Supplementary Materials for

Size: px

Start display at page:

Download "Supplementary Materials for"

Diana Barton
6 years ago
Views:

www.sciencemag.org/cgi/content/full/science.

1 Supplementary Materials for Cyclic GMP-AMP Synthase Is an Innate Immune Sensor of HIV and Other Retroviruses Daxing Gao, Jiaxi Wu, You-Tong Wu, Fenghe Du, Chukwuemika Aroh, Nan Yan, Lijun Sun, Zhijian J. Chen* This PDF file includes: *Corresponding author. Materials and Methods Figs. S1 to S7 References Published 8 August 2013 on Science Express DOI: /science

2 Materials and Methods Cells, Antibodies, Nucleotides, Chemical Inhibitors and General Methods L929 and Human Embryonic Kidney 293T (HEK293T) cells were cultured in DMEM (Sigma) supplemented with 10% calf serum and antibiotics. Trex1 -/- mouse embryonic fibroblasts (MEF) were cultured in DMEM supplemented with 20% fetal bovine serum and antibiotics. THP-1 cells were cultured in RPMI containing 10% fetal bovine serum, antibiotics, nonessential amino acids, and 50 μm of β-mercaptoethanol. The rabbit polyclonal antibodies against human STING were generated and affinity purified as described previously (22). Antibodies against human and murine IRF3 were from Santa Cruz Biotechnology and Invitrogen, respectively. GFP antibody was from Covance. Antibodies against tubulin and h-cgas were from Sigma. p-stat1 (Tyr701) antibody was from Cell Signaling. Cyclic GMP-AMP (cgamp) was enzymatically synthesized using cgas in vitro and purified as previously described (23, 24). Polybrene, poly(i:c) and herring testis (HT)- DNA were from Sigma. Poly(I:C) and HT-DNA were transfected into cells using Lipofectamine TM 2000 (Invitrogen). HIV reverse transcriptase inhibitors azidothymidine (AZT), nevirapine (NVP), didanosine (DDI) and integrase inhibitor raltegravir(ral) were from Selleckchem. IRF3 Dimerization Assay and Quantitative Real Time PCR 2

3 The procedures for native gel electrophoresis for detection of IRF3 dimerization, SDS polyacrylamide gel electrophoresis (SDS-PAGE), and Western blotting have been described previously(25). Reverse transcription and real-time PCR reactions were carried out using iscript cdna synthesis kit and iq SYBR Green Supermix (Bio-Rad) (26). qpcr was performed on an Applied Biosystems Vii7 using the following primers: Gene Forward Primer Reverse Primer GAPDH ATGACATCAAGAAGGTGGTG CATACCAGGAAATGAGCTTG CXCL10 TGGCATTCAAGGAGTACCTC TTGTAGCAATGATCTCAACACG IFN-β AGGACAGGATGAACTTTGAC TGATAGACATTAGCCAGGAG STING ACTGTGGGGTGCCTGATAAC TGGCAAACAAAGTCTGCAAG cgas GGGAGCCCTGCTGTAACACTTCTTAT CCTTTGCATGCTTGGGTACAAGGT MTND1 ATGGCCAACCTCCTACTCCT GCGGTGATGTAGAGGGTGAT RPL19 AAATCGCCAATGCCAACTC TCTTCCCTATGCCCATATGC mifn-β TCCGAGCAGAGATCTTCAGGAA TGCAACCACCACTCATTCTGAG msting AAATAACTGCCGCCTCATTG TGGGAGAGGCTGATCCATAC mcxcl10 GCCGTCATTTTCTGCCTCA CGTCCTTGCGAGAGGGATC mtrex1 CACATGCTGCCACAGCTACT GGCCAGGAAGAGTCCATACA mcgas ACCGGACAAGCTAAAGAAGGTGCT GCAGCAGGCGTTCCACAACTTTAT HIV-GAG GGCAAGAGTTTTGGCTGAAG CACATTTCCAACAGCCCTTT RNA Interference The lentiviral vector, pty-shrna-ef1a-puro, and the method for generating stable knockdown and rescue cell lines were described previously (22, 23, 27). The target sequences of shrna are as follows (only sense strand sequence is shown): Luciferase: AACTTACGCTGAGTACTTCGA; TREX1: GATCACAGGTCTGAGCAAA; m-cgas: GGATTGAGCTACAAGAATA; h-cgas: GGAAGGAAATGGTTTCCAA; msting: CGAAATAACTGCCGCCTCA; hsting: GCACCTGTGTCCTGGAGTA. sirna oligos were purchased from Sigma and transfected into cells using Lipofectamine The sense strand sequences are: 3

4 Control: GCCUAGAUCCUGUGCUUUAdTdT; m-cgas: GGAUUGAGCUACAAGAAUAdTdT; msting: CGAAAUAACUGCCGCCUCAdTdT Virus Preparation and Infection Viral infection experiments at biosafety levels 2 and 2 + were approved by the Environmental Health and Safety Committee at UT Southwestern Medical Center. HIV-1 BaL strain was obtained from NIH AIDS Reagent Program and titered by p24 capsid ELISA (Perkin Elmer). Plasmids for HIV-GFP and VSV-G had been described previously (28). SIV-GFP, MLV-GFP and MLV-Gag-Pol plasmids were kindly provided by Joe Sodroski (Dana Farber Cancer Institute). SIV3+ plasmid was kindly provided by Nathaniel Landau (New York University). Each retroviral plasmid was co-transfected with the VSV-g plasmid into HEK293T cells for 24 h before the culture media were replaced with fresh media. Supernatants containing the viruses were harvested and filtered (0.45 μm pore size) in three batches every 12 h starting at 24h after replacement of media. Viral supernatants were concentrated by PEG8000 precipitation. Viral supernatants with final concentration of 5% PEG8000, 0.15M NaCl were incubated at 4 overnight and centrifuged at 2000g for 20 min. Pellets were resuspended in fresh media as the virus stock. The titers of each retrovirus were measured using L929 (for mouse cell experiments) or HEK293T cells (for human cell experiments) by flow cytometry analysis of GFP + cells 24 h after infection in the presence of 10 µg/ml polybrene. 4

5 To measure HIV episomal DNA, viral stocks were pretreated with Turbo DNase by following manufacturer s protocol (TURBO DNA-free Kit, life technologies). Episomal DNA was purified by PureLink Quick Plasmid Miniprep Kit (Invitrogen) and quantified by qpcr. Mitochondrial NADH dehydrogenase subunit 1 (MTND1) gene was used as the internal control. Sendai virus (Cantell strain, Charles River Laboratories) was used at a final concentration of 50 hemagglutinating units/ml. HIV Infection in Primary Human cells Experiments involving human materials were approved by the Institutional Review Boards of UT Southwestern Medical Center. Human bloods from anonymous donors were obtained from the Carter BloodCare at Dallas. CD14 + monocytes were isolated from fresh peripheral blood mononuclear cells (PBMCs) using positive selection (Miltenyi Biotec). Monocyte-derived macrophages (MDMs) were generated by plate selection followed by 5-7 days stimulation with 50 ng/ml of M-CSF (R&D Systems). Monocyte-derived dendritic cells (MDDCs) were generated by 4-5 days stimulation with 10 ng/ml of GM-CSF and 10 ng/ml of IL-4 (R&D Systems). Approximately 1 to 5 million MDMs or MDDCs were used in each infection experiment. Vpx-VLP was generated using the SIV3 + plasmid as described(29). MDMs and MDDCs were infected with 100 ng p24 HIV-BaL or HIV-GFP virus, respectively, per 1 million cells. Percentage of infected MDMs and MDDCs was determined by FACS using p24-fitc antibody (Beckman Coulter) and GFP as the fluorescent marker, respectively. 5

6 In vitro Assay for cgamp activity The cgamp activity assay was performed as described previously with some modifications(30). Briefly, cells were infected with HIV-GFP or transfected with HT- DNA and then homogenized by douncing in the hypotonic buffer [10mM Tris-HCl, ph7.4, 10mM KCl, 1.5mM MgCl 2 ]. The homogenate was centrifuged at 100,000 rpm for 5 min, then the supernatant was heated at 95 C for 5 min and centrifuged again at 12,000 rpm for 5 min to remove denatured proteins. The heat-resistant supernatant was mixed with 10 6 THP-1 or Raw264.7 cells in an 8μl reaction containing 2 mm ATP, 1 U/μl Benzonase and 1.5 ng/μl PFO. The mixture was incubated at 30 C for 1.5 hr. Cells in the reaction were lysed by adding 0.2% NP40 and subjected to native gel electrophoresis. IRF3 dimerization was detected by immunoblotting with an IRF3 antibody. For in vitro stimulation of cgas by HIV DNA, HEK293T cells were infected with HIV- GFP (MOI = 4) for 20 h. Cytosolic extracts (8 μg) were incubated with purified human cgas protein (50 ng) in a reaction volume of 10 μl at 37 o C for 20 min. The reaction was terminated by heating at 95 o C for 5 min, and then cgamp activity in the heat-resistant supernatant was measured after its delivery into PFO permeabilized THP1 cells. Mass Spectrometry Tandem MS/MS analysis and targeted quantification of 2 3 -cgamp from HIV infected cells was conducted on a Dionex Ultimate 3000 nanolc system coupled to a Q-Exactive mass spectrometer (ThermoFisher Scientific). The LC conditions and ion source 6

7 parameters have been described before(24, 30). MS/MS spectra (resolution: 70,000 at m/z = 200) were acquired in a targeted-ms 2 mode in which the precursor ion of cgamp ([M+H]+, m/z = ) was specifically fragmented by higher energy collision dissociation (HCD). The Normalized Collision Energy (NCE) for HCD was set to 25. The relative abundance of cgamp was represented by the intensity of a product ion (m/z= ) that is unique and prominent in the MS/MS spectrum of 2 3 -cgamp. Generation of cgas knockout L929 cells by TALEN TALEN constructs were designed using the free online tool Mojo Hand ( and assembled using the Golden Gate TALEN and TAL Effector Kit (Addgene cat# ), according to published protocols (31). The TALEN constructs were designed to target exon 2 of the mouse cgas genomic locus, which encodes most of the catalytic domain of cgas (residues ). Assembled TALENs were transfected into L929 cells using Lipofectamine TM 2000 (Invitrogen) and the cells were then maintained at 30, 5% CO2 for 3 days before splitting to isolate single colonies. The single cell clone screening was performed as previously described(31). Briefly, genomic DNA was extracted from each cell clone, and DNA fragments flanking the TALEN target sites were amplified using specific primers (5 primer: TTGAGGGCCTCTACAAGGTG, 3 primer: GGGTCAGAGGAAATCAGCAG). The PCR product was then digested with PmeI and resolved on 2% agarose gel. Resistance to digestion indicates that deletions had occurred at the PmeI sites, thus single cell clones containing the uncleavable DNA were expanded for further analyses. DNA sequencing was performed after TA cloning of DNA from 7

8 each single cell clone. More than 12 TA cloned plasmids for each single cell clone were sequenced. 8

9 Figure S1. HIV-GFP virus induces innate immune responses in THP1 cells. (A) THP1 cells were infected with VSV-g pseudotyped HIV-GFP virus at MOI = 2 for the indicated time, then cell extracts were analyzed by native gel electrophoresis or SDS- PAGE followed by immunoblotting with the indicated antibodies. (B) Similar to A, 9

10 except that total RNA was isolated for q-rt-pcr. (C) THP1 cells were infected with HIV-GFP for the indicated time, and then episomal DNA was isolated to measure the viral GAG expression by qpcr. (D) THP1 cells were infected with HIV-GFP at the indicated MOI, and then IFNβ RNA was measured by q-rt-pcr. (E) THP1 cells were infected with HIV-GFP virus, which was pretreated with Turbo DNase or mock treated. IFNβ and IFIT1 RNA levels were measured by q-rt-pcr. (F) Similar to (E), except that HT-DNA was treated with Turbo DNase or mock treated before being used to transfect THP1 cells. (G and H) THP-1 cells were treated with or without PMA for 24h, replaced with fresh medium for 12h and infected with HIV-GFP (MOI=0.5) for 21h. Cells were collected for FACS analysis (G) and IFNβ RNA levels were measured by q-rt-pcr (H). 10

11 Figure S2. HIV-GFP virus induces innate immune responses through the cgas- STING pathway (A-C) THP1 cells were treated with inhibitors of HIV reverse transcriptase (AZT and NVP) or integrase (RAL) at the indicated concentrations, then transfected with HT-DNA or infected with HIV-GFP. Total RNA was isolated to measure IFNβ RNA levels by q- RT-PCR. (D) THP1 cells stably expressing an shrna against cgas, STING or luciferase (control) were infected with HIV-GFP for the indicated time, followed by measurement of CXCL10 RNA by q-rt-pcr. (E) THP1 cells expressing an shrna against STING or luciferase were infected with HIV-GFP and then cell extracts were analyzed by immunoblotting with the indicated antibodies. (F) THP1 cells expressing an shrna against cgas or luciferase were stimulated with cgamp or HT-DNA and then IFNβ RNA levels were measured by q-rt-pcr. Error bars indicate standard deviations of triplicate measurements. 11

12 Figure S3. HIV-GFP virus induces innate immune responses in TREX1-deficient MEF cells. Trex1 -/- MEF cells stably expressing shrna against mouse cgas, STING or luciferase were analyzed for the knockdown efficiency by q-rt-pcr (A and B). These cells were infected with HIV-GFP (MOI=2) for 20 h or transfected with poly[i:c] for 6 h, then total RNA was isolated to measure the expression of IFNβ (C) or CXCL10 (D) by q- RT-PCR. N.D: non-detectable. Error bars indicate standard deviations of triplicate experiments. 12

above the TALEN target sequence in exon 2.

13 Figure S4. Generation and characterization of L929 cgas mutant cells using the TALEN technology. (A) Mouse cgas genomic DNA organization is shown above the TALEN target sequence in exon 2. The pairs of amino acids in TALEN nuclease that recognize each nucleotide in the target sequence are shown on the bottom. (B) 13

14 Sequencing results depicting the deletion of nucleotides within cgas exon 2 of each chromosome are shown for three cloned cell lines. (C) cgas WT and mutant cell lines were transfected with HT-DNA or poly[i:c] for the indicated time, followed by measurement of IRF3 dimerization. (D) cgas WT and mutant cell lines were transfected with HT-DNA or mouse cgas expression plasmid, then total RNA was isolated to measure CXCL10 expression by q-rt-pcr. (E and F) L929 and the cgas KO clone #18 were stably transfected with an shrna against TREX1 or luciferase (control). The RNA levels of cgas, STING and TREX1 in these cells were measured by q-rt-pcr. Error bars indicate standard deviations of triplicate measurements. 14

15 Figure S5. HIV retroviral DNA induces cgamp activity in THP1 cells and in vitro (A) HEK293T or THP1 cells were infected with HIV-GFP or Sendai virus, then cell lysates were immunoblotted with the indicated antibodies. (B) HEK293T or THP1 cells were infected with HIV-GFP for 24 h, then cell extracts were treated at 95 o C for 5 min to prepare cgamp-containing supernatant, which was delivered into PFO-permeabilized THP1 cells followed by IRF3 dimerization assay. HT-DNA was transfected into THP1 cells to generate cgamp as a positive control. (C) HEK293T cells were pretreated with the RT inhibitor AZT (5 μm, 30 min) or mock treated before infection with HIV-GFP (MOI = 4) for 20 h. Cytosolic extracts were incubated with purified human cgas protein to produce cgamp, whose activity to stimulate IRF3 was measured after its delivery into THP1 cells. (D) DNA in the cytosolic extracts shown in (C) were extracted and amplified by PCR using specific primers of the indicated genes and then analyzed by agarose gel electrophoresis. In lane 5, total DNA in HEK293T cells was used as the template for PCR. MTND1: mitochondrial NADH dehydrogenase subunit 1. GAPDH: glyceraldehyde 3-phosphate dehydrogenase. In lane 2-4, only trace amounts of the mitochondrial DNA (MTND1) and nuclear DNA (GAPDH) are detected in the cytosolic extracts. (E) Proteins in the cytosolic extracts shown in (C) were immunoblotted with the indicated antibodies. 15

16 Figure S6. HIV infection in primary immune cells from human donors (A) Monocyte-derived macrophages (MDM) from human donor #1 were pretreated with Vpx-VLP or not for 1 day before infection with HIV-BaL for 3 days. FACS analysis of HIV-1 capsid (p24) was performed to determine the efficiency of infection. (B) Similar to (A), except that monocyte-derived dendritic cells (MDDC) were infected with HIV-GFP for 1 day, and FACS analysis of GFP was performed. (C) Cell extracts of 5 million MDDCs uninfected or infected with HIV-GFP as shown in (B) were heated at 95 o C for 5 min, and the heat-resistant supernatant was fractionated by HPLC using a C18 column. cgamp abundance was measured by mass spectrometry using SRM. As a positive control, 500 fmol cgamp was spiked into HEK293T cell extracts and processed in parallel. (D) Similar to (B), except that MDDCs from human donors #2 and #3 were infected with HIV-GFP for 2 days. (E) Heat-resistant supernatant from MDDCs infected with HIV-GFP as shown in (D) were assayed for cgamp activity after its delivery into THP1 cells. (F) MDMs from human donor #4 were treated with Vpx and infected with HIV-BaL as indicated and the cgamp activity in the heat-resistant supernatant was measured. 16

17 Figure S7. cgas and STING mediate IFNβ induction by MLV and SIV. (A-C) Trex1 -/- MEF cells were transfected with indicated sirna to knock down endogenous cgas or STING as verified by q-rt-pcr (A and B). These cells were infected with MLV-GFP (MOI = 2) for 20 h and then IFNβ RNA was measured by q-rt-pcr (C). (D) Trex1 -/- MEF cells stably expressing shrna against mouse cgas, STING or luciferase were infected with SIV-GFP (MOI = 1) for 20 h. IFNβ RNA was measured by q-rt- PCR. ND: not detectable. Error bars indicate standard deviations of triplicate measurements. 17

18 References 22. Y. Tanaka, Z. J. Chen, STING Specifies IRF3 Phosphorylation by TBK1 in the Cytosolic DNA Signaling Pathway. Sci Signal 5, ra20 (2012). 23. L. Sun, J. Wu, F. Du, X. Chen, Z. J. Chen, Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science 339, 786 (Feb 15, 2013). 24. X. Zhang et al., Cyclic GMP-AMP Containing Mixed Phosphodiester Linkages Is An Endogenous High-Affinity Ligand for STING. Molecular cell, (Jun 3, 2013). 25. R. B. Seth, L. Sun, C. K. Ea, Z. J. Chen, Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3. Cell 122, 669 (Sep 9, 2005). 26. Y. H. Chiu, J. B. Macmillan, Z. J. Chen, RNA polymerase III detects cytosolic DNA and induces type I interferons through the RIG-I pathway. Cell 138, 576 (Aug 7, 2009). 27. J. He, A. T. Nguyen, Y. Zhang, KDM2b/JHDM1b, an H3K36me2-specific demethylase, is required for initiation and maintenance of acute myeloid leukemia. Blood 117, 3869 (Apr 7, 2011). 28. N. Yan, A. D. Regalado-Magdos, B. Stiggelbout, M. A. Lee-Kirsch, J. Lieberman, The cytosolic exonuclease TREX1 inhibits the innate immune response to human immunodeficiency virus type 1. Nature immunology 11, 1005 (Nov, 2010). 29. N. Laguette et al., SAMHD1 is the dendritic- and myeloid-cell-specific HIV-1 restriction factor counteracted by Vpx. Nature 474, 654 (Jun 30, 2011). 30. J. Wu et al., Cyclic GMP-AMP is an endogenous second messenger in innate immune signaling by cytosolic DNA. Science 339, 826 (Feb 15, 2013). 31. T. Cermak et al., Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Nucleic Acids Res 39, e82 (Jul, 2011). 18

Pre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression

Pre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression LVP336 LVP336-PBS LVP339 LVP339-PBS LVP297 LVP297-PBS LVP013 LVP013-PBS LVP338 LVP338-PBS LVP027 LVP027-PBS LVP337 LVP337-PBS