Statistical method for Next Generation Sequencing pipeline comparison
|
|
- Abel Griffin
- 6 years ago
- Views:
Transcription
1 Statistical method for Next Generation Sequencing pipeline comparison Pascal Roy, MD PhD EPICLIN 2016 Strasbourg mai 2016 MH Elsensohn 1-4*, N Leblay 1-4, S Dimassi 5,6, A Campan-Fournier 5,6, A Labalme 5, D Sanlaville 5,6, G Lesca 5,6, C Bardel 1-4, P Roy Service de Biostatistique, Hospices Civils de Lyon, Lyon, France. 2 Université de Lyon, Lyon, France. 3 Université Lyon 1, Villeurbanne, France. 4 CNRS UMR 5558, Laboratoire de Biométrie et Biologie Evolutive, Equipe Biostatistique-Santé, Villeurbanne, France. 5 Service de Génétique, Hospices Civils de Lyon, Lyon, France 6 Centre de recherche en Neurosciences de Lyon (CNRS UMR 5292, INSERM U1028, Université Claude Bernard Lyon 1, Université Jean Monnet Saint-Etienne, and Hospices Civils de Lyon) Lyon, France. 1
2 DNA sequencing Sanger method (1977) considered as a Gold Standard New sequencers were designed since 2000 Next Generation Sequencing technologies became available since
3 Pipeline Association of software programs for the various steps of NGS data analyses Academic and commercial softwares are available How To compare two NGS pipelines once with another? Each with the Gold Standard Sanger? 3
4 DNA Sequencing NGS sequencing Sanger technique Genetics Department - Hospices Civils de Lyon Whole blood Informed consent 43 epileptic patients 41 genes (epilepsy / mental retardation) Ion Torrent PGM BWA-GATK and TMAP-NextGENe pipelines 30 epileptic patients 1 to 3 genes according to clinical signs 4
5 Statistical Unit = Chromosomal position on the reference sequence Hg19 Each patient = A single study All patients = A meta-analysis 5
6 2-by-2 pairwise table for agreement p = 1,, P patient z = A, B Pipeline k = 1,, K X pzk nπ pab 1 0 K k 1 otherwise Chromosomal position disagreeme ntwithhg19 I X a I X b,a 0,1,b 0,1 pak pbk 6
7 Agreement on position Agreement on position and nature 7
8 With Gold Standard Sanger variants Sensitivity comparison Sanger non-variants Specificity comparison 8
9 9
10 1 2 P-1 P 10
11 1 2 Saturated model for variant identity A B log(npab )= μp +aλp +bλp +ab(θ p +Iθ ps Alternative approach Fitting mixed-effects log-linear models Random effects for biological variability ) P-1 P 11
12 # of Variants identified by the pipelines and by the gold standard All Types of variants* Variants and pipelines N Mean±SD Min. Max. Regions sequenced by MPS only BWA-GATK ± TMAP-NextGENe ± Region sequenced by MPS +Sanger Sanger ± BWA-GATK ± TMAP-NextGENe ± * Single Nucleotide Variants (SNVs), insertions, and deletions base-pairs per patient 1 to 3 genes and to base-pairs per patient 12
13 # of Variants identified by the pipelines and by the gold standard Only SNVs Variants and pipelines N Mean±SD Min. Max. Regions sequenced by MPS only BWA-GATK ± TMAP-NextGENe ± Region sequenced by MPS +Sanger Sanger ± BWA-GATK ± TMAP-NextGENe ± base-pairs per patient to base-pairs per patient 13
14 Pipeline comparisons - All types of variants Estimation of parameters Variants, pipelines, parameters Value 95% CI 95% BVI Without Gold Standard * # of variants for BWA-GATK ; ; # of variants for TMAP-NextGENe ; ; OR for agreement ; ; Conditional probability of identity ** ; ; 0.28 With Gold Standard Sensitivity of BWA-GATK (%) ; ; Sensitivity of TMAP-NextGENe (%) ; ; FP rate for BWA-GATK ; NA FP rate for TMAP-NextGENe ; NA * Heterogeneous margins and odds-ratios. **Heterogeneous variant identity parameter Heterogeneous margins and odds-ratios for specificity extended to sensitivity analysis for Sanger NV 14
15 Pipeline comparisons - Only SNVs Estimation of parameters Variants, pipelines, parameters Value 95% CI 95% BVI Without Gold Standard * Number of SNVs for BWA-GATK ; ; Number of SNVs for TMAP-NextGENe ; ; OR for agreement ; ; Conditional probability of identity ** ; NA With Gold Standard Sensitivity of BWA-GATK (%) ; NA Sensitivity of TMAP-NextGENe (%) ; NA FP rate for BWA-GATK ; 2.24 NA FP rate for TMAP-NextGENe ; 2.24 NA * Heterogeneous margins and odds-ratios. **Homogeneous variant identity parameter Homogeneous margins and odds-ratios for specificity extended to sensitivity analysis 15 for Sanger NV
16 Discussion Several usual statistical methods may be adapted to NGS analyses More sophisticated experimental designs are needed to analyze the various components of experimental variability, in contrast with biological variability More sophisticated decision rules are needed to select appropriate pipelines, including the respective costs of FP and FN When all variants were analyzed, the performances of the 2 pipelines were low in terms of false sensitivity et specificity In substitution analyses, a better performance was observed, leading to a very high value of the odds-ratio for agreement Extensions of these models are needed to evaluated the performances of NGS 16
17 References Li H. Exploring single-sample SNP and INDEL calling with wholegenome de novo assembly. Bioinformatics 2012;28: Agresti A. Categorical Data Analysis, 3 rd edition. Wiley, Becker MP., Agresti A. Log-linear modelling of pairwise interobserver agreement on a categorical scale. Stat Med 1992;11:
Statistical method to compare massive parallel sequencing pipelines
Statistical method to compare massive parallel sequencing pipelines Delphine Maucort-Boulch MD PhD Mad-Hélénie Elsensohn Msc, Florence Roucher-Boulez PharmD PhD, Claire Bardel PhD, Pascal Roy MD PhD Service
More informationVariant detection analysis in the BRCA1/2 genes from Ion torrent PGM data
Variant detection analysis in the BRCA1/2 genes from Ion torrent PGM data Bruno Zeitouni Bionformatics department of the Institut Curie Inserm U900 Mines ParisTech Ion Torrent User Meeting 2012, October
More informationThe Basics of Understanding Whole Genome Next Generation Sequence Data
The Basics of Understanding Whole Genome Next Generation Sequence Data Heather Carleton-Romer, MPH, Ph.D. ASM-CDC Infectious Disease and Public Health Microbiology Postdoctoral Fellow PulseNet USA Next
More informationIntroduction to metagenome assembly. Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014
Introduction to metagenome assembly Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014 Sequencing specs* Method Read length Accuracy Million reads Time Cost per M 454
More informationPerformance of the Newly Developed Non-Invasive Prenatal Multi- Gene Sequencing Screen
1 // Performance of the Newly Developed Non-Invasive Prenatal Multi- Gene Sequencing Screen ABSTRACT Here we describe the analytical performance of the newly developed non-invasive prenatal multi-gene
More informationTargeted Sequencing in the NBS Laboratory
Targeted Sequencing in the NBS Laboratory Christopher Greene, PhD Newborn Screening and Molecular Biology Branch Division of Laboratory Sciences Gene Sequencing in Public Health Newborn Screening February
More informationData Basics. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis
Data Basics Josef K Vogt Slides by: Simon Rasmussen 2017 Generalized NGS analysis Sample prep & Sequencing Data size Main data reductive steps SNPs, genes, regions Application Assembly: Compare Raw Pre-
More informationAssay Validation Services
Overview PierianDx s assay validation services bring clinical genomic tests to market more rapidly through experimental design, sample requirements, analytical pipeline optimization, and criteria tuning.
More informationAlignment methods. Martijn Vermaat Department of Human Genetics Center for Human and Clinical Genetics
Alignment methods Martijn Vermaat Department of Human Genetics Center for Human and Clinical Genetics Alignment methods Sequence alignment Assembly vs alignment Alignment methods Common issues Platform
More informationDNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.
DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private
More informationTHE ERA OF INDIVIDUAL GENOMES. Sandra Viz Lasheras Advanced Genetics ( )
THE ERA OF INDIVIDUAL GENOMES Sandra Viz Lasheras Advanced Genetics (2017-2018) CONTENTS 1. INTRODUCTION - The genomic era - Sequencing techniques 2. PROJECTS - 1000 genomes project - Individual genome
More informationAnalytics Behind Genomic Testing
A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical
More informationAn innovative approach to genetic testing for improved patient care
An innovative approach to genetic testing for improved patient care Blueprint Genetics Blueprint Genetics is changing diagnostics by providing fast, affordable and comprehensive genetic knowledge Who we
More informationVariant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4
WHITE PAPER Oncomine Comprehensive Assay Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4 Contents Scope and purpose of document...2 Content...2 How Torrent
More informationVariant Callers. J Fass 24 August 2017
Variant Callers J Fass 24 August 2017 Variant Types Caller Consistency Pabinger (2014) Briefings Bioinformatics 15:256 Freebayes Bayesian haplotype caller that can call SNPs, short CNVs / duplications,
More informationSetting Standards and Raising Quality for Clinical Bioinformatics. Joo Wook Ahn, Guy s & St Thomas 04/07/ ACGS summer scientific meeting
Setting Standards and Raising Quality for Clinical Bioinformatics Joo Wook Ahn, Guy s & St Thomas 04/07/2016 - ACGS summer scientific meeting 1. Best Practice Guidelines Draft guidelines circulated to
More information14 March, 2016: Introduction to Genomics
14 March, 2016: Introduction to Genomics Genome Genome within Ensembl browser http://www.ensembl.org/homo_sapiens/location/view?db=core;g=ensg00000139618;r=13:3231547432400266 Genome within Ensembl browser
More informationAgilent NGS Solutions : Addressing Today s Challenges
Agilent NGS Solutions : Addressing Today s Challenges Charmian Cher, Ph.D Director, Global Marketing Programs 1 10 years of Next-Gen Sequencing 2003 Completion of the Human Genome Project 2004 Pyrosequencing
More informationProcessing Ion AmpliSeq Data using NextGENe Software v2.3.0
Processing Ion AmpliSeq Data using NextGENe Software v2.3.0 July 2012 John McGuigan, Megan Manion, Kevin LeVan, CS Jonathan Liu Introduction The Ion AmpliSeq Panels use highly multiplexed PCR in order
More informationSNP calling and VCF format
SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide
More informationwith drmid Dx for Illumina NGS systems
Performance Characteristics BRCA MASTR Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Revision date: July 27, 2017 Page 1 of 8 Table of Contents
More informationBiology Evolution: Mutation I Science and Mathematics Education Research Group
a place of mind F A C U L T Y O F E D U C A T I O N Department of Curriculum and Pedagogy Biology Evolution: Mutation I Science and Mathematics Education Research Group Supported by UBC Teaching and Learning
More informationPersonal Genomics Platform White Paper Last Updated November 15, Executive Summary
Executive Summary Helix is a personal genomics platform company with a simple but powerful mission: to empower every person to improve their life through DNA. Our platform includes saliva sample collection,
More informationUnderstanding the science and technology of whole genome sequencing
Understanding the science and technology of whole genome sequencing Dag Undlien Department of Medical Genetics Oslo University Hospital University of Oslo and The Norwegian Sequencing Centre d.e.undlien@medisin.uio.no
More informationDNA polymorphisms and RNA-Seq alternative splicing blow bubbles in de Bruijn Graphs
DNA polymorphisms and RNA-Seq alternative splicing blow bubbles in de Bruijn Graphs Nadia Pisanti University of Pisa & Leiden University Outline New Generation Sequencing (NGS), and the importance of detecting
More informationLees J.A., Vehkala M. et al., 2016 In Review
Sequence element enrichment analysis to determine the genetic basis of bacterial phenotypes Lees J.A., Vehkala M. et al., 2016 In Review Journal Club Triinu Kõressaar 16.03.2016 Introduction Bacterial
More informationC3BI. VARIANTS CALLING November Pierre Lechat Stéphane Descorps-Declère
C3BI VARIANTS CALLING November 2016 Pierre Lechat Stéphane Descorps-Declère General Workflow (GATK) software websites software bwa picard samtools GATK IGV tablet vcftools website http://bio-bwa.sourceforge.net/
More informationExperiences in implementing large-scale biomedical workflows on the cloud: Challenges in transitioning to the clinical domain
Experiences in implementing large-scale biomedical workflows on the cloud: Challenges in transitioning to the clinical domain Sehrish KANWAL a,1, Andrew LONIE a, Richard O. SINNOTT a Charlotte ANDERSON
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationNext-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
More informationFast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing:
Fast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing: Patented, Anti-Correlation Technology Provides 99.5% Accuracy & Sensitivity to 5% Variant Knowledge Base and External Annotation
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationAnalytical verification methods for the Oncomine Lung cfdna Assay using the Ion S5 XL System
WHITE PAPER Oncomine Lung cfdna Assay and Ion S5 XL System Analytical verification methods for the Oncomine Lung cfdna Assay using the Ion S5 XL System Key highlights Investigate tumor heterogeneity and
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationIntroduction to Short Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016
Introduction to Short Read Alignment UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationHuman Genetic Variation. Ricardo Lebrón Dpto. Genética UGR
Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.
More informationExpected Relationship Between the Silent Substitution Rate and the GC Content: Implications for the Evolution of Isochores
J Mol Evol (2002) 54:129 133 DOI: 10.1007/s00239-001-0011-3 Springer-Verlag New York Inc. 2002 Letters to the Editor Expected Relationship Between the Silent Substitution Rate and the GC Content: Implications
More informationCourse Presentation. Ignacio Medina Presentation
Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital
More informationTranscriptomics analysis with RNA seq: an overview Frederik Coppens
Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)
More informationMate-pair library data improves genome assembly
De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate
More informationSEQUENCING. M Ataei, PhD. Feb 2016
CLINICAL NEXT GENERATION SEQUENCING M Ataei, PhD Tehran Medical Genetics Laboratory Feb 2016 Overview 2 Background NGS in non-invasive prenatal diagnosis (NIPD) 3 Background Background 4 In the 1970s,
More informationThe Human Genome and its upcoming Dynamics
The Human Genome and its upcoming Dynamics Matthias Platzer Genome Analysis Leibniz Institute for Age Research - Fritz-Lipmann Institute (FLI) Sequencing of the Human Genome Publications 2004 2001 2001
More informationSingle Nucleotide Variant Analysis. H3ABioNet May 14, 2014
Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide
More informationReconstruction of Infectious Bronchitis Virus Quasispecies from NGS Data
Reconstruction of Infectious Bronchitis Virus Quasispecies from NGS Data Bassam Tork 1, Ekaterina Nenastyeva 1, Alexander Artyomenko 1, Nicholas Mancuso 1, Mazhar I.Khan 3, Rachel O Neill 4, Ion Mandoiu
More informationPractical Considerations for Implementation of Clinical Sequencing. Emily Winn-Deen, Ph.D. April 2017
Practical Considerations for Implementation of Clinical Sequencing Emily Winn-Deen, Ph.D. April 2017 1. DEFINE THE CLINICAL PROBLEM TO BE ADDRESSED Focused panels Targeted Gene Panels Gene or disease-based
More informationDepartment of Research Evaluation. Theory and Approaches of Genomics Complexity TAGC
Department of Research Evaluation report on the research unit: Theory and Approaches of Genomics Complexity TAGC under the supervision of the following institutions and research bodies: Aix-Marseille Université
More informationVariant Discovery. Jie (Jessie) Li PhD Bioinformatics Analyst Bioinformatics Core, UCD
Variant Discovery Jie (Jessie) Li PhD Bioinformatics Analyst Bioinformatics Core, UCD Variant Type Alkan et al, Nature Reviews Genetics 2011 doi:10.1038/nrg2958 Variant Type http://www.broadinstitute.org/education/glossary/snp
More informationGenetic Testing in the Clinic. Anne Goodeve Sheffield Diagnostic Genetics Service Sheffield Children s NHS Foundation Trust
Genetic Testing in the Clinic Anne Goodeve Sheffield Diagnostic Genetics Service Sheffield Children s NHS Foundation Trust Disclosures for Anne Goodeve In compliance with COI policy, ISTH requires the
More informationTitelstijl van model bewerken
Generate Titelstijl van and verify model your bewerken data Solutions for all your genetic analysis needs Sanger Sequencing Microarray technology QuantStudio real-time and digital PCR Ion Torrent NGS systems
More informationWhole Human Genome Sequencing Report This is a technical summary report for PG DNA
Whole Human Genome Sequencing Report This is a technical summary report for PG0002601-DNA Physician and Patient Information Physician name: Vinodh Naraynan Address: Suite 406 222 West Thomas Road Phoenix
More informationUsing Genomics to Guide Immunosuppression Therapy David A. Baran, MD, FACC, FSCAI System Director, Advanced HF, Transplant and MCS, Sentara Heart
Using Genomics to Guide Immunosuppression Therapy David A. Baran, MD, FACC, FSCAI System Director, Advanced HF, Transplant and MCS, Sentara Heart Hospital, Norfolk, VA Disclosure Consulting: Livanova,
More informationNext Generation Sequencing of CFTR from dried blood spots using the Ion Torrent PGM
Next Generation Sequencing of CFTR from dried blood spots using the Ion Torrent PGM Miyono Hendrix Newborn Screening & Genetic Testing Symposium October 27, 2014 National Center for Environmental Health
More informationComplementary Technologies for Precision Genetic Analysis
Complementary NGS, CGH and Workflow Featured Publication Zhu, J. et al. Duplication of C7orf58, WNT16 and FAM3C in an obese female with a t(7;22)(q32.1;q11.2) chromosomal translocation and clinical features
More informationHaloPlex HS. Get to Know Your DNA. Every Single Fragment. Kevin Poon, Ph.D.
HaloPlex HS Get to Know Your DNA. Every Single Fragment. Kevin Poon, Ph.D. Sr. Global Product Manager Diagnostics & Genomics Group Agilent Technologies For Research Use Only. Not for Use in Diagnostic
More informationEcole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech
GALAXY INITIATION A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech How does Next- Gen sequencing work? DNA fragmentation Size selection and clonal amplification Massive parallel sequencing ACCGTTTGCCG
More informationEucalyptus gene assembly
Eucalyptus gene assembly ACGT Plant Biotechnology meeting Charles Hefer Bioinformatics and Computational Biology Unit University of Pretoria October 2011 About Eucalyptus Most valuable and widely planted
More informationVariation detection based on second generation sequencing data. Xin LIU Department of Science and Technology, BGI
Variation detection based on second generation sequencing data Xin LIU Department of Science and Technology, BGI liuxin@genomics.org.cn 2013.11.21 Outline Summary of sequencing techniques Data quality
More informationVariant Finding. UCD Genome Center Bioinformatics Core Wednesday 30 August 2016
Variant Finding UCD Genome Center Bioinformatics Core Wednesday 30 August 2016 Types of Variants Adapted from Alkan et al, Nature Reviews Genetics 2011 Why Look For Variants? Genotyping Correlation with
More informationChang Xu Mohammad R Nezami Ranjbar Zhong Wu John DiCarlo Yexun Wang
Supplementary Materials for: Detecting very low allele fraction variants using targeted DNA sequencing and a novel molecular barcode-aware variant caller Chang Xu Mohammad R Nezami Ranjbar Zhong Wu John
More informationIncorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows
Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows Stephen Jackson, Ph.D 27 May 2017 The world leader in serving science Key Applications for Genome Editing Research
More informationInformatic Issues in Genomics
Informatic Issues in Genomics DEISE PRACE Symposium Barcelona, 10 12 May 2010 Ivo Glynne Gut, PhD Centro Nacional de Analisis Genomico Barcelona Our Objectives Improve the quality of life Understand the
More informationApplications of HMMs in Computational Biology. BMI/CS Colin Dewey
Applications of HMMs in Computational Biology BMI/CS 576 www.biostat.wisc.edu/bmi576.html Colin Dewey cdewey@biostat.wisc.edu Fall 2008 The Gene Finding Task Given: an uncharacterized DNA sequence Do:
More informationSanger vs Next-Gen Sequencing
Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics
More informationA DE NOVO NONSENSE MUTATION IN MAGEL2 IN A PATIENT INITIALLY DIAGNOSED AS OPITZ-C: SIMILARITIES BETWEEN SCHAAF-YANG AND
A DE NOVO NONSENSE MUTATION IN MAGEL2 IN A PATIENT INITIALLY DIAGNOSED AS OPITZ-C: SIMILARITIES BETWEEN SCHAAF-YANG AND OPITZ-C SYNDROMES Roser Urreizti, PhD, Anna Maria Cueto-Gonzalez, MD, Héctor Franco-Valls,
More informationPublished online 15 May 2014 Nucleic Acids Research, 2014, Vol. 42, No. 12 e101 doi: /nar/gku392
Published online 15 May 2014 Nucleic Acids Research, 2014, Vol. 42, No. 12 e101 doi: 10.1093/nar/gku392 Performance comparison of SNP detection tools with illumina exome sequencing data an assessment using
More informationBICF Variant Analysis Tools. Using the BioHPC Workflow Launching Tool Astrocyte
BICF Variant Analysis Tools Using the BioHPC Workflow Launching Tool Astrocyte Prioritization of Variants SNP INDEL SV Astrocyte BioHPC Workflow Platform Allows groups to give easy-access to their analysis
More informationApplied Bioinformatics
Applied Bioinformatics In silico and In clinico characterization of genetic variations Assistant Professor Department of Biomedical Informatics Center for Human Genetics Research ATCAAAATTATGGAAGAA ATCAAAATCATGGAAGAA
More informationAssignment 9: Genetic Variation
Assignment 9: Genetic Variation Due Date: Friday, March 30 th, 2018, 10 am In this assignment, you will profile genome variation information and attempt to answer biologically relevant questions. The variant
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature13127 Factors to consider in assessing candidate pathogenic mutations in presumed monogenic conditions The questions itemized below expand upon the definitions in Table 1 and are provided
More informationA Crash Course in NGS for GI Pathologists. Sandra O Toole
A Crash Course in NGS for GI Pathologists Sandra O Toole The Sanger Technique First generation sequencing Uses dideoxynucleotides (dideoxyadenine, dideoxyguanine, etc) These are molecules that resemble
More informationVariant calling in NGS experiments
Variant calling in NGS experiments Jorge Jiménez jjimeneza@cipf.es BIER CIBERER Genomics Department Centro de Investigacion Principe Felipe (CIPF) (Valencia, Spain) 1 Index 1. NGS workflow 2. Variant calling
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia June 28, 2017 Our mandate is to advance knowledge about cancer and other diseases
More informationHGMD : Human Gene Mutation Database
HGMD : Human Gene Mutation Database The gold standard resource for comprehensive human hereditary disease mutation data, licensed exclusively through QIAGEN Sample to Insight Introduction The human gene
More informationSample to Insight. Dr. Bhagyashree S. Birla NGS Field Application Scientist
Dr. Bhagyashree S. Birla NGS Field Application Scientist bhagyashree.birla@qiagen.com NGS spans a broad range of applications DNA Applications Human ID Liquid biopsy Biomarker discovery Inherited and somatic
More informationHLA and Next Generation Sequencing it s all about the Data
HLA and Next Generation Sequencing it s all about the Data John Ord, NHSBT Colindale and University of Cambridge BSHI Annual Conference Manchester September 2014 Introduction In 2003 the first full public
More informationTrimethylaminuria (TMAU) Yiran Guo, Ph.D. Center for Applied Genomics Children's Hospital of Philadelphia
Trimethylaminuria (TMAU) Yiran Guo, Ph.D. Center for Applied Genomics Children's Hospital of Philadelphia TMAU Genetics Background in Human Genetics Human genome variants and methods to detect them Rare
More informationRead Mapping and Variant Calling. Johannes Starlinger
Read Mapping and Variant Calling Johannes Starlinger Application Scenario: Personalized Cancer Therapy Different mutations require different therapy Collins, Meredith A., and Marina Pasca di Magliano.
More informationIntroducing QIAseq. Accelerate your NGS performance through Sample to Insight solutions. Sample to Insight
Introducing QIAseq Accelerate your NGS performance through Sample to Insight solutions Sample to Insight From Sample to Insight let QIAGEN enhance your NGS-based research High-throughput next-generation
More informationAlignment & Variant Discovery. J Fass UCD Genome Center Bioinformatics Core Tuesday June 17, 2014
Alignment & Variant Discovery J Fass UCD Genome Center Bioinformatics Core Tuesday June 17, 2014 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationSNP calling. Jose Blanca COMAV institute bioinf.comav.upv.es
SNP calling Jose Blanca COMAV institute bioinf.comav.upv.es SNP calling Genotype matrix Genotype matrix: Samples x SNPs SNPs and errors A change in a read may due to: Sample contamination Cloning or PCR
More informationRNA-SEQUENCING ANALYSIS
RNA-SEQUENCING ANALYSIS Joseph Powell SISG- 2018 CONTENTS Introduction to RNA sequencing Data structure Analyses Transcript counting Alternative splicing Allele specific expression Discovery APPLICATIONS
More informationBioinformatics Advice on Experimental Design
Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics
More informationAN ALGORITHM FOR STRUCTURAL VARIANT DETECTION WITH THIRD GENERATION SEQUENCING HUI-JOU CHOU. A thesis submitted to the. Graduate School Camden
AN ALGORITHM FOR STRUCTURAL VARIANT DETECTION WITH THIRD GENERATION SEQUENCING BY HUI-JOU CHOU A thesis submitted to the Graduate School Camden Rutgers, The State University of New Jersey in partial fulfillment
More informationDeveloping Tools for Rapid and Accurate Post-Sequencing Analysis of Foodborne Pathogens. Mitchell Holland, Noblis
Developing Tools for Rapid and Accurate Post-Sequencing Analysis of Foodborne Pathogens Mitchell Holland, Noblis Agenda Introduction Whole Genome Sequencing Analysis Pipeline Sequence Alignment SNPs and
More informationThe Beery Twins Story and Sepiapterin Reductase
The Beery Twins Story and Sepiapterin Reductase Sepiapterin reductase (SPR) is an enzyme that makes tetrahydrobiopterin an important cofactor used by other enzymes to make the neurotransmitters dopamine
More informationGenomes contain all of the information needed for an organism to grow and survive.
Section 3: Genomes contain all of the information needed for an organism to grow and survive. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the components of the
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature26136 We reexamined the available whole data from different cave and surface populations (McGaugh et al, unpublished) to investigate whether insra exhibited any indication that it has
More informationPharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001
Pharmacogenetics: A SNPshot of the Future Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 1 I. What is pharmacogenetics? It is the study of how genetic variation affects drug response
More informationVariant Detection in Next Generation Sequencing Data. John Osborne Sept 14, 2012
+ Variant Detection in Next Generation Sequencing Data John Osborne Sept 14, 2012 + Overview My Bias Talk slanted towards analyzing whole genomes using Illumina paired end reads with open source tools
More informationFunctional DNA Quality Analysis Improves the Accuracy of Next Generation Sequencing from Clinical Specimens
Functional DNA Quality Analysis Improves the Accuracy of Next Generation Sequencing from Clinical Specimens Overview We have developed a novel QC, the SuraSeq DNA Quantitative Functional Index (QFI ).
More informationQIAseq Targeted Panel Analysis Plugin USER MANUAL
QIAseq Targeted Panel Analysis Plugin USER MANUAL User manual for QIAseq Targeted Panel Analysis 1.1 Windows, macos and Linux June 18, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej
More informationCAPTURE-BASED APPROACH FOR COMPREHENSIVE DETECTION OF IMPORTANT ALTERATIONS
CAPTURE-BASE APPROACH FOR COMPREHENSIVE ETECTION OF IMPORTANT ALTERATIONS SEQUENCE MUTATIONS MICROSATELLITE INSTABILITY AMPLIFICATIONS GENOMIC REARRANGEMENTS For Research Use Only. Not for iagnostic Purposes.
More informationNext Generation Sequencing. Dylan Young Biomedical Engineering
Next Generation Sequencing Dylan Young Biomedical Engineering What is DNA? Molecule composed of Adenine (A) Guanine (G) Cytosine (C) Thymine (T) Paired as either AT or CG Provides genetic instructions
More informationLinking Genetic Variation to Important Phenotypes
Linking Genetic Variation to Important Phenotypes BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2018 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under
More informationCompute- and Data-Intensive Analyses in Bioinformatics"
Compute- and Data-Intensive Analyses in Bioinformatics" Wayne Pfeiffer SDSC/UCSD August 8, 2012 Questions for today" How big is the flood of data from high-throughput DNA sequencers? What bioinformatics
More informationDNA Sequencing by Ion Torrent. Marc Lavergne CHEM 4590
DNA Sequencing by Ion Torrent Marc Lavergne CHEM 4590 OVERVIEW History DNA Synthesis and First-Gen Sequencing Technology Sequencing Signal Detection Advantages/Disadvantages Applications Current Research
More informationAlignment. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014
Alignment J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationOutline General NGS background and terms 11/14/2016 CONFLICT OF INTEREST. HLA region targeted enrichment. NGS library preparation methodologies
Eric T. Weimer, PhD, D(ABMLI) Assistant Professor, Pathology & Laboratory Medicine, UNC School of Medicine Director, Molecular Immunology Associate Director, Clinical Flow Cytometry, HLA, and Immunology
More informationMatthew Tinning Australian Genome Research Facility. July 2012
Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909
More information