Isolation and Characterization of a Biosurfactant Producing Strain Pseudomonas Aeruginosa SMVIT 1 from Oil Contaminated Soil

Size: px

Start display at page:

Download "Isolation and Characterization of a Biosurfactant Producing Strain Pseudomonas Aeruginosa SMVIT 1 from Oil Contaminated Soil"

Archibald Hunter
6 years ago
Views:

1 Journal of Scientific & Industrial Research Vol. 75, November 2016, pp Isolation and Characterization of a Biosurfactant Producing Strain Pseudomonas Aeruginosa SMVIT 1 from Oil Contaminated Soil K Rath*, A B Singh, S Chandan and R S Vatsala Department of Biotechnology, Sir M Visvesvaraya Institute of Technology, Hunsmaranahalli, new airport road, Bangalore, Karnataka, India Received 21 July 2015; revised 19 March 2016; accepted 16 August 2016 The increasing demand of surfactant derived products, typically those based on biosurfactant has led to wide research in this area. This paper aims at isolation, molecular characterization and potential applications of a novel biosurfactant producing strain from oil spilled sample of Sir MVIT petrol bunk. Five different carbon sources were studied and the isolated strain showed better biosurfactant production in soybean oil (1.8 g/l) and hence was used as the sole carbon source for the entire experiment. The isolate was identified as Pseudomonas aeruginosa SMVIT 1 and phylogenetic analysis was performed using Clustal W2. Biosurfactant activity assays were performed using emulsification measurement, drop collapsing and oil displacement test. Structural and functional analysis was done using FTIR and GC-MS and indicated rhamnolipid nature of the biosurfactant. The isolated strain or the extracted biosurfactant can be used directly or as an immobilised system for bioremediation specifically in oil spill treatment. Keywords: Pseudomonas Aeruginosa SMVIT 1, Isolation, Soybean Oil, Glycolipid Type Biosurfactant, Oil Removal Introduction Oil spill is the release of oil into the environment at a large scale due to accidental oil leakage, oily storm water drainage from untreated waste disposal from factories and industries, cities and agricultural fields and unregulated recreational boating that are befouling our environment. Some oils have property to evaporate, emulsify, disperse, weather and decompose. Therefore the fate of oil residues persisting in the environment depends on the spilled oil's composition, volume, properties, and climatic conditions. The effect of oil pollution can be majorly detected in natural waterways and soil. Spilled oil comprising of several polycyclic aromatic compounds and hydrocarbons can deteriorate quality of soil by changing its ph, texture, chemical and physiological properties making it inappropriate for cultivation and if entered into ground water making it unsuitable for drinking 1-3. The oil spill and its effect can also be experienced in marine ecosystem which forms a layer on the surface of water thus obstructing the penetration of sunlight leading to hazardous impact on marine life 4,5. Bioremediation is an effective, safe and eco-friendly technique to clean up the oil spill 6. But *Author for Correspondence E- mail: kalyani2rath@gmail.com the microbial degradation activity is limited due to low solubility of hydrophobic hydrocarbon in water contributing to its prolonged persistence in environment 7,8. Therefore approaches have been made by employing synthetic surfactants or biosurfactants to enhance the biodegradation of these hydrophobic hydrocarbons 7,9,10. Biosurfactants are the biological surface active agents produced by bacteria, yeast and fungi. These can be mainly categorized as glycolipids, lipopeptides, fatty acid salts, phospholipids, and polymeric biosurfactants on the basis of their chemical composition 11,12. These amphiphilic compounds exhibit unique properties which includes ability to reduce surface tension and interfacial tensions between different molecules, biodegradability, low toxicity, structural diversity, high specificity, low critical micelle concentration and their effectiveness in wide range of extreme conditions including temperature, ph and salinity Synthetic approaches are not preferred due to their recalcitrant nature making it unsuitable for bioremediation applications 10,20. Therefore increasing environmental concerns has led to the advances in biotechnology that has created biosurfactants as a potential alternative to the chemical surfactants This paper presents the isolation of a novel bacterial strain from oil spill soil sample collected from sir

2 682 J SCI IND RES VOL 75 NOVEMBER 2016 MVIT petrol bunk. Isolated bacterial strain was identified as Pseudomonas aeroginosa SMVIT 1. Crude biosurfactant was investigated for its key components. Finally biosurfactant activity assay, production kinetics on different carbon sources and oil spill removal ability was evaluated. Materials and Methods Materials Chemicals required for this study were tryptone, yeast extract, NaCl, NaNO 3, KH 2PO 4, MgSO 4.7H 2O, HCl and ethyl acetate. Tryptone and yeast extract were purchased from Himedia and soybean oil was purchased locally. Rest of the chemicals were of analytical grade and obtained from Merck, Germany. All the reactions were carried out by using double distilled water. Oil spill soil sample was collected from Sir MVIT petrol bunk, Bangalore. Isolation of biosurfactant producing microorganism Oil spill sample collected from Sir MVIT petrol bunk was used as the natural source to screen biosurfactant producing microorganism. Seed culture was prepared using seed culture medium containing (g/l): 10 tryptone, 5 yeast extract, 10 NaCl and incubated in shaking incubator for 4 days at 121 rpm at 33 C. 1 ml of seed culture was inoculated into 50 ml of production medium constituting of (g/l): 3 NaNO 3, 0.25 KH 2PO 4, 0.25 MgSO 4.7H 2O, 1 yeast extract and 10 soybean oil used as the sole carbon source 23, followed by incubation in the shaking incubator for 6 days at 120 rpm at 33 C. Biosurfactant production efficiency was checked on different carbon sources. Isolation of single colony was obtained using streak plate method and agar slant and examined for their ability to produce biosurfactant. Biosurfactant extraction and activity assay Acid precipitation technique and solvent extraction method were used to obtain crude biosurfactant. Cells were removed after six days of incubation from the culture broth by centrifugation at 10,000 rpm for 15 minutes at 4 C. The cell free supernatant were incubated overnight at 4 C by adjusting the ph at 2 and acidified with 6 N HCl. The precipitate was collected by centrifugation (18,000 rpm, 30 min, 4 C) and vigorously shaken with ethyl acetate. The solvent was allowed to evaporate completely at room temperature. The crude biosurfactant was recovered as a viscose brown coloured material. The biosurfactant activity assays for the isolate was done by the following methods. Drop collapsing test Drop collapsing test is a sensitive and rapid method for screening of bacterial colonies that have ability to produce biosurfactant. In this test, 96-well microtiter plate lid was taken and two micro litres of mineral oil was added to each well. 5 μl of the culture supernatant was added to the surface of oil and analysed for the drop shape. Flat drops were scored as positive'+' and round drops were scored as negative '-', for the biosurfactant production respectively. Emulsification measurement The emulsification activity is defined as the height of the emulsion layer divided by the total height, expressed as percentage. Emulsification activity was measured according to the method of Cooper and Goldenberg. To 4 ml of culture supernatant or biosurfactant crude extract (0.5%, w/v), 4 ml of diesel were added and vortexed at high speed. The mixture was allowed to stand for 10 minutes prior to measurement. Oil displacement test Oil displacement test is a method of determining the surface activity of the biosurfactant by measuring clear zone diameter. 15μl of weathered crude oil was placed on the surface of distilled water (40μl) in a petridish (150 mm in diameter). 10μl of the culture supernatant was gently put on the centre of the oil film. The diameter and area of clear halo visualized under visible light were measured and calculated after 30 seconds. Molecular identification of isolated strain and phylogenetic analysis 16S rrna gene sequencing analysis was done for the identification of the isolated bacterial strain. DNA sequencing was done using Sanger s dideoxynucleotide chain termination method. Universal primer sets used for the PCR amplification were 27 F and 1492 R. Primer set used for sequencing were 518 F and 800 R. Base pair composition of the primer sets used is presented in table 1. PCR amplification was carried out in thermocycler using DNA template 0.5 µl, Taq DNA polymerase buffer (10 x) 2.5 µl, dntps (2 mm) 2.5 µl, Taq polymerases (5U/µl) 0.2 µl, forward primer (10µM) 0.5 µl, reverse primer (10 µm) 0.5 µl and double distilled water 18.3 µl. PCR amplification was performed as follows:

3 RATH et al.: ISOLATION AND CHARACTERIZATION OF BIOSURFACTANT STRAIN 683 Table-1 PCR and Sequencing primer annealing region. PCR primer set Sequence 27 F 5 AGAGTTTGATCMTGGCTCAG R 5 TACGGYTACCTTGTTACGACTT3 Sequencing primer set Sequence 518 F 5 CCAGCAGCCGCGGTAATACG3 800 R 5 TACCAGGGTATCTAATCC3 initial denaturation 95 C for 5 minutes, followed by 25 cycles each of 94 C for 45 seconds, 55 C of annealing for 45 seconds and 1 minute extension at 72 C. The purification of the PCR products was performed using MACHEREY NAGEL NucleoSpin Gel and PCR Clean-up Kit. Sequence homology was performed using BLAST (Basic Local Alignment Search Tool) version of National Center for Biotechnology Information and Phylogenetic tree was obtained using Clustal W2. Structural analysis of biosurfactant. Structural analysis was done using FTIR and GC- MS. FTIR spectra of biosurfactant produced by the bacterial strain was analyzed by Perkin Elmer; IR- Prestige Z1, Shimadzu using KBR pellet method. Gas-chromatography mass spectrometry (GC-MS) was used to identify number of compounds and its molecular weight present in the biosurfactant. GC-MS analysis was carried out on GC Clarus 600 model and an Elite-5MS (30.0m, 0.25mm ID, 250 µm df column). Result and Discussions Biosurfactant production by the bacterial strain on different carbon source The microorganism obtained from the oil spill contaminated area was cultured on five different carbon sources including Kerosene, Petrol, Diesel, soybean oil and Coconut oil. The isolated strain showed good biosurfactant production rate in the different carbon sources used, maximum yield (1.8 g/l) being shown in soybean oil after 4 days of incubation (Fig.1a & b). As the organism could utilise petrol, diesel and kerosene as sole carbon source it can be applied to clean oil contaminated soils. Identification and analysis of selected biosurfactant producing bacterial strain Biochemical activity assays were performed to measure the biosurfactant activity (shown in Fig.1d). The positive oil displacement test having diameter of clear halo 1.2 cm, indicated the presence of surfactant properties in the compound. It can be concluded that the lipase activity of the bacteria helps in degradation of triacylglycerol of soybean oil to free fatty acids, di and mono acyl glycerol which acts as a precursor for synthesis of biosurfactant 24. In drop collapsing test, flat drop was observed indicating the production of biosurfactant and emulsification activity was found to be 75%. 16S rrna characterisation of the isolated bacterial strain 16S Ribosomal RNA sequencing is widely used for studying the phylogenetic relationship between diverse prokaryotic organisms as well as other organsims. Partial 16S rrna sequence alignment was done for the isolated bacterial strain using BLAST and Clustal W2 to generate the phylogenetic tree. It revealed that the isolated strain exhibited the highest similarity (99%) to Pseudomonas aeruginosa as shown in Fig. 2b. Therefore, the isolated strain was classified as Pseudomonas aeruginosa SMVIT 1. The complete 16S rrna gene sequences of the selected isolate is available in the Genbank under accession number KJ Characterization of the biosurfactant produced by Pseudomonas Aeruginosa SMVIT1 FTIR characterization Fourier transform infrared spectroscopy is a technique for the identification of the functional groups in the sample. FTIR spectra of the biosurfactant produced by Pseudomonas aeruginosa SMVIT 1 was performed. Characteristic absorption bands corresponding to functional groups typically forming part of rhamnolipids could be observed (Fig. 1c). The characteristic peak at cm -1 represents the O-H stretching (free hydroxyl groups of rhamnose rings). The symmetric stretch (CH) of CH 2 and CH 3 groups of aliphatic chains could be observed around cm cm -1. Absorption around cm -1 and cm -1 represents ester (C=O) and carbonyl (COO - ) group respectively. The peak at cm -1 indicates the presence of polysaccharide or polysaccharide-like substances in the biosurfactant. Absorption peak between cm -1 and cm -1 represents C-O-C vibrations (rhamnose rings). Whereas peak at 694 cm -1 indicates the presence of CH 2 group. Therefore, above study indicates the glycolipid nature of biosurfactant corresponding to rhamnolipids 24.

4 684 J SCI IND RES VOL 75 NOVEMBER 2016 Fig.1 (a) Time course profile of biosurfactant production, cell growth and oil displacement of Pseudomonas aeruginosa SMVIT 1 grown on soybean oil as sole carbon source. Closed square, DCW (g/l); circle, BS yield (g/l); triangle, Oil displacement (cm). (b) Effect of different carbon sources on biosurfactant production (c) FTIR spectra of rhamnolipid type biosurfactant produced (d) Biochemical activity assays. A: Drop collapsing test, B: Oil displacement test, C: Emulsification measurement. Fig. 2 (a) GC-MS spectrum of the biosurfactant (b) Phylogenetic tree of the isolated organism

5 RATH et al.: ISOLATION AND CHARACTERIZATION OF BIOSURFACTANT STRAIN 685 GC-MS GC-MS is an analytical method comprising of gas chromatography coupled to mass spectroscopy for identification of different substances in the sample. GC-MS chromatogram of the biosurfactant producing organism was performed, showing six peaks indicating the presence of different compounds (Fig. 2a). Major peak compounds at the retention time of 11.59, 12.47, 13.84, 14.48, 18.16, minutes were identified from the standard library compound as 5- methyl-z-5 docosene, hexadecanoic acid, 3- hydroxydecanoic acid, trans-2-dodecenoic acid, N- hexadecanoic acid, 2(1H)-benzocyclooctenone respectively. Therefore, the study indicates rhamnolipid biosurfactant. Conclusion Pseudomonas aeruginosa SMVIT 1, a novel rhamnolipid producing bacterium was found to be present in oil spilled contaminated soil of Sir MVIT petrol bunk. The conducted activity assays demonstrate the oil removal efficiency of biosurfactant. High production of biosurfactant in soybean oil could be due to probable lipase activity of the organism leading to degradation of triacylglycerol to free fatty acids, di and mono acylglycerol. FTIR and GC-MS characterization were done for the identification of characteristic compound present in the sample. Therefore, it can be concluded that this strain of Pseudomonas aeruginosa SMVIT 1 producing glycolipid type biosurfactant has potential benefits in oil spill removal and can be used for large scale production of biosurfactant at an industrial level. Acknowledgment Authors acknowledge Department Of Biotechnology, Sir M Visvesvaraya Institute of Technology, Bangalore, for providing the lab facilities. We also wish to thank Society for Innovation and Development, IISC, Bangalore, for providing FTIR and GC-MS characterization. Reference 1 Bakker MI, Casado B, Koerselman JW, Tolls J & Kollöffel C, Polycyclic aromatic hydrocarbons in soils and plant samples from the vicinity of an oil refinery, Sci Total Environ, 263 (2000) Oyem & Rank I L, Effects of Crude Oil Spillage on Soil Physico-Chemical Properties in Ugborodo Community, Int J Mod Eng Res Technol, 3 (2013) Ugboma &P, Effects of Oil Spillage on Soil Fertility in Udu Local Government Area in Delta State, Int J Sci Technol, 3 (2014) Chung I Y, Chao K J, Hiraoka K, Mukai T, Nishijima W, Takimoto K & Okada M, Effects of oil spill on seawater infiltration and macrobenthic community in tidal flats, Marine Pollution Bulletin, 49 (2004) Lewis M & R P, Toxicities of oils, dispersants and dispersed oils to algae and aquatic plants: review and database value to resource sustainability, Environ Pollut, 180 (2013) Seo J S, Keum Y S & Li Q X, Bacterial Degradation of Aromatic Compounds, Int J Environ Res Public Health, 6 (2009) Barkay T, Navon-Venezia S, Ron EZ & Rosenberg E, Enhancement of Solubilization and Biodegradation of Polyaromatic Hydrocarbons by the Bioemulsifier Alasan, Appl Environ Microbio, 65 (1999) Wei, Q F, Mather R & Fotheringham A F, Oil removal from used sorbents using a biosurfactant, Bioresource Technology, 96 (2005) Grant R J, Muckian L M, Clipson N J W & Doyle E M, Microbial community changes during the bioremediation of creosote-contaminated soil, Lett Appl Microbiol, 44 (2007) Urum K & Pekdemir T, Evaluation of biosurfactants for crude oil contaminated soil washing, Chemosphere, 57 (2004) Bodour AA, Guerrero-Barajas C, Jiorle BV, Malcomson ME, Paull AK, Somogyi A, Trinh LN, Bates RB &Maier RM, Structure and characterization of flavolipids, a novel class of biosurfactants produced by Flavobacterium sp. strain MTN11, Appl Environ Microbiol, 70 (2004) Kitamoto D, Isoda H & Nakahara T, Functions and potential applications of glycolipid biosurfactants from energysaving materials to gene delivery carriers, J Biosci Bioeng, 94 (2002) Das K, & Mukherjee A K, Comparison of lipopeptide biosurfactants production by Bacillus subtilis strains in submerged and solid state fermentation systems using a cheap carbon source: some industrial applications of biosurfactants, Process Biochem, 42 (2007) Desai J & Banat I, Microbial production of surfactants and their commercial potential. Microbiol, Mol Biol Rev, 61 (1997) Haba E, Espuny M J, Busquets M & Manresa A, Screening and production of rhamnolipids by Pseudomonas aeruginosa 47 T2 NCIB from waste frying oils, J Appl Microbiol, 88 (2000) Holmberg K, Natural surfactants, CurrOpin Colloid Interface Sci, 6 (2001) Makkar R S & Cameotra S, An update on the use of unconventional substrates for biosurfactant production and their new applications, Appl Microbiol Biotechnol, 58 (2002) Morita T, Konishi M, Fukuoka T, Imura T, Kitamoto H K & Kitamoto D, Characterization of the genus Pseudozyma by the formation of glycolipid biosurfactants, mannosylerythritol lipids, FEMS Yeast Res, 7 (2007) Raza Z A, Rehman A, Khan M S & Khalid Z M, Improved production of biosurfactant by a Pseudomonas aeruginosa mutant using vegetable oil refinery wastes, Biodegradation, 18 (2007)

6 686 J SCI IND RES VOL 75 NOVEMBER Makkar R S & Rockne K J, Comparison of synthetic surfactants and biosurfactants in enhancing biodegradation of polycyclic aromatic hydrocarbons, Environ Toxicol Chem, 22 (2003) Banat IM, Makkar RS and Cameotra SS, Potential commercial applications of microbial surfactants, Appl Microbiol Biotechnol, 53 (2000) Henkel M, Muller M M, Kugler J H, Lovanglio R B, Contiero J & Syldatk C, Rhamnolipids as biosurfactants from renewable resources: Concepts for next-generation rhamnolipid production, Process Biochem, 47 (2012) Kitamoto D, Akiba S, Hioki C & Tabuchi T, Extracellular accumulation of mannosylerythritol lipids by a strain of Candida Antarctica, Agric Biol Chem, 54 (1990) Abbasi H, Hamedi MM, Lotfabad TB, Zahiri HS, Sharafi H, Masoomi F, Moosavi-Movahedi AA, Ortiz A, Amanlou M & Noghabi KA, Biosurfactant- producing bacterium, Pseudomonas aeruginosa MA01 isolated from spoiled apples: Physicochemical and structural characteristics of isolated biosurfactant, J Biosci Bioeng, 113 (2012)

PUBLISHED ON 29 TH FEB 2012

PUBLISHED ON 29 TH FEB 2012 PRODUCTION OF BIOSURFACTANT BY PSEUDOMONAS AERUGINOSA CH23 C.D.AFUWALE*, H.A. MODI ** AND S.A. KAPADIYA *** * & *** P.G.CENTER OF MICROBIOLOGY, SMT S.M. PANCHAL SCIENCE COLLEGE,