Utilisation d IMGT pour l humanisation et. l ingénierie des anticorps thérapeutiques
|
|
|
- Johnathan Hutchinson
- 6 years ago
- Views:
Transcription
1 Utilisation d IMGT pour l humanisation et l ingénierie des anticorps thérapeutiques Marie-Paule Lefranc IMGT, the international ImMunoGeneTics information system Université de Montpellier, CNRS Institut de Génétique Humaine IGH, Montpellier, France Recherche, développement et production d anticorps monoclonaux thérapeutiques Villejuif, 4-6 avril 2018
2 IMGT domain: the adaptive immune response Immunoglobulin (IG) T lymphocyte B lymphocyte T cell receptor (TR) peptid e Major histocompatibility (MH) protein Trimolecular complex TR/pMH Vertebrates gnathostomata (with jaws): specificity, memory
3 Immunoglobulin (IG) T cell receptor (TR) V-DOMAIN V-J-REGION V-DOMAIN V-D-J-REGION Light chain Contribution of the 2 V-DOMAINs to the antigen binding site Alpha - Beta Gamma - Delta Heavy chain V-J-REGION V-DJ-REGION Membrane IgM T cell receptor The Immunoglobulin FactsBook, 2001
4 IMGT, the international ImMunoGeneTics information system
5 Why was IMGT necessary? 1. Unique structure of the immunoglobulin (IG) and T cell receptor (TR) genes. 2. Huge diversity of the immunoglobulin (IG) and T cell receptor (TR) repertoires. IMGT is at the origin of Immunoinformatics
6 Structure of an immunoglobulin (IG) or antibody Potentially 2 x different IG (or antibody) specificities IMGT,
7 Immunoglobulin (IG) synthesis genomic DNA (IGH Locus 14q32) V D J C 5 3' rearranged DNA mrna 5 3' 2 x different IG per individual IMGT Repertoire,
8 Immunoglobulin (IG) synthesis 15 0 FUNCTIONAL IG GENES HEAVY CHAIN V D J C V J C 5 ' 3 ' 5' 3 ' x 2 3 x x 5 Kappa x 4-5 Lambda LIGHT CHAIN 6300 POTENTIAL RECOMBINATIONS POTENTIAL RECOMBINATIONS N-DIVERSITY SOMATIC MUTATIONS x ' 3' 5 ' 3 ' ABOUT 6.3 x 10 6 POSSIBILITIES ABOUT 3.5 x 10 5 POSSIBILITIES 2 x DIFFERENT ANTIBODIES IMGT Repertoire,
9 Bone marrow Blood Lymph nodes, spleen V-D-J and V-J rearrangements Hypermutations, selection
10 Genomic DNA in germline configuration V-GENE >X HSVI2 Homo sapiens VI-2 gene for immunoglobulin heavy chain tgagagctcc gttcctcacc atggactgga cctggaggat cctcttcttg gtggcagcag 60 ccacaggtaa gaggctccct agtcccagtg atgagaaaga gattgagtcc agtccaggga 120 gatctcatcc acttctgtgt tctctccaca ggagcccact cccaggtgca gctggtgcag 180 tctggggctg aggtgaagaa gcctggggcc tcagtgaagg tctcctgcaa ggcttctgga 240 tacaccttca ccggctacta tatgcactgg gtgcgacagg cccctggaca agggcttgag 300 tggatgggat ggatcaaccc taacagtggt ggcacaaact atgcacagaa gtttcagggc 360 agggtcacca tgaccaggga cacgtccatc agcacagcct acatggagct gagcaggctg 420 agatctgacg acacggccgt gtattactgt gcgagagaca cagtgtgaaa tgaaa acccacatcc 480 tgagggtgtc agaaacccaa gggaggaggc ag L-PART1 L-PART2 V-REGION V-RS 5'UTR V-INTRON 3'UTR 5' 3' V-HEPTAMER INIT-CODON 1st-CYS 2nd-CYS DONOR ACCEPTOR V-SPACER SPLICE -SPLICE V-NONAMER
11 Genomic DNA in germline configuration J-GENE
12 Genomic DNA in germline configuration D-GENE 5 D-RS D-REGION 3 D-RS 5'UTR 3'UTR 5' 3' 5 D-NONAMER 5 D-SPACER 5 D-HEPTAMER 3 D-HEPTAMER 3 D-SPACER 3 D-NONAMER
13 Immunoglobulin V-D-J generation of sequence diversity 3 V-REGION N-REGION D-REGION N-REGION 5 J-REGION tgtgcgaaaga tacc agcatattgtgtggtgactgctat tcc gatt acaactggttcgactcctgg JUNCTION C A P Y R G D T Y D Y S W tgt tgtgcgccagcg cca tac cgg ggggtgactactat ggt gac act tat gat tac tcc tgg
14 V domains of an IG (or antibody) VH V-D-J junction VL V-J junction IMGT
15 Structural domains of the IG and TR V-DOMAIN C-DOMAIN CDR: complementarity determining region IMGT Repertoire,
16
17 The eleven IMGT amino acid classes according to the physico-chemical properties Pommié et al. J. Mol Recognit. 17, 17-32, 2004
18 Spacefill 3D representation of an IgG The Immunoglobulin FactsBook, 2001
19 cdna..gagga ttcaccatgg aactggggct ccgctgggtt ttccttgttg cttttttaga 120 aggtgtccag tgtgaggtgc aactggtgga gtctggggga ggcctggtca agccgggggg 180 gtccctgaga ctctcctgtg cagcctctgg attaagcttc agtacctatg ccatgaactg 240 ggtccgccag gctccaggga aggggctgga atgggtctca agtattagta gtagaagtga 300 ttacatatac tatagagact cagtgaaggg ccgattcacc atctccagag acaacgccaa 360 gaattcactg tatctgcaaa tgaatagcct gagagtcgac gacacggctg tctattactg 420 tgcgagagat t tcttgtaatg gtgctatatg ttatggtttcgtttc agtccctggg gccagggaac 480 cctggtcacc tcgtctcctcag catccccgac cagccccaag agt gtcttcccgc tgagcctctg 540 cagcacccag ccagatggga acgtggtcat cgcctgcctg gtccagggct tcttccccca 600 ggagccactc agtgtgacct ggagcgaaag cggacagggc gtgaccgcca gaaacttccc 660 acccagccag gatgcctccg gggacctgta caccacgagc agccagctga ccctgccggc 720 cacacagtgc ctagccggca agtccgtgac atgccacgtg aagcactaca cgaatcccag 780 ccaggatgtg actgtgccct gcccagttcc ctcaactcca cctaccccat ctccctcaac 840 tccacctacc ccatctccct catgctgcca cccccgactg tcactgcacc gaccggccct 900 cgaggacctg ctcttaggtt cagaagcgaa cctcacgtgc acactgaccg gcctgagaga 960 tgcctcgggt gtcaccttca cctggacgcc ctcaagtggg aagagcgctg ttcaaggacc 1020 acctgagcgt gacctctgtg gctgctacag cgtgtccagt gtcctgccgg gctgtgccga 1080 gccatggaac catgggaaga ccttcacttg cactgctgcc taccccgagt ccaagacccc 1140 gctaaccgcc accctctcaa aatccggaaa cacattccgg cccgaggtcc acctgctgcc 1200 gccgccgtcg gaggagctgg ccctgaacga gctggtgacg ctgacgtgcc tggcacgtgg 1260 cttcagcccc aaggacgtgc tggttcgctg gctgcagggg tcacaggagc tgccccgcga 1320 gaagtacctg acttgggcat cccggcagga gcccagccag ggcaccacca ccttcgctgt 1380 gaccagcata ctgcgcgtgg cagccgagga ctggaagaag ggggacacct tctcctgcat 1440 ggtgggccac gaggccctgc cgctggcctt cacacagaag accatcgacc gcttggcggg 1500 taaacccacc catgtcaatg tgtctgttgt catggcggag gtggacggca cctgctactga UTR 3 UTR FR1-IMGT FR2-IMGT FR3-IMGT W/F C-REGION C W C L-REGION V-REGION D-REGION JUNCTION J-REGION
20 IMGT birth and objectives: 1989 IMGT was created in June 1989, following the Human Genome Meeting HGM, at New Haven, USA. * Thomas Shows and Ken Kidd, meeting organizers * Lap Chee Tsui, chromosome 7 responsable * Claude Boucheix (CD nomenclature) 1. At New haven, entry of the 16 human T cell receptor gamma genes (TRG) in the genome database, Genome Database (GDB). 2. IMGT was created to answer the need to manage the T cell receptor (TR) and immunoglobulin (IG) genes and to enter them in the generalist databases.
21 Lefranc M-P. Immunoglobulin (IG) and T cell receptor genes (TR): IMGT and the birth and rise of immunoinformatics. Front Immunol Feb 05;5:22. doi: /fimmu Open access. PMID: Lefranc M-P et al. IMGT, the international ImMunoGeneTics information system 25 years on. Nucleic Acids Res Jan;43(Database issue):d doi: /nar/gku1056. Epub 2014 Nov 5 Free Article. PMID:
22 Part IMGT-ONTOLOGY 2. A new science: Immunoinformatics 3. An information system for IG, TR and MH.
23 IMGT-ONTOLOGY seven axioms: To share, reuse and represent knowledge in Immunogenetics and Life Sciences IDENTIFICATION OBTENTION CLASSIFICATION DESCRIPTION ORIENTATION LOCALIZATION NUMEROTATION Giudicelli and Lefranc, Bioinformatics 1999, Front Genet 2012
24 Concepts of IDENTIFICATION IMGT standardized keywords IG-Heavy IGH IG-Light-Kappa IGK IG-Light-Lambda IGL
25 Gene name: Homo sapiens IGLV2-11 Definition: Homo sapiens immunoglobulin lambda variable 2-11 CLASSIFICATION LOCALIZATION Human IGL locus (22q11.2)
26 Concepts of CLASSIFICATION 1. Immunoglobulin (IG) and T cell receptor (TR) genes 2. Nomenclature for the variable (V), diversity (D), joining (J) and constant (C) genes 3. IMGT concepts of group, subgroup, gene and allele 4. All IMGT human gene names were approved by HUGO Gene Nomenclature Committee (HGNC) in 1999, and endorsed by NCBI in IMGT alleles validated by WHO-IUIS/IMGT-NC since 1989 IMGT/GENE-DB: international reference database for IG and TR genes (links from NCBI Gene to IMGT/GENE-DB) and alleles Lefranc and Lefranc, 2 FactsBooks (IG, TR) 2001
27 Concepts of NUMEROTATION 1. IMGT unique numbering 2. IMGT Collier de Perles (first one in 1997) CDR-IMGT lengths [ ] Lefranc et al. Dev Comp Immunol 2003
28 Concepts of NUMEROTATION 1. IMGT unique numbering 2. IMGT Collier de Perles (first one in 1997) CDR-IMGT lengths [ ] - conserved AA (and codons) always at the same positions: 23 1st-CYS 41 CONSERVED-TRP 89 hydrophobic 104 2nd-CYS 118 J-PHE, J-TRP - six anchors: delimitation of the FR-IMGT and CDR-IMGT CDR-IMGT lengths are crucial information Lefranc et al. Dev Comp Immunol 2003
29 Concepts of DESCRIPTION IMGT labels are in capital letters Example: Prototype and IMGT Labels for a rearranged V-D-J-GENE in gdna
30 IMGT created in 1989 by Marie-Paule Lefranc Montpellier University, CNRS, France 7 databases 17 online tools 20,000 web pages Sequences Genes Structures Immunoglobulins (IG) (or antibodies) T cell receptors (TR) MH IgSF and MhSF
31 IMGT source and reference for IG and TR genes NCBI Example of HGNC Entry For IGHV1-69 HGNC
32 IMGT/3Dstructure-DB DESCRIPTION
33 IMGT/3Dstructure-DB V-DOMAIN Hydrogen bonds Lefranc et al. Nucl Acids Res 2009
34 IMGT/3Dstructure-DB: Contacts IG/Ag (Ligand)
35
36 Two IMGT tools for interpretation of IG and TR sequences and NGS repertoires: IMGT/HighV-QUEST IMGT/StatClonotype
37 IMGT/HighV-QUEST: High throughput version of IMGT/V-QUEST on the Web since 2010, freely available for academics (user registration required) deals with NGS sequences from Roche 454, Illumina, Ion Torrent, PacBio 2 modules: 1. Analyses up to 500,000 IG or TR rearranged sequences per batch 2. Statistics analysis (including IMGT clonotype (AA)) between batches (up to 1 million IG or TR sequence outputs from module 1). Alamyar et al. Immunome Res 2012
38 IMGT/HighV-QUEST Module 1: sequence analysis IMGT/V-QUEST results in 11 CSV files (1 line per analysed sequence, ~500 columns per line) 1. Identifies the germline V, D and J genes and alleles, score, % Provides sequences (nt and AA, with or without IMGT gaps) with description of the V-DOMAIN 6. Analyses the V-(D)-J junction (IMGT/JunctionAnalysis) Characterizes: nt mutations AA changes localisation of the hotspots 11. Parameters Alamyar et al. Immunome Res 2012
39 IMGT/HighV-QUEST sequence analysis 1_Summary (CSV file): equivalent to Results summary of online IMGT/V-QUEST
40 IMGT/HighV-QUEST sequence analysis 6_Junction (CSV file) equivalent to IMGT/JunctionAnalysis detailed analysis
41 IMGT/HighV-QUEST Module 2: Statistics for sequence analysis interpretation Up to 1,000,000 sequence results Performed on filtered-in sequences (reliable set) Li S, et al. Nat Commun 2013
42 Characterization of IMGT clonotypes (AA) An IMGT clonotype (AA) is defined by: a unique V-(D)-J-rearrangement (V and J genes and alleles ) (nt) a unique CDR3 (AA) Conserved anchors 104, 118 (C104, W or F118) An example of table for TRB IMGT clonotypes (AA) Li S. et al. Nat Commun 2013
43 Evaluation of the clonotype diversity and expression per gene IMGT clonotype (AA) diversity IMGT clonotype (AA) expression Diversity: nb of IMGT clonotypes per gene Expression: nb of sequences per gene
44 Identification of common IMGT clonotypes (AA) in different sets
45 IMGT/HighV-QUEST (web portal for NGS) 15.8 billions of IG and TR sequences analysed 2419 users from 46 countries, March 2018
46 IMGT/StatClonotype: significance of differences in proportions Statistic test : z-score (exact Fisher s test for low or null occurrences) Adjustment of the p-values with 7 multiple testing procedures
47 IMGT/StatClonotype: Multiple testing procedures plots for genes (also available for alleles) Scatter plot Aouinti et al. PLoS One 2015, Front Immunol 2016
48 IMGT/StatClonotype: Statistical significance Results: Test interpretation is displayed in Synthesis graphs Aouinti et al. PLoS One 2015 Front Immunol 2016
49 IMGT/StatClonotype: CDR-IMGT AA Properties (here CDR3-IMGT length=13 AA) Displays:. 20 amino acids. Physicochemical. Hydropathy. Volume. Chemical. Charge. Hydrogen donor or acceptor atoms. Polarity Variability plot Variability indexes :. Shannon entropy. Wu-Kabat variability. Simpson index Aouinti et al. Front Immunol 2016
50
IMGT/mAb-DB et IMGT/2Dstructure-DB
IMGT/mAb-DB et IMGT/2Dstructure-DB François Ehrenmann, Yan Wu, Chantal Ginestoux, Gérard Lefranc and Marie-Paule Lefranc 1ère Réunion du GDR 3260 - ACCITH Anticorps et ciblage thérapeutique 22-23 Octobre
Atlas of Genetics and Cytogenetics in Oncology and Haematology. IMMUNOGLOBULIN GENES: CONCEPT OF DNA REARRANGEMENT * Introduction
Atlas of Genetics and Cytogenetics in Oncology and Haematology IMMUNOGLOBULIN GENES: CONCEPT OF DNA REARRANGEMENT * Introduction I Historical questions II Answers II.1 Light chains (kappa or lambda) II.1.1
IMGT Locus on Focus. ABC Fax Marie-Paule Lefranc
Exp Clin Immunogenet 1998;15:1 7 Received: January 7, 1998 Marie-Paule Lefranc Laboratoire d ImmunoGénétique Moléculaire, CNRS, Université Montpellier II, Montpellier, France IMGT Locus on Focus A New
Chapter 2 Standardized Sequence and Structure Analysis of Antibody Using IMGT 1
Chapter 2 Standardized Sequence and Structure Analysis of Antibody Using IMGT 1 François Ehrenmann, Patrice Duroux, Véronique Giudicelli, and Marie-Paule Lefranc 2.1 Introduction IMGT 1, the international
IMGT/V-QUEST: the highly customized and integrated system for IG and TR standardized V-J and V-D-J sequence analysis
Published online 23 May 2008 Nucleic Acids Research, 2008, Vol. 36, Web Server issue W503 W508 doi:10.1093/nar/gkn316 IMGT/V-QUEST: the highly customized and integrated system for IG and TR standardized
T and B cell gene rearrangement October 17, Ram Savan
T and B cell gene rearrangement October 17, 2016 Ram Savan savanram@uw.edu 441 Lecture #9 Slide 1 of 28 Three lectures on antigen receptors Part 1 (Last Friday): Structural features of the BCR and TCR
GENETIC BASIS OF ANTIBODY STRUCTURE AND DIVERSITY. Steven J. Norris, Ph.D
GENETIC BASIS OF ANTIBODY STRUCTURE AND DIVERSITY Steven J. Norris, Ph.D Topics I. General principles II. The heavy chain Ig locus and VDJ rearrangement III. Light chain rearrangement. IV. Mechanisms of
بسم هللا الرحمن الرحيم. Today we're going to talk about the generation of diversity of the receptors of the lymphocytes
بسم هللا الرحمن الرحيم Today we're going to talk about the generation of diversity of the receptors of the lymphocytes The receptors of lymphocytes are : 1. B cells : immunoglobulins ; which are cell bound
Schaller et al. BMC Bioinformatics (2015) 16:252 DOI /s
Schaller et al. BMC Bioinformatics (2015) 16:252 DOI 10.1186/s12859-015-0687-9 SOFTWARE Open Access ImmunExplorer (IMEX): a software framework for diversity and clonality analyses of immunoglobulins and
IMMUNOGLOBULIN GENES UNDERGO TWO DNA REARRANGEMENTS
A Prototype Ig Gene: Murine Kappa About 10 0 V κ gene segments 4 J Gene Segment s 1 C κ Gene Segmen t Multiple V gene segments, distant from J and C A few J gene segments One C gene segment GERMLINE Ig
Immunoglobulins Harry W Schroeder Jr MD PhD
Immunoglobulins Harry W Schroeder Jr MD PhD Division of Developmental and Clinical Immunology Departments of Medicine, Microbiology, and Genetics University of Alabama at Birmingham Immunoglobulin Has
bioinformatics: state of art tools for NGS immunogenetics
bioinformatics: state of art tools for NGS immunogenetics Nikos Darzentas, Ph.D. CEITEC MU, Brno, Czech Republic bat.infspire.org nikos.darzentas@gmail.com Ministry of Health of theczech Republic, grant#
SPECIFICITY, DIVERSITY, AND IMMUNOGLOBULIN GENES
SPECIFICITY, DIVERSITY, AND IMMUNOGLOBULIN GENES ANTIBODY SPECIFICITY. This can be thought of in terms of the goodness of fit (affinity) between an antigenic determinant and a lymphocyte receptor or antibody.
Cloning of a hamster anti-mouse CD79B antibody sequences and identification of a new hamster immunoglobulin lambda constant IGLC gene region
Immunogenetics (2013) 65:473 478 DOI 10.1007/s00251-013-0698-5 BRIEF COMMUNICATION Cloning of a hamster anti-mouse CD79B antibody sequences and identification of a new hamster immunoglobulin lambda constant
LECTURE: 22 IMMUNOGLOBULIN DIVERSITIES LEARNING OBJECTIVES: The student should be able to:
LECTURE: 22 Title IMMUNOGLOBULIN DIVERSITIES LEARNING OBJECTIVES: The student should be able to: Identify the chromosome that contains the gene segments that encode the surface immunoglobulin heavy chain
Applications of the Ion AmpliSeq Immune Repertoire Assay Plus TCRβ
Applications of the Ion AmpliSeq Immune Repertoire Assay Plus TCRβ Timothy Looney, PhD Staff Scientist, Clinical Next-Generation Sequencing Division Thermo Fisher Scientific The world leader in serving
OmniAb. Naturally optimized human antibodies
OmniAb Naturally optimized human antibodies Transgenic animals for hmab discovery Only company to offer three platforms Patented technology with freedom to operate V L V H C C H 1 hinge C H 2 C H 3 2 28
Antibody Structure. Antibodies
Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against
Antibody Structure supports Function
Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against
Lecture 11: Gene Prediction
Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are
Immunology: Antibody Basics
e-learning JABSOM Immunology: Antibody Basics One :: General Structure Identify the Parts of an Antibody Two :: Isotypes Identify Antibody Isotypes Three :: Function Match Antibody Functions With Isotypes
Antibody Repertoires in Humanized NOD-scid-IL2Rc null Mice and Human B Cells Reveals Human-Like Diversification and Tolerance Checkpoints in the Mouse
Antibody Repertoires in Humanized NOD-scid-IL2Rc null Mice and Human B Cells Reveals Human-Like Diversification and Tolerance Checkpoints in the Mouse Gregory C. Ippolito 1, Kam Hon Hoi 2, Sai T. Reddy
B cell Epitopes CENTER FOR BIOLOGICAL SEQUENCE ANALYSIS. Technical University of Denmark - DTU Department of systems biology
B cell Epitopes Antibody Effect Virus or Toxin Antibodies Antibody Effect Virus or Toxin Antibodies Antibodies Antibodies Antibody - Antigen interaction Antigen Antibody Antibody - Antigen interaction
Lecture 3. Used anti B cell marker antibodies to deplete in mice
Lecture 3 V-Gene Rearrangement and Expression Used anti B cell marker antibodies to deplete in mice Rat anti mouse CD19, anti mouse B220, and anti mouse CD22. Mice were then injected with a secondary antibody
Disease and selection in the human genome 3
Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression
Year III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
1 Name. 1. (3 pts) What is apoptosis and how does it differ from necrosis? Which is more likely to trigger inflammation?
1 Name MCB 150 Midterm Eam #1 (100 points total) Please write your full name on each page of the eam!! The eam consists of 17 questions (6 pages). Each has a different point count as indicated. Please
Immunoglobulins: Structure and Function
Immunoglobulins: Structure and Function Immunoglobulins:Structure and Function Definition: Glycoprotein molecules that are produced by plasma cells in response to an immunogen and which function as antibodies
Immunological Techniques
Midterm Extra Office Hours Take Regular Office Hours: Tuesdays 11-12 Extra office hours: Wed, Feb 7 12-1pm Thurs, Feb 8 11am-12 Fri, Feb 9 2-4pm I WILL NOT BE HOLDING OFFICE HOURS ON TUESDAY Feb 13!! Dina,
Gene mutation and DNA polymorphism
Gene mutation and DNA polymorphism Outline of this chapter Gene Mutation DNA Polymorphism Gene Mutation Definition Major Types Definition A gene mutation is a change in the nucleotide sequence that composes
BIRKBECK COLLEGE (University of London)
BIRKBECK COLLEGE (University of London) SCHOOL OF BIOLOGICAL SCIENCES M.Sc. EXAMINATION FOR INTERNAL STUDENTS ON: Postgraduate Certificate in Principles of Protein Structure MSc Structural Molecular Biology
In vitro cultures of bone marrow stromal cells and progenitor B cells can accurately recapitulate the normal steps of B cell development.
Regular Office Hours: Tuesdays 11-12 Extra office hours: Wed, Feb 7 12-1pm Thurs, Feb 8 11am-12 Fri, Feb 9 2-4pm I WILL NOT BE HOLDING OFFICE HOURS ON TUESDAY Feb 13!! Dina, Tim, and I encourage all confused
B cell development The stages of B cell development
Regular Office Hours: Tuesdays 11-12 Extra office hours: Wed, Feb 7 12-1pm Thurs, Feb 8 11am-12 Fri, Feb 9 2-4pm I WILL NOT BE HOLDING OFFICE HOURS ON TUESDAY Feb 13!! Dina, Tim, and I encourage all confused
VIR.II: a new interface with the antibody sequences in the Kabat database
BioSystems 61 (2001) 125 131 www.elsevier.com/locate/biosystems VIR.II: a new interface with the antibody sequences in the Kabat database Maria del Carmen Ramirez-Benitez a, Gabriel Moreno-Hagelsieb b,
European guidelines for the universal description of Ig / TCR clonality testing data
December 13, 2011 3rd Scientific Meeting MolecularDiagnostics.be t Elzenveld, Antwerp European guidelines for the universal description of Ig / TR clonality testing data Anton W. Langerak Dept. of Immunology
PrimePCR Assay Validation Report
Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the
G+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.
1 Introduction 2 Chromosomes Topology & Counts 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 7 Codon usage 121 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures Introduction
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)
The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
Protein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
Hands-On Four Investigating Inherited Diseases
Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise
2/23/16. Protein-Protein Interactions. Protein Interactions. Protein-Protein Interactions: The Interactome
Protein-Protein Interactions Protein Interactions A Protein may interact with: Other proteins Nucleic Acids Small molecules Protein-Protein Interactions: The Interactome Experimental methods: Mass Spec,
HLA and Next Generation Sequencing it s all about the Data
HLA and Next Generation Sequencing it s all about the Data John Ord, NHSBT Colindale and University of Cambridge BSHI Annual Conference Manchester September 2014 Introduction In 2003 the first full public
Gene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
Antigen receptor (immunoglobulin and T-cell receptor) gene rearrangements: Utility in Routine Diagnostic Hematopathology
Antigen receptor (immunoglobulin and T-cell receptor) gene rearrangements: Utility in Routine Diagnostic Hematopathology DIAGNÓSTICO PRÁTICO DOS LINFOMAS São Paulo, Brasil 02 DE SETEMBRO DE 2011 Adam Bagg
Basic Antibody Structure. Multiple myeloma = cancerous plasma cells Monomer = 150,000. Chapter 4. Immunoglobulin Structure and Function
Chapter 4. Immunoglobulin Structure and Function. Functional Regions. Types of chains. Constant & Variable regions 4. Glycoprotein * * * Heavy chain= 446 aa Light chain= 4aa Each heavy and light chain
Application Note. NGS Analysis of B-Cell Receptors & Antibodies by AptaAnalyzer -BCR
Reduce to the Best Application Note NGS Analysis of B-Cell Receptors & Antibodies by AptaAnalyzer -BCR The software AptaAnalyzer harnesses next generation sequencing (NGS) data to monitor the immune response
Generation of Recombinant Antibodies and Means for Increasing Their Affinity
ISSN 0006-2979, Biochemistry (Moscow), 2010, Vol. 75, No. 13, pp. 1584-1605. Pleiades Publishing, Ltd., 2010. Original Russian Text E. P. Altshuler, D. V. Serebryanaya, A. G. Katrukha, 2010, published
Biotechnology Explorer
Biotechnology Explorer C. elegans Behavior Kit Bioinformatics Supplement explorer.bio-rad.com Catalog #166-5120EDU This kit contains temperature-sensitive reagents. Open immediately and see individual
TIGR THE INSTITUTE FOR GENOMIC RESEARCH
Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,
The HLA Community s Success in Combining Clinical & Genomic Data
The HLA Community s Success in Combining Clinical & Genomic Data Elizabeth Trachtenberg MS, PhD, DABHI Director, Center for Applied Genomics HLA/Immunogenetics Laboratory Children s Hospital & Research
A database of immunoglobulins with integrated tools: DIGIT
D1230 D1234 Nucleic Acids Research, 2012, Vol. 40, Database issue Published online 10 November 2011 doi:10.1093/nar/gkr806 A database of immunoglobulins with integrated tools: DIGIT Anna Chailyan 1, Anna
Chapter 2. Antibodies
Chapter 2. Antibodies An iddy-biddy antibody Just nanometers long Saved the butt of a sumo man Hundreds of kilos strong Anonymous The main elements of the immune system are firstly antibodies, secondly
www.lessonplansinc.com Topic: Gene Mutations WS Summary: Students will learn about frame shift mutations and base substitution mutations. Goals & Objectives: Students will be able to demonstrate how mutations
Genes and Proteins in Health. and Disease
Genes and Health and I can describe the structure of proteins All proteins contain the chemical elements Carbon, Hydrogen, Oxygen and Nitrogen. Some also contain sulphur. Proteins are built from subunits
A Public Database of Memory and Naive B- Cell Receptor Sequences
RESEARCH ARTICLE A Public Database of Memory and Naive B- Cell Receptor Sequences William S. DeWitt 1, Paul Lindau 2,3, Thomas M. Snyder 1, Anna M. Sherwood 1, Marissa Vignali 1, Christopher S. Carlson
Strategies for Assessment of Immunotoxicology in Preclinical Drug Development
Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Rebecca Brunette, PhD Scientist, Analytical Biology SNBL USA Preclinical Immunotoxicology The study of evaluating adverse effects
Bio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
TRIg: a robust alignment pipeline for nonregular T-cell receptor and immunoglobulin sequences
Hung et al. BMC Bioinformatics (2016) 17:433 DOI 10.1186/s12859-016-1304-2 SOFTWARE Open Access TRIg: a robust alignment pipeline for nonregular T-cell receptor and immunoglobulin sequences Sheng-Jou Hung
Thr Gly Tyr. Gly Lys Asn
Your unique body characteristics (traits), such as hair color or blood type, are determined by the proteins your body produces. Proteins are the building blocks of life - in fact, about 45% of the human
Transcription. Unit: DNA. Central Dogma. 2. Transcription converts DNA into RNA. What is a gene? What is transcription? 1/7/2016
Warm Up Questions 1. Where is DNA located? 2. Name the 3 parts of a nucleotide. 3. Enzymes can catalyze many different reactions (T or F) 4. How many variables should you have in an experiment? 5. A red
Fig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
Citation. As Published Publisher. Version. Accessed Sun Feb 18 15:02:00 EST 2018 Citable Link Terms of Use. Detailed Terms
Immunoglobulin light chain (IgL) genes in zebrafish: Genomic configurations and inversional rearrangements between (V[subscript L] J[subscript L C[subscript L) The MIT Faculty has made this article openly
Chapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
Review of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
Electronic Supplementary Information
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane
Codon Bias with PRISM. 2IM24/25, Fall 2007
Codon Bias with PRISM 2IM24/25, Fall 2007 from RNA to protein mrna vs. trna aminoacid trna anticodon mrna codon codon-anticodon matching Watson-Crick base pairing A U and C G binding first two nucleotide
Multiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
Introduction to the UCSC genome browser
Introduction to the UCSC genome browser Dominik Beck NHMRC Peter Doherty and CINSW ECR Fellow, Senior Lecturer Lowy Cancer Research Centre, UNSW and Centre for Health Technology, UTS SYDNEY NSW AUSTRALIA
CS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS
1 CS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS * Some contents are adapted from Dr. Jean Gao at UT Arlington Mingon Kang, PhD Computer Science, Kennesaw State University 2 Genetics The discovery of
An introduction to genetics and molecular biology
An introduction to genetics and molecular biology Cavan Reilly September 5, 2017 Table of contents Introduction to biology Some molecular biology Gene expression Mendelian genetics Some more molecular
Towards detection of minimal residual disease in multiple myeloma through circulating tumour DNA sequence analysis
Towards detection of minimal residual disease in multiple myeloma through circulating tumour DNA sequence analysis Trevor Pugh, PhD, FACMG Princess Margaret Cancer Centre, University Health Network Dept.
MATH 5610, Computational Biology
MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class
DNA Structure & the Genome. Bio160 General Biology
DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:
You use the UCSC Genome Browser (www.genome.ucsc.edu) to assess the exonintron structure of each gene. You use four tracks to show each gene:
CRISPR-Cas9 genome editing Part 1: You would like to rapidly generate two different knockout mice using CRISPR-Cas9. The genes to be knocked out are Pcsk9 and Apoc3, both involved in lipid metabolism.
Peptide libraries: applications, design options and considerations. Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST
Peptide libraries: applications, design options and considerations Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST Overview 1 2 3 4 5 Introduction Peptide library basics Peptide library design considerations
Human Germline Antibody Gene Segments Encode Polyspecific Antibodies
Human Germline Antibody Gene Segments Encode Polyspecific Antibodies Jordan R. Willis 1,2,3, Bryan S. Briney 4, Samuel L. DeLuca 1,2,3, James E. Crowe, Jr. 4,5 *, Jens Meiler 1,2,3,6 * 1 Center for Structural
Human KIR sequences 2003
Immunogenetics (2003) 55:227 239 DOI 10.1007/s00251-003-0572-y ORIGINAL PAPER C. A. Garcia J. Robinson L. A. Guethlein P. Parham J. A. Madrigal S. G. E. Marsh Human KIR sequences 2003 Received: 17 March
Lecture 2: Central Dogma of Molecular Biology & Intro to Programming
Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Central Dogma of Molecular Biology Proteins: workhorse molecules of biological systems Proteins are synthesized from the genetic blueprints
Not all mutations result in a change to the amino acid sequence of the encoded polypeptide
Q1.(a) (i) A mutation of a tumour suppressor gene can result in the formation of a tumour. Explain how. (2) (ii) Not all mutations result in a change to the amino acid sequence of the encoded polypeptide.
Annotating 7G24-63 Justin Richner May 4, Figure 1: Map of my sequence
Annotating 7G24-63 Justin Richner May 4, 2005 Zfh2 exons Thd1 exons Pur-alpha exons 0 40 kb 8 = 1 kb = LINE, Penelope = DNA/Transib, Transib1 = DINE = Novel Repeat = LTR/PAO, Diver2 I = LTR/Gypsy, Invader
1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular
![strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular](/thumbs/72/66361212.jpg "strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular")
Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain
Bi 8 Lecture 7. Ellen Rothenberg 26 January Reading: Ch. 3, pp ; panel 3-1
Bi 8 Lecture 7 PROTEIN STRUCTURE, Functional analysis, and evolution Ellen Rothenberg 26 January 2016 Reading: Ch. 3, pp. 109-134; panel 3-1 (end with free amine) aromatic, hydrophobic small, hydrophilic
HLA Nomenclature. Steven GE Marsh. Anthony Nolan Research Institute London
HLA Nomenclature Steven GE Marsh Anthony Nolan Research Institute London Number of HLA Alleles June 2007 HLA-A HLA-B HLA-C 574 (24) 920 (49) 311 (9) HLA-E HLA-F HLA-G 9 21 28 HLA-DRA HLA-DRB HLA-DQA1 HLA-DQB1
PrimePCR Assay Validation Report
Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha
From DNA to Protein Structure and Function
STO-106 From DNA to Protein Structure and Function Teacher information Summary: Students model how information in the DNA base sequences is transcribed and translated to produce a protein molecule. They
Protein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
MOLECULAR RECOGNITION
MOLECULAR RECOGNITION Bioanalytical Methods Classification 1. Biassay: molecular recognition, signal generation and detection in solution or on inert solid phase 2. Biosensor: molecular recognition system
Cooperative Patent Classification at the USPTO
Cooperative Patent Classification at the USPTO Jerry Lorengo - Director Technology Center 1600 Organic Chemistry & Biotechnology PIUG Biotech Conference San Francisco, CA Feb 2015 Overview CPC Milestones
Guided tour to Ensembl
Guided tour to Ensembl Introduction Introduction to the Ensembl project Walk-through of the browser Variations and Functional Genomics Comparative Genomics BioMart Ensembl Genome browser http://www.ensembl.org
8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
Immunoglobulin genes and diversity: what we have learned from domestic animals
Sun et al. Journal of Animal Science and Biotechnology 2012, 3:18 JOURNAL OF ANIMAL SCIENCE AND BIOTECHNOLOGY REVIEW Open Access Immunoglobulin genes and diversity: what we have learned from domestic animals
Introduction to Proteins
Introduction to Proteins Lecture 4 Module I: Molecular Structure & Metabolism Molecular Cell Biology Core Course (GSND5200) Matthew Neiditch - Room E450U ICPH matthew.neiditch@umdnj.edu What is a protein?
Higher Human Biology. Unit 1: Human Cells
Calderglen High School Higher Human Biology Unit 1: Human Cells Homework Questions Contents Page Sub-Topic 1: Differentiation and stem cells 3-5 Sub-Topic 2: DNA and its replication 6-10 Sub-Topic 3: RNA,
Transcription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
Central Dogma. 1. Human genetic material is represented in the diagram below.
Central Dogma 1. Human genetic material is represented in the diagram below. 4. If 15% of a DNA sample is made up of thymine, T, what percentage of the sample is made up of cytosine, C? A) 15% B) 35% C)