationship Between the Silent Substitution Rate and the GC Content: Implications for the Evolution of Isochores J Mol Evol (2002) 54:129 133 DOI: 10.1007/s00239-001-0011-3 Springer-Verlag New York Inc. 2002 Letters to the Editor Expected Relationship Between the Silent Substitution Rate and the GC Content: Implications

More information

Course Presentation. Ignacio Medina Presentation

Course Presentation. Ignacio Medina Presentation Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital

More information

Transcriptomics analysis with RNA seq: an overview Frederik Coppens

Transcriptomics analysis with RNA seq: an overview Frederik Coppens Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)

More information

Mate-pair library data improves genome assembly

Mate-pair library data improves genome assembly De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate

More information

SEQUENCING. M Ataei, PhD. Feb 2016

SEQUENCING. M Ataei, PhD. Feb 2016 CLINICAL NEXT GENERATION SEQUENCING M Ataei, PhD Tehran Medical Genetics Laboratory Feb 2016 Overview 2 Background NGS in non-invasive prenatal diagnosis (NIPD) 3 Background Background 4 In the 1970s,

More information

The Human Genome and its upcoming Dynamics

The Human Genome and its upcoming Dynamics The Human Genome and its upcoming Dynamics Matthias Platzer Genome Analysis Leibniz Institute for Age Research - Fritz-Lipmann Institute (FLI) Sequencing of the Human Genome Publications 2004 2001 2001

More information

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014 Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide

More information

Reconstruction of Infectious Bronchitis Virus Quasispecies from NGS Data

Reconstruction of Infectious Bronchitis Virus Quasispecies from NGS Data Reconstruction of Infectious Bronchitis Virus Quasispecies from NGS Data Bassam Tork 1, Ekaterina Nenastyeva 1, Alexander Artyomenko 1, Nicholas Mancuso 1, Mazhar I.Khan 3, Rachel O Neill 4, Ion Mandoiu

More information

Practical Considerations for Implementation of Clinical Sequencing. Emily Winn-Deen, Ph.D. April 2017

Practical Considerations for Implementation of Clinical Sequencing. Emily Winn-Deen, Ph.D. April 2017 Practical Considerations for Implementation of Clinical Sequencing Emily Winn-Deen, Ph.D. April 2017 1. DEFINE THE CLINICAL PROBLEM TO BE ADDRESSED Focused panels Targeted Gene Panels Gene or disease-based

More information

Department of Research Evaluation. Theory and Approaches of Genomics Complexity TAGC

Department of Research Evaluation. Theory and Approaches of Genomics Complexity TAGC Department of Research Evaluation report on the research unit: Theory and Approaches of Genomics Complexity TAGC under the supervision of the following institutions and research bodies: Aix-Marseille Université

More information

Variant Discovery. Jie (Jessie) Li PhD Bioinformatics Analyst Bioinformatics Core, UCD

Variant Discovery. Jie (Jessie) Li PhD Bioinformatics Analyst Bioinformatics Core, UCD Variant Discovery Jie (Jessie) Li PhD Bioinformatics Analyst Bioinformatics Core, UCD Variant Type Alkan et al, Nature Reviews Genetics 2011 doi:10.1038/nrg2958 Variant Type http://www.broadinstitute.org/education/glossary/snp

More information

Genetic Testing in the Clinic. Anne Goodeve Sheffield Diagnostic Genetics Service Sheffield Children s NHS Foundation Trust

Genetic Testing in the Clinic. Anne Goodeve Sheffield Diagnostic Genetics Service Sheffield Children s NHS Foundation Trust Genetic Testing in the Clinic Anne Goodeve Sheffield Diagnostic Genetics Service Sheffield Children s NHS Foundation Trust Disclosures for Anne Goodeve In compliance with COI policy, ISTH requires the

More information

Titelstijl van model bewerken

Titelstijl van model bewerken Generate Titelstijl van and verify model your bewerken data Solutions for all your genetic analysis needs Sanger Sequencing Microarray technology QuantStudio real-time and digital PCR Ion Torrent NGS systems

More information

Whole Human Genome Sequencing Report This is a technical summary report for PG DNA

Whole Human Genome Sequencing Report This is a technical summary report for PG DNA Whole Human Genome Sequencing Report This is a technical summary report for PG0002601-DNA Physician and Patient Information Physician name: Vinodh Naraynan Address: Suite 406 222 West Thomas Road Phoenix

More information

Using Genomics to Guide Immunosuppression Therapy David A. Baran, MD, FACC, FSCAI System Director, Advanced HF, Transplant and MCS, Sentara Heart

Using Genomics to Guide Immunosuppression Therapy David A. Baran, MD, FACC, FSCAI System Director, Advanced HF, Transplant and MCS, Sentara Heart Using Genomics to Guide Immunosuppression Therapy David A. Baran, MD, FACC, FSCAI System Director, Advanced HF, Transplant and MCS, Sentara Heart Hospital, Norfolk, VA Disclosure Consulting: Livanova,

More information

Next Generation Sequencing of CFTR from dried blood spots using the Ion Torrent PGM

Next Generation Sequencing of CFTR from dried blood spots using the Ion Torrent PGM Next Generation Sequencing of CFTR from dried blood spots using the Ion Torrent PGM Miyono Hendrix Newborn Screening & Genetic Testing Symposium October 27, 2014 National Center for Environmental Health

More information

Complementary Technologies for Precision Genetic Analysis

Complementary Technologies for Precision Genetic Analysis Complementary NGS, CGH and Workflow Featured Publication Zhu, J. et al. Duplication of C7orf58, WNT16 and FAM3C in an obese female with a t(7;22)(q32.1;q11.2) chromosomal translocation and clinical features

More information

HaloPlex HS. Get to Know Your DNA. Every Single Fragment. Kevin Poon, Ph.D.

HaloPlex HS. Get to Know Your DNA. Every Single Fragment. Kevin Poon, Ph.D. HaloPlex HS Get to Know Your DNA. Every Single Fragment. Kevin Poon, Ph.D. Sr. Global Product Manager Diagnostics & Genomics Group Agilent Technologies For Research Use Only. Not for Use in Diagnostic

More information

Ecole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech

Ecole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech GALAXY INITIATION A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech How does Next- Gen sequencing work? DNA fragmentation Size selection and clonal amplification Massive parallel sequencing ACCGTTTGCCG

More information

Eucalyptus gene assembly

Eucalyptus gene assembly Eucalyptus gene assembly ACGT Plant Biotechnology meeting Charles Hefer Bioinformatics and Computational Biology Unit University of Pretoria October 2011 About Eucalyptus Most valuable and widely planted

More information

Variation detection based on second generation sequencing data. Xin LIU Department of Science and Technology, BGI

Variation detection based on second generation sequencing data. Xin LIU Department of Science and Technology, BGI Variation detection based on second generation sequencing data Xin LIU Department of Science and Technology, BGI liuxin@genomics.org.cn 2013.11.21 Outline Summary of sequencing techniques Data quality

More information

Variant Finding. UCD Genome Center Bioinformatics Core Wednesday 30 August 2016

Variant Finding. UCD Genome Center Bioinformatics Core Wednesday 30 August 2016 Variant Finding UCD Genome Center Bioinformatics Core Wednesday 30 August 2016 Types of Variants Adapted from Alkan et al, Nature Reviews Genetics 2011 Why Look For Variants? Genotyping Correlation with

More information

Chang Xu Mohammad R Nezami Ranjbar Zhong Wu John DiCarlo Yexun Wang

Chang Xu Mohammad R Nezami Ranjbar Zhong Wu John DiCarlo Yexun Wang Supplementary Materials for: Detecting very low allele fraction variants using targeted DNA sequencing and a novel molecular barcode-aware variant caller Chang Xu Mohammad R Nezami Ranjbar Zhong Wu John

More information

Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows

Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows Stephen Jackson, Ph.D 27 May 2017 The world leader in serving science Key Applications for Genome Editing Research

More information

Informatic Issues in Genomics

Informatic Issues in Genomics Informatic Issues in Genomics DEISE PRACE Symposium Barcelona, 10 12 May 2010 Ivo Glynne Gut, PhD Centro Nacional de Analisis Genomico Barcelona Our Objectives Improve the quality of life Understand the

More information

Applications of HMMs in Computational Biology. BMI/CS Colin Dewey

Applications of HMMs in Computational Biology. BMI/CS Colin Dewey Applications of HMMs in Computational Biology BMI/CS 576 www.biostat.wisc.edu/bmi576.html Colin Dewey cdewey@biostat.wisc.edu Fall 2008 The Gene Finding Task Given: an uncharacterized DNA sequence Do:

More information

Sanger vs Next-Gen Sequencing

Sanger vs Next-Gen Sequencing Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics

More information

A DE NOVO NONSENSE MUTATION IN MAGEL2 IN A PATIENT INITIALLY DIAGNOSED AS OPITZ-C: SIMILARITIES BETWEEN SCHAAF-YANG AND

A DE NOVO NONSENSE MUTATION IN MAGEL2 IN A PATIENT INITIALLY DIAGNOSED AS OPITZ-C: SIMILARITIES BETWEEN SCHAAF-YANG AND A DE NOVO NONSENSE MUTATION IN MAGEL2 IN A PATIENT INITIALLY DIAGNOSED AS OPITZ-C: SIMILARITIES BETWEEN SCHAAF-YANG AND OPITZ-C SYNDROMES Roser Urreizti, PhD, Anna Maria Cueto-Gonzalez, MD, Héctor Franco-Valls,

More information

Published online 15 May 2014 Nucleic Acids Research, 2014, Vol. 42, No. 12 e101 doi: /nar/gku392

Published online 15 May 2014 Nucleic Acids Research, 2014, Vol. 42, No. 12 e101 doi: /nar/gku392 Published online 15 May 2014 Nucleic Acids Research, 2014, Vol. 42, No. 12 e101 doi: 10.1093/nar/gku392 Performance comparison of SNP detection tools with illumina exome sequencing data an assessment using

More information

BICF Variant Analysis Tools. Using the BioHPC Workflow Launching Tool Astrocyte

BICF Variant Analysis Tools. Using the BioHPC Workflow Launching Tool Astrocyte BICF Variant Analysis Tools Using the BioHPC Workflow Launching Tool Astrocyte Prioritization of Variants SNP INDEL SV Astrocyte BioHPC Workflow Platform Allows groups to give easy-access to their analysis

More information

Applied Bioinformatics

Applied Bioinformatics Applied Bioinformatics In silico and In clinico characterization of genetic variations Assistant Professor Department of Biomedical Informatics Center for Human Genetics Research ATCAAAATTATGGAAGAA ATCAAAATCATGGAAGAA

More information

Assignment 9: Genetic Variation

Assignment 9: Genetic Variation Assignment 9: Genetic Variation Due Date: Friday, March 30 th, 2018, 10 am In this assignment, you will profile genome variation information and attempt to answer biologically relevant questions. The variant

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature13127 Factors to consider in assessing candidate pathogenic mutations in presumed monogenic conditions The questions itemized below expand upon the definitions in Table 1 and are provided

More information

A Crash Course in NGS for GI Pathologists. Sandra O Toole

A Crash Course in NGS for GI Pathologists. Sandra O Toole A Crash Course in NGS for GI Pathologists Sandra O Toole The Sanger Technique First generation sequencing Uses dideoxynucleotides (dideoxyadenine, dideoxyguanine, etc) These are molecules that resemble

More information

Variant calling in NGS experiments

Variant calling in NGS experiments Variant calling in NGS experiments Jorge Jiménez jjimeneza@cipf.es BIER CIBERER Genomics Department Centro de Investigacion Principe Felipe (CIPF) (Valencia, Spain) 1 Index 1. NGS workflow 2. Variant calling

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia June 28, 2017 Our mandate is to advance knowledge about cancer and other diseases

More information

HGMD : Human Gene Mutation Database

HGMD : Human Gene Mutation Database HGMD : Human Gene Mutation Database The gold standard resource for comprehensive human hereditary disease mutation data, licensed exclusively through QIAGEN Sample to Insight Introduction The human gene

More information

Sample to Insight. Dr. Bhagyashree S. Birla NGS Field Application Scientist

Sample to Insight. Dr. Bhagyashree S. Birla NGS Field Application Scientist Dr. Bhagyashree S. Birla NGS Field Application Scientist bhagyashree.birla@qiagen.com NGS spans a broad range of applications DNA Applications Human ID Liquid biopsy Biomarker discovery Inherited and somatic

More information

HLA and Next Generation Sequencing it s all about the Data

HLA and Next Generation Sequencing it s all about the Data HLA and Next Generation Sequencing it s all about the Data John Ord, NHSBT Colindale and University of Cambridge BSHI Annual Conference Manchester September 2014 Introduction In 2003 the first full public

More information

Trimethylaminuria (TMAU) Yiran Guo, Ph.D. Center for Applied Genomics Children's Hospital of Philadelphia

Trimethylaminuria (TMAU) Yiran Guo, Ph.D. Center for Applied Genomics Children's Hospital of Philadelphia Trimethylaminuria (TMAU) Yiran Guo, Ph.D. Center for Applied Genomics Children's Hospital of Philadelphia TMAU Genetics Background in Human Genetics Human genome variants and methods to detect them Rare

More information

Read Mapping and Variant Calling. Johannes Starlinger

Read Mapping and Variant Calling. Johannes Starlinger Read Mapping and Variant Calling Johannes Starlinger Application Scenario: Personalized Cancer Therapy Different mutations require different therapy Collins, Meredith A., and Marina Pasca di Magliano.

More information

Introducing QIAseq. Accelerate your NGS performance through Sample to Insight solutions. Sample to Insight

Introducing QIAseq. Accelerate your NGS performance through Sample to Insight solutions. Sample to Insight Introducing QIAseq Accelerate your NGS performance through Sample to Insight solutions Sample to Insight From Sample to Insight let QIAGEN enhance your NGS-based research High-throughput next-generation

More information

Alignment & Variant Discovery. J Fass UCD Genome Center Bioinformatics Core Tuesday June 17, 2014

Alignment & Variant Discovery. J Fass UCD Genome Center Bioinformatics Core Tuesday June 17, 2014 Alignment & Variant Discovery J Fass UCD Genome Center Bioinformatics Core Tuesday June 17, 2014 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

More information

SNP calling. Jose Blanca COMAV institute bioinf.comav.upv.es

SNP calling. Jose Blanca COMAV institute bioinf.comav.upv.es SNP calling Jose Blanca COMAV institute bioinf.comav.upv.es SNP calling Genotype matrix Genotype matrix: Samples x SNPs SNPs and errors A change in a read may due to: Sample contamination Cloning or PCR

More information

RNA-SEQUENCING ANALYSIS

RNA-SEQUENCING ANALYSIS RNA-SEQUENCING ANALYSIS Joseph Powell SISG- 2018 CONTENTS Introduction to RNA sequencing Data structure Analyses Transcript counting Alternative splicing Allele specific expression Discovery APPLICATIONS

More information

Bioinformatics Advice on Experimental Design

Bioinformatics Advice on Experimental Design Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics

More information

AN ALGORITHM FOR STRUCTURAL VARIANT DETECTION WITH THIRD GENERATION SEQUENCING HUI-JOU CHOU. A thesis submitted to the. Graduate School Camden

AN ALGORITHM FOR STRUCTURAL VARIANT DETECTION WITH THIRD GENERATION SEQUENCING HUI-JOU CHOU. A thesis submitted to the. Graduate School Camden AN ALGORITHM FOR STRUCTURAL VARIANT DETECTION WITH THIRD GENERATION SEQUENCING BY HUI-JOU CHOU A thesis submitted to the Graduate School Camden Rutgers, The State University of New Jersey in partial fulfillment

More information

Developing Tools for Rapid and Accurate Post-Sequencing Analysis of Foodborne Pathogens. Mitchell Holland, Noblis

Developing Tools for Rapid and Accurate Post-Sequencing Analysis of Foodborne Pathogens. Mitchell Holland, Noblis Developing Tools for Rapid and Accurate Post-Sequencing Analysis of Foodborne Pathogens Mitchell Holland, Noblis Agenda Introduction Whole Genome Sequencing Analysis Pipeline Sequence Alignment SNPs and

More information

The Beery Twins Story and Sepiapterin Reductase

The Beery Twins Story and Sepiapterin Reductase The Beery Twins Story and Sepiapterin Reductase Sepiapterin reductase (SPR) is an enzyme that makes tetrahydrobiopterin an important cofactor used by other enzymes to make the neurotransmitters dopamine

More information

Genomes contain all of the information needed for an organism to grow and survive.

Genomes contain all of the information needed for an organism to grow and survive. Section 3: Genomes contain all of the information needed for an organism to grow and survive. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the components of the

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature26136 We reexamined the available whole data from different cave and surface populations (McGaugh et al, unpublished) to investigate whether insra exhibited any indication that it has

More information

Pharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001

Pharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 Pharmacogenetics: A SNPshot of the Future Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 1 I. What is pharmacogenetics? It is the study of how genetic variation affects drug response

More information

Variant Detection in Next Generation Sequencing Data. John Osborne Sept 14, 2012

Variant Detection in Next Generation Sequencing Data. John Osborne Sept 14, 2012 + Variant Detection in Next Generation Sequencing Data John Osborne Sept 14, 2012 + Overview My Bias Talk slanted towards analyzing whole genomes using Illumina paired end reads with open source tools

More information

Functional DNA Quality Analysis Improves the Accuracy of Next Generation Sequencing from Clinical Specimens

Functional DNA Quality Analysis Improves the Accuracy of Next Generation Sequencing from Clinical Specimens Functional DNA Quality Analysis Improves the Accuracy of Next Generation Sequencing from Clinical Specimens Overview We have developed a novel QC, the SuraSeq DNA Quantitative Functional Index (QFI ).

More information

QIAseq Targeted Panel Analysis Plugin USER MANUAL

QIAseq Targeted Panel Analysis Plugin USER MANUAL QIAseq Targeted Panel Analysis Plugin USER MANUAL User manual for QIAseq Targeted Panel Analysis 1.1 Windows, macos and Linux June 18, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej

More information

CAPTURE-BASED APPROACH FOR COMPREHENSIVE DETECTION OF IMPORTANT ALTERATIONS

CAPTURE-BASED APPROACH FOR COMPREHENSIVE DETECTION OF IMPORTANT ALTERATIONS CAPTURE-BASE APPROACH FOR COMPREHENSIVE ETECTION OF IMPORTANT ALTERATIONS SEQUENCE MUTATIONS MICROSATELLITE INSTABILITY AMPLIFICATIONS GENOMIC REARRANGEMENTS For Research Use Only. Not for iagnostic Purposes.

More information

Next Generation Sequencing. Dylan Young Biomedical Engineering

Next Generation Sequencing. Dylan Young Biomedical Engineering Next Generation Sequencing Dylan Young Biomedical Engineering What is DNA? Molecule composed of Adenine (A) Guanine (G) Cytosine (C) Thymine (T) Paired as either AT or CG Provides genetic instructions

More information

Linking Genetic Variation to Important Phenotypes

Linking Genetic Variation to Important Phenotypes Linking Genetic Variation to Important Phenotypes BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2018 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under

More information

Compute- and Data-Intensive Analyses in Bioinformatics"

Compute- and Data-Intensive Analyses in Bioinformatics Compute- and Data-Intensive Analyses in Bioinformatics" Wayne Pfeiffer SDSC/UCSD August 8, 2012 Questions for today" How big is the flood of data from high-throughput DNA sequencers? What bioinformatics

More information

DNA Sequencing by Ion Torrent. Marc Lavergne CHEM 4590

DNA Sequencing by Ion Torrent. Marc Lavergne CHEM 4590 DNA Sequencing by Ion Torrent Marc Lavergne CHEM 4590 OVERVIEW History DNA Synthesis and First-Gen Sequencing Technology Sequencing Signal Detection Advantages/Disadvantages Applications Current Research

More information

Alignment. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014

Alignment. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 Alignment J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

More information

Outline General NGS background and terms 11/14/2016 CONFLICT OF INTEREST. HLA region targeted enrichment. NGS library preparation methodologies

Outline General NGS background and terms 11/14/2016 CONFLICT OF INTEREST. HLA region targeted enrichment. NGS library preparation methodologies Eric T. Weimer, PhD, D(ABMLI) Assistant Professor, Pathology & Laboratory Medicine, UNC School of Medicine Director, Molecular Immunology Associate Director, Clinical Flow Cytometry, HLA, and Immunology

More information

Matthew Tinning Australian Genome Research Facility. July 2012

Matthew Tinning Australian Genome Research Facility. July 2012 Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909

More information