DETECTION OF GMOs (LMOs).
|
|
- Cathleen Webster
- 6 years ago
- Views:
Transcription
1 ISO/9001:2000 Certified Organisation NABL Accredited (ISO 17025) ISO DETECTION OF GMOs (LMOs). LALITHA R. GOWDA DEPARTMENT OF PROTEIN CHEMISTRY AND TECHNOLOGY CENTRAL FOOD TECHNOLOGICAL RESEARCH INSTITUTE MYSORE
2 Internationally referred centre of excellence for post graduate studies and research in foodcentric disciplines 53 Years of dedicated R&D Service to the nation Multi-disciplinary spread across 17 R&D departments covering every field of scientific investigation connected with foods and their relationship to humans, including the cutting edge area of food biotechnology Competitive and wide array of technologies for several commercially attractive, nutritionally superior and safe foods with humane touch State-of-the-art resource base comprehensive Ultra-sophisticated pilot plant A nationally referred food safety analytical quality control laboratory Sensory evaluation Package development Food Engineering services
3 Genetically Modified Organisms Plants or animals containing genes from other species to produce certain characteristics Pest resistance Herbicide resistance
4
5
6 Overview of GM-traits herbicide tolerance 646 male sterility/fertility restoration 149 Bt-derived insect resistance 139 virus resistance 130 fungal resistance 35 alteration of starch biosynthesis 31 modification of oil composition 29 improvement of processing quality 23 marker system 20 alteration of lignin biosynthesis 10 increased nutritional value 7 drought tolerance 5 alteration of ripening characteristics 4 bacterial resistance 4 nematode resistance 4
7 Gene construct for a GMO: Plant DNA Promoter Enhancer Gene Plant DNA Terminator
8 Some Common GMO Constructs
9 Who needs detection methods, and why? GMO producers To assure purity and segregation of products To be able to trace genetic modification in breeding Food & feed industry, seed companies To assure purity and segregation of products To assure compliance with legislation Competent (enforcement) authorities Product control, compliance with legislation To be able to retrieve specific products E.g. if marketing permission withdrawn Laboratories To provide services to society (incl. above)
10 Operational procedures involved in detection, identification and quantification of GMOs. Negative GMO test GMO detection Positive Sampling CRM. GMO identification Illegal No Authorised? Yes Assay individual ingredients No need for labelling Less than 1% Labelling required More than 1%
11 Requirements for GM-detection Target molecules must be present: DNA (template) or protein Capture molecules must be developed: For DNA: primers and probes For proteins: antibodies Reference materials Positive and negative controls Calibrants for quantitation
12 GMO DETECTION AND TESTING METHODS DNA Based methods Protein based methods Qualitative and Quantitative
13 DNA-BASED METHODS Detects a known DNA sequence by amplification Target sequence is duplicated billions of times Results obtained can be quantitative or qualitative Amplification is done in changing temperature cycles Enzyme = Thermophyllic TAQ polymerase Instrument = Thermocycler
14
15 Field of application Screening targets: false positives and false negatives possible! Not suited for identification and quantification Cost efficient Gene and construct specific targets: Positives GMO presence Event specific targets: Well suited for identification and quantification
16 Reference genes (for plants) A GMO belongs to a species Reference gene: Demonstrates presence of DNA from species Quantification of species DNA Reference for GMO quantification
17
18 GMO ANALYSIS FLOW CHART NON GM FOOD (-ve Control) STANDARD REFERENCE (+ve Control) GM FOOD MATERIAL DNA Extraction CTAB Method DNA Purity WIZARD TM Method PCR Amplification DNA Electrophoresis Interpretation & Documentation
19 POLYMERASE CHAIN REACTION - PCR A 'licence' to do molecular biology A key central technique that has revolutionised molecular and consequently cell biology devised by Kary Mullis c Mullis, K.B. (1990) The unusual origin of the polymerase chain reaction. Scientific American. 262 (4)
20 DENATURATION 93 C - 95 C ANNEALING 37 C - 65 C PCR Cycle CYCLES DENATURATION 93 C - 95 C EXTENSION 72 C
21
22 Polymerase Chain Reaction (PCR): Mg++ A C T G DENATURATION PRIMER ANNEALING POLYMERASE RECOGNITION TAAACTAGCGAAACTGCGTAGTGTGTCTAATCCGTGGACGACTTATT ATTTGATCGCTTTGACGCATCACACAGATTAGGCACCTGCTGAATAA Mg++ Mg++ TAAACTAGCGAAACTGCGTAGTGTGTCTAATCCGTGGACGACTTATT ATTTGATCGCTTTGACGCATCACACAGATTAGGCACCTGCTGAATAA MAGNESIUM COFACTOR EXTENSION Mg++ THE STRAND IS DUPLICATED A C T G
23 Theoretical DNA Amplification Cycle # of DNA copies , , ,048, ,554, ,073,741,824
24
25 Agarose Gel Electrophoresis UV Photograph Polaroid Photograph
26 DETECTION OF REGULATORY GENES Amplification of TNOS gene bp 192 bp 180 bp Lane 1, Premise control, Lane 2, 100 bp DNA ladder, Lane 3, Control biscuit, Lane 4, GM-2, Lane 5, GM-1 and Lane 6, GM-Soya Different segments of the NOS gene using different primer pairs were amplifiable.
27 DETECTION OF CONSTRUCT SPECIFIC GENES OF RUR-SOYA CaMV 35S CTP EPSPS EPSPS-TNOS bp 210 bp Lane 1, Premise control, Lane 2, Control biscuit, Lane 3, 100 bp DNA ladder, Lane 4, GM-1, Lane 5, GM-2 Lane 6, GM Soya Lane 1, Premise control, Lane 2, 100 bp DNA ladder, Lane 3, Control biscuit, Lane 4, GM Soya, Lane 5, GM-1 and Lane 6, GM -2 The CaMV 35S promoter Petunia- EPSPS (169bp) and EPSPS-NOS (210 bp) are cross border segments of the transgene of RUR Soya
28 Detection of GM-Soya in soya milk Lane 1: Premise control Lane 2: 100bp DNA ladder Lane 3: CP4 EPSPS-TNOSa Lane 4: CaMV 35S-CTP Lane 5: TNOS Lane 6: CaMV 35S Lane 7: Soya Lectin Lane 8: 35S-CP4 EPSPS
29 PCR Quality Control/Quality Assurance Positive and negative controls Extraction controls (Blanks) Control reactions (i.e. Lectin gene), spikes, CRM s Validated primer systems All analysis performed at least in duplicate Participation in sponsored check sample programs/ collaborative studies Internal validation trials
30 A major drawback of conventional PCR is lack of quantitative information due to effect of amplification efficiency. Efficiency is not constant for each amplification cycle but varies between different reactions & within the same reaction particularly in the later cycles. Conventional PCR thus relies on endpoint measurements.
31 PCR based relative quantification At least two different types of assays Quantitative Competitive PCR Real-time PCR For relative GMO concentrations: Quantification of plant-specific reference gene to GM-specific gene
32 RELATIVE QUANTITIES 0.5%GM 1.5%GM
33 REAL TIME PCR Amplification of the target DNA sequence is followed during each cycle by monitoring the product formed. Detection strategies rely on continuous measurements of the increase in fluorescence
34 Most popular assay is the Taqman or 5 -exonclease assay Employs a fluorogenic probe in addition to gene specific primers Fluorogenic probe is an oligonucleotide with both a reporter and a quencher dye attached.
35 Denaturation
36 Annealing Due to its target specific sequence, the probe anneals specifically to the target DNA between the forward and reverse primer
37 Extension If hybridization occurs the 5 exonuclease activity of Taq polymerase cleaves the internal probe.
38 5 Exonuclease Activity Cleavage reduces the quenching effect and a fluoroscent signal of the reporter is produced.
39 Plant specific GMO-specific The number of PCR cycles necessary to generate a signal that is significantly and statistically above the noise level is called cycle threshold.
40
41 Different techniques to monitor the PCR product formation in real time using amplicon-specific probes.
42 COMPETITIVE PCR
43 Validation Sensitivity Specificity Primer systems tested against other species Primer systems tested against DNA dilutions in various percentages and/or samples with different weight-to weight ratios Accuracy/Precision Primer systems tested in replicates against various matrices of known composition Robustness Other labs able to duplicate results
44 PCR (Advantages) High species specificity High sensitivity. Detection limits 0.1% of DNA present. Semi-quantitative PCR can provide a rough estimate of the level of contamination Real-Time PCR providing quite accurate quantitation in the less than 10% range DNA highly stable
45 PCR (Limitations) Not all tissues contain the same amount of DNA Require relatively advanced lab facilities and instrumentation and highly trained staff Cost is fairly expensive ($75- $300) Time (usually >24 hrs for results) Special measures needed for avoidance of contamination and inhibition
46 Challenges in PCR detection Target molecules Degraded or absent target molecules undetectable! Effects of processing usually significant Important to improve methods to recover target Capture molecules must be developed: Impossible without (description of) target molecules Need material for method development / validation Reference materials Material for production of RMs difficult to obtain Materials must serve many different functions Contd..
47 Challenges in PCR detection Gene stacking Hybrids between GMOs Detection methods will detect GMO1 + GMO2 GMO1 X GMO2 GMO1 X GMO2 Unknown GMOs Not described in any available documents
48
49
50 Two-tiered approach for DNA detection 1. Detection + Identification (Microarray) 2. Quantitation (Real time PCR)
51 GMO CHIPS Based on classical DNA hybridization principle Many specific probes are attached to a solid surface Screen & identifies GMOs in raw material and processed food, currently available on soybean, maize, oilseed, rape, rice, CaMV, RR-soybean, Bt etc., Allows screening for all GMOs with the CaMV 35S promoter, Nosterminator, bar-gene and pat-gene
52 GMO DETECTION AND TESTING METHODS DNA Based methods Protein Based Methods Qualitative and Quantitative
53 PROTEIN BASED DETECTION
54 Different strategies to perform an ELISA Test
55 GMO protein specific to antigen Protein methods - ELISA Enzyme-labelled Antiantibody antibody Blocking protein Antigen Antibody-coated microwells; Quantitative, highly sensitive, economical, high throughput & ideal for laboratory analysis Standard of known GMO-protein well Less expensive than PCR and faster; Risk of false positive less Cannot discriminate difference expression pattern Denaturing protein food processing Separate test is needed for each trait Colour Response Concentration Dependent
56
57 Quicktest strip for Cry1Ab/Ac control test positive negative
58 Quick test strip for EPSPS 0% GM 0.1 % GM 1.0% GM
59
60 Captured PCR-ELISA
61
62
63
64 METHOD HARMONISATION Check that the method works Check that the method is reliable Check that other laboratories can use the method Performance Measurement Validation Proficiency Testing
65 Summary of detection methods for rdna products of GM foods Parameter Western blot ELISA Lateral flow strip Southern blot Qualitative PCR QC-PCR RT-PCR Ease of use Difficult moderate Simple Difficult Difficult Difficult Difficult Special equipment needed Yes Yes No Yes Yes Yes Yes Sensitivity High High High Moderate Very High High High Duration 2d min 10 min 6h 1.5d 2d 1d Cost/sample Quantitative No Yes No No No Yes Yes Field application No Yes Yes No No No No Where applied Academic lab Test facility Field Testing Academic lab Test facility Test facility Test facility Ahmed, 2002
66 CONCLUSIONS PCR with its various formats is currently the leading analytical technology employed in the qualitative and quantitative analysis of GMOs (LMOs) because of its unparalleled sensitivity and specificity. On the other hand immunoassays are tools for rapid field monitoring of the integrity of agricultural commodities, whereby non-specialized personnel can employ them in a cost effective manner.
Technical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationHiPer Real-Time PCR Teaching Kit
HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationBio Rad PCR Song Lyrics
Bio Rad PCR Song Lyrics There was a time when to amplify DNA, You had to grow tons and tons of tiny cells. (Oooh) Then along came a guy named Dr. Kary Mullis, Said you can amplify in vitro just as well.
More informationGM (Genetically Modified) Plants. Background
1 GM (Genetically Modified) Plants Background Genetically modified crops (GM) have been used since 1996 in the U.S. GM crops contain foreign genetic material The DNA may be from another plant or from a
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationqpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationIntroduction to Real-Time PCR: Basic Principles and Chemistries
Introduction to Real-Time PCR: Basic Principles and Chemistries Leta Steffen, PhD Applications Scientist Promega Corporation Outline I. Real-Time PCR overview Basics of Real-Time PCR Understanding the
More informationCertified Reference Materials AOCS 0707-C4
Mail Address: AOCS, P.O. Box 17190, Urbana, IL 61803-7190 USA Street Address: AOCS, 2710 S. Boulder Drive, Urbana, IL 618026996 USA Phone: +1-217-359-2344; Fax: +1-217-351-8091; E-Mail: CRM@aocs.org; Web:
More informationfoodproof GMO RR 2 Yield Soya Quantification Kit
For GMO Testing purposes. FOR IN VITRO USE ONLY. foodproof GMO RR 2 Yield Soya Quantification Kit - 5 Nuclease - Version 2, March 2017 PCR kit for the quantitative detection of genetically modified soya
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationCertified Reference Materials AOCS 0707-C6
Street Address: AOCS, 2710 S. Boulder Drive Urbana, IL 61802-6996 USA Phone: +1-217-359-2344 Fax: +1-217-351-8091 E-Mail: CRM@aocs.org Web: www.aocs.org Certified Reference Materials AOCS 0707-C6 Report
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationFundamentals of Real Time PCR
Fundamentals of Real Time PCR Mohamed Abdel Fattah Senior Technical Specialist Scientific Support - Molecular Biology Dept. AnalysisAB Co. Mobile: 012 27 906 74 E-mail: analysis@analysis-ab.com What is
More informationBasic Steps of the DNA process
As time pasted technology has improve the methods of analyzing DNA. One of the first methods for the analysis of DNA is known as Restriction Fragment Length Polymorphism (RFLP). This technique analyzed
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background PCR Amplify= Polymerase Chain Reaction (PCR) Invented in 1984 Applications Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off
More informationPolymerase Chain Reaction (PCR) and Its Applications
Polymerase Chain Reaction (PCR) and Its Applications What is PCR? PCR is an exponentially progressing synthesis of the defined target DNA sequences in vitro. It was invented in 1983 by Dr. Kary Mullis,
More informationvalidation report for TaqMan Roundup Ready Quantification Kit
validation report for TaqMan Roundup Ready Quantification Kit Life Technologies offers a breadth of products DNA RNA protein cell culture instruments For Research Use Only. Not intended for any animal
More informationQuantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit
Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to
More informationGenetic Fingerprinting
Genetic Fingerprinting Introduction DA fingerprinting In the R & D sector: -involved mostly in helping to identify inherited disorders. In forensics: -identification of possible suspects involved in offences.
More informationEvent-specific Method for the Quantification of Oilseed Rape Line Ms8 Using Real-time PCR. Validation Report
EUROPEAN COMMISSION DIRECTORATE GENERAL JRC JOINT RESEARCH CENTRE INSTITUTE FOR HEALTH AND CONSUMER PROTECTION COMMUNITY REFERENCE LABORATORY FOR GM FOOD AND FEED Event-specific Method for the Quantification
More informationAccuPower PCR PreMix 73. AccuPower Taq PCR PreMix 77. AccuPower PCR PreMix (with UDG) 79. AccuPower HotStart PCR PreMix 81
PCR PreMix 73 AccuPower Taq PCR PreMix 77 AccuPower PCR PreMix (with UDG) 79 AccuPower HotStart PCR PreMix 81 AccuPower PyroHotStart Taq PCR PreMix 84 AccuPower HotStart PCR PreMix (with UDG) 87 AccuPower
More informationHiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit
HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit Product Code: HTBM031 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 3.5 hours Agarose Gel Electrophoresis:
More informationIntroduction To Real-Time Quantitative PCR (qpcr)
Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More informationDifferent types of PCR and principles of Real Time PCR. Prof. Dr. Hamdy M. El-Aref Assiut University, Faculty of Agriculture Genetics Department
Different types of PC and principles of eal Time PC. Prof. Dr. Hamdy M. El-Aref Assiut University, Faculty of Agriculture Genetics Department I N T O D U C T I O N PC Cycle (round) I N T O D U C T I O
More informationSensitivity vs Specificity
Viral Detection Animal Inoculation Culturing the Virus Definitive Length of time Serology Detecting antibodies to the infectious agent Detecting Viral Proteins Western Blot ELISA Detecting the Viral Genome
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationReverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques
More informationUncertainties and certainties in GMO analytics using qpcr
Uncertainties and certainties in GMO analytics using qpcr PD Dr. Philipp Hübner Kantonales Labor Basel-Stadt Abteilung Lebensmittel Postfach CH-412 Basel using qpcr historical review Short crash course
More informationEvent-specific Method for the Quantification of Soybean Line A Using Real-time PCR. Validation Report
Event-specific Method for the Quantification of Soybean Line A2704-12 Using Real-time PCR Validation Report 14 May 2007 Directorate General-Joint Research Centre Institute for Health and Consumer Protection
More informationMycobacterium tuberculosis End-Point PCR Kit Product# EP42100
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Mycobacterium tuberculosis End-Point PCR Kit Product# EP42100
More informationCertified Reference Materials AOCS 0512-A
Mail Address: AOCS, P.O. Box 17190, Urbana, IL 61803-7190 USA Street Address: AOCS, 2710 S. Boulder Drive, Urbana, IL 618026996 USA Phone: +1-217-359-2344; Fax: +1-217-351-8091; E-Mail: CRM@aocs.org; Web:
More informationPolymerase Chain Reaction (PCR) May 23, 2017
Polymerase Chain Reaction (PCR) May 23, 2017 Outline History of PCR Uses of PCR How PCR works How to set up and run PCR The structure of DNA PCR Polymerase chain reaction Selective amplification of target
More information3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) Fax: (905)
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com E.coli O157:H7 End-Point PCR Kit Product# EP41300 Product Insert
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationPCR based Testing of Living Modified Organisms (LMOs)
PCR based Testing of Living Modified Organisms (LMOs) Gurinder Jit Randhawa Senior Scientist NRC on DNA Fingerprinting NBPGR New Delhi The first commercially available transgenic crop was the FLAVR-SAVR
More informationGMO-Plants: Basics-Technology-Legislation-Analysis. Dr. F. Waldherr CONGEN Biotechnologie GmbH
-Plants: Basics-Technology-Legislation-Analysis Dr. F. Waldherr CONGEN Biotechnologie GmbH In September 2009 unauthorized linseed FP967/CDC Triffid from Canada was detected in europoean raw materials and
More informationDNA Technology. Asilomar Singer, Zinder, Brenner, Berg
DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other
More informationUSB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr
USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate
More informationChapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
More informationPrincipals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt
Principals of Real-Time PCR Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt What Is Real-Time PCR? Nucleic acid (DNA) amplification and detection
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationPCR settings, pitfalls and artefacts
De gekoppelde afbeelding kan niet worden weergegeven. Het bestand is mogelijk verplaatst, heeft een andere naam gekregen of is verwijderd. Controleer of de koppeling verwijst naar het juiste bestand en
More informationPCR Methods and Analytical Strategies for GMO Testing. E. Pearce Smith Eurofins GeneScan
PCR Methods and Analytical Strategies for GMO Testing E. Pearce Smith Eurofins GeneScan 1 Genetically Modified Organisms Viruses Bacteria Fungi Plants Animals 2 Examples of Tests for Biotech Corn and Soy
More informationCHAPTER 08: RECOMBINANT DNA TECHNOLOGY Pearson Education, Inc.
CHAPTER 08: RECOMBINANT DNA TECHNOLOGY The Role of Recombinant DNA Technology in Biotechnology Biotechnology the use of microorganisms to make practical products Recombinant DNA technology Intentionally
More informationSuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes
WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus
More informationChapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi
Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated
More informationChapter 7 DNA Fingerprinting By the end of this chapter you will be able to:
Chapter 7 DNA Fingerprinting By the end of this chapter you will be able to: explain how crime scene evidence is collected and processed to obtain DNA describe how radioactive probes are used in DNA fingerprinting
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationAgilent s Mx3000P and Mx3005P
Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded
More informationDNA Replication. DNA Replication. Meselson & Stahl Experiment. Contents
DNA Replication Contents 1 DNA Replication 1.1 Meselson & Stahl Experiment 1.2 Replication Machinery 2 Polymerase Chain Reaction (PCR) 3 External Resources: DNA Replication Meselson & Stahl Experiment
More informationEvent-specific Method for the Quantification of Soybean Line Using Real-time PCR. Validation Report
Event-specific Method for the Quantification of Soybean Line 40-3-2 Using Real-time PCR Validation Report 11 September 2007 Joint Research Centre Institute for Health and Consumer Protection Biotechnology
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More informationChapter 8 Recombinant DNA Technology. 10/1/ MDufilho
Chapter 8 Recombinant DNA Technology 10/1/2017 1 MDufilho The Role of Recombinant DNA Technology in Biotechnology Biotechnology? Recombinant deoxyribonucleic acid (DNA) technology Intentionally modifying
More informationA SIMPLEX PCR ASSAY FOR THE IDENTIFICATION OF FISH MATERIAL IN FEED
LUCRARI STIINTIFICE MEDICINA VETERINARA VOL. XLIV(1), 2011, TIMISOARA A SIMPLEX PCR ASSAY FOR THE IDENTIFICATION OF FISH MATERIAL IN FEED SORINA POPESCUl, OANA-MARIA IOJA- BOLDURA1, I. HUTU2 Molecular
More informationMightyAmp DNA Polymerase Ver.3
Cat. # R076A For Research Use MightyAmp DNA Polymerase Ver.3 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. General PCR Reaction Mix... 3 V. Primer Design...
More informationBacteriophage MS2. genesig Standard Kit. Phage MS2 genome. 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Bacteriophage MS2 Phage MS2 genome genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Bacteriophage MS2 Bacteriophage MS2 is a non-enveloped,
More informationChapter 10 Analytical Biotechnology and the Human Genome
Chapter 10 Analytical Biotechnology and the Human Genome Chapter Outline Enzyme tests and biosensors DNA-based tests DNA analysis technologies Human genome and genome-based analytical methods 1 Enzyme-based
More informationRoche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
More informationQUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)
QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.
More informationChapter 5. The Carriage of Genetically Modified (GM) Crops
Chapter 5 The Carriage of Genetically Modified (GM) Crops The term GMO (genetically modified organism) refers to any organism whose genetic makeup has been altered using genetic engineering. In the instance
More informationBiotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationProduct# EP Product Description
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Chlamydia End-Point PCR Kit Product# EP31400 Product Insert Intended
More information2 Gene Technologies in Our Lives
CHAPTER 15 2 Gene Technologies in Our Lives SECTION Gene Technologies and Human Applications KEY IDEAS As you read this section, keep these questions in mind: For what purposes are genes and proteins manipulated?
More informationCertified Reference Materials AOCS 1011-A
Mail Address: AOCS, P.O. Box 17190, Urbana, IL 61803-7190 USA Street Address: AOCS, 2710 S. Boulder Drive, Urbana, IL 618026996 USA Phone: +1-217-359-2344; Fax: +1-217-351-8091; E-Mail: CRM@aocs.org; Web:
More informationCertified Reference Materials AOCS 0210-A
Mail Address: AOCS, P.O. Box 17190, Urbana, IL 61803-7190 USA Street Address: AOCS, 2710 S. Boulder Drive, Urbana, IL 618026996 USA Phone: +1-217-359-2344; Fax: +1-217-351-8091; E-Mail: general@aocs.org;
More informationFapas GM (GeMMA) Proficiency Testing Programme 2017
Fapas GM (GeMMA) Proficiency Testing Programme 2017 Contents Who We Are 3 Fapas Proficiency Tests 4 Mixed Event Unprocessed Matrix (MU) 6 Mixed Event Processed Matrix (MP) 6 Single Event Tobacco Matrix
More informationTroubleshooting of Real Time PCR Ameer Effat M. Elfarash
Troubleshooting of Real Time PCR Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. aelfarash@aun.edu.eg What is Real-Time PCR used for? Gene expression analysis Disease diagnosis
More informationprogress in GMO analysis and presentation of the Compendium of validated reference methods
2 nd International Workshop on Harmonisation of GMO Detection and Analysis for Central and South America Merida, Mexico 2-3 March 2011 1 2009-2010 progress in GMO analysis and presentation of the Compendium
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationNucleic Acid Electrophoresis APPLICATION GUIDE
AGAROSE BUFFERS LADDERS EQUIPMENT Nucleic Acid Electrophoresis APPLICATION GUIDE Reagents: Agarose Thermo Scientific and Fisher Scientific products deliver an end-to-end solution that can meet your most
More informationqpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description
qpcr Kit, DNA-free For the PCR detection and identification of bacterial and fungal DNA using custom primers Product code A8514 Product components 100 rxn 250 rxn A 2.5x mastermix (3 mm MgCl 2 final concentration)
More informationPrimer Design Ameer Effat M. Elfarash
Primer Design Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. amir_effat@yahoo.com PCR Cycle Each cycle (Round) of PCR contains 3 steps: 1- Denaturation 2- Primer annealing
More informationISTA Tests for GMO seeds : New Rules Chapter and Handbook
ISTA Tests for GMO seeds : New Rules Chapter and Handbook René Mathis GEVES Groupe d Etude et de contrôle des Variétés Et des Semences ISTA Seminar on Molecular tools for seed quality & Seed health 2015-06-15
More informationA practical approach to screen for authorised and non-authorised GMOs
A practical approach to screen for authorised and non-authorised GMOs Dr. Lutz Grohmann Federal Office of Consumer Protection and Food Safety Berlin, Germany 2 nd Workshop on Harmonisation of GMO analysis
More informationDesigning Real-Time Assays on the SmartCycler II System
Designing eal-time Assays on the SmartCycler II System Cepheid Technical Support Overview This document provides general guidelines for the design of real-time experiments on the Cepheid SmartCycler II
More informationApplied Biosystems Real-Time PCR Rapid Assay Development Guidelines
Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping
More informationOne Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)
Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.
More informationEvent-specific method for the quantitation of rice line LLRICE62 using real-time PCR. Validation Report
CRLVL05/04VR EUROPEAN COMMISSION DIRECTORATE GENERAL JRC JOINT RESEARCH CENTRE INSTITUTE FOR HEALTH AND CONSUMER PROTECTION COMMUNITY REFERENCE LABORATORY FOR GM FOOD AND FEED Event-specific method for
More informationLATE-PCR. Linear-After-The-Exponential
LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,
More informationBIO NEWS. Food Diagnostics Special. Genomic DNA from food and feed for GMO detection / quantification and animal species differentiation
BIO NEWS Food Diagnostics Special Genomic DNA from food and feed for GMO detection / quantification and animal species differentiation NucleoSpin Food NucleoSpin Food Purification of genomic DNA from food
More informationOne platform, endless possibilities
One platform, endless possibilities The Agilent 2100 Bioanalyzer is an indispensable tool for food chemists and biologists. Now you can have a multi-purpose platform that streamlines your workflows from
More informationMolekulargenetische Reagenzien. Raumtemperaturstabile PCR und qpcr Reagenzien
Molekulargenetische Reagenzien Raumtemperaturstabile PCR und qpcr Reagenzien Polypeptide Stabilization Technology: Stability TAG Ice-free reaction set-up Our temperature stable enzymes allow you to change
More informationGenetics module. DNA Structure, Replication. The Genetic Code; Transcription and Translation. Principles of Heredity; Gene Mapping
Genetics module Lectures DNA Structure, Replication The Genetic Code; Transcription and Translation Principles of Heredity; Gene Mapping Controlling Gene Expression Mutation and Cancer Textbook: Introduction
More informationLaboratory #7 PCR PCR
1 Laboratory #7 Polymerase chain reaction () is DNA replication in a test tube. In vitro enzymatic amplification of a specific segment of DNA. Many Applications. direct cloning from DNA or cdna. Mutagenesis
More informationMolecular assessment of GMOs Ilona Kryspin Sørensen PhD DTU Food Division for Risk Assessment and Nutrition
Molecular assessment of GMOs Ilona Kryspin Sørensen PhD DTU Food Division for Risk Assessment and Nutrition Objective : to assess the level of documentation necessary for the evaluation of the insertion
More informationQuantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract
Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer Application Note Odilo Mueller Abstract This application note describes how the Agilent Technologies 2100 bioanalyzer can be used
More informationUsing Genetics for Species Identification
Using Genetics for Species Identification John Hyde NOAA Southwest Fisheries Science Center La Jolla, California USA December 6, 2013 2 Important Point to Consider Not all specimens need to be genetically
More informationHuman bocavirus. Viral protein (VP) gene. 150 tests. Quantification of Human bocavirus genomes. Advanced kit handbook HB
Techne qpcr test Human bocavirus Viral protein (VP) gene 150 tests For general laboratory and research use only 1 Introduction to Human bocavirus Human Bocavirus is a genus of the Parvoviridae family with
More informationFood Safety and. Genetically Modified Foods
3 Food Safety and Genetically Modified Foods Food Safety and Genetically Modified Foods The debate surrounding genetically modified foods has left consumers confused and sceptical. Interest groups seem
More information