ABI INVENTORY Invitrogen INVENTORY
|
|
- Shauna Poole
- 6 years ago
- Views:
Transcription
1 ABI INVENTORY AM9780 RNASE Zap $ AM7024 RNA Later $ opt covers $ well plate $ Optical 384 well reaction plate with barcode $ Optical 8-Cap Strip $ micro amp optical 8 $ N well plate $ AM1907 Turbo DNAFRE $ N AmpliTaq gold DNA Polymerase $ AmpliTaq Gold PCR Master Mix $ GAPDH control $ cdna kit $ High Capacity cdna kit 1000 $ AM9738 Tri Reagent (Trizol) $ TaqMan Gene Expression $ TaqMan Univ Master $ TaqMan Univ Master--no UNG $ SYBR green master $ Power SYBR green master $ Invitrogen INVENTORY geneticin $ Insulin $ plus reagent $ lipofectamine 2000 $ Blue Juice $ proteinase K $ Neurobasal $ L-15 MEDIUM $ D-MEM/F-12 $ DMEM High Glucose $ 7.15 EC6028BOX 4-20% tris-glycine gel $ EC6038BOX 4-12% tris-glycine gel $ NP0001 Nu Page MOPS SDS Running Buffer $ iblot Transfer Stack Nitrocellulose $ mM dntp 4 25 µmol $ Taq Man Fast Adv Master Mix 1x5ml $ Taq DNA poly 500U $ Taq DNA poly 100U $ kb plus DNA ladder $ kb DNA ladder $ glycogen $ benchmark prestained protein ladder $ RNase inhibitor $ RNaseOUT $ platinum Taq Hi-Fi $
2 platinum Pfx DNA poly $ platinum Taq $ oligo dt primer $ DNase I $ superscript II $ superscript III $ T4 DNA ligase $ bp DNA ladder $ random primers $ mm dntp $ ribonuclease H $ MMLV $ % trypsin $ penicillin/streptomycin $ QIAgen INVENTORY DNeasy Tissue Kit (250) $ DNeasy Tissue Kit (50) $ Plasmid Midi Kit (25) $ QIAquick Gel Extraction Kit (50) $ QIAquick PCR Purification Kit (50) $ QIAprep Spin Mini Kit (50) $ QIAprep Spin Mini Kit (250) $ QIAEX II Gel Extraction Kit (150) $ RNase-Free DNase Set (50) $ Plasmid Endofree Maxi Kit (10) $ QIAfilter Plasmid Maxi Kit (10) $ Plasmid Mini Kit (25) $ QIAfilter Plasmid Midi Kit (25) $ Plasmid Maxi Kit (10) $ Rneasy Mini Kit (50) $ QIAquick PCR Purification Kit (250) $ RNeasy Micro Kit (50) $ HiSpeed plasmid maxi kit (10) $ HiSpeed plasmid midi kit (25) $ BIO-RAD INVENTORY mini prep kit $ midi prep kit $ TEMED $ Xblot filter paper $ blotting paper $ Extra Thick Blot Paper $ Criterion Blotter Filter Paper $ x tris-glycine-sds $ x TBE $ x tris-glycine $ SDS 1kg $ blocking milk $ 46.87
3 Mini fiber pads $ prestained std broad range $ precision plus std $ Prec Plus Pro STD $ KIT, iq SYBR GRN, 100 X 50 ul $ % gel 10w 30ul $ % gel 10w 30ul $ % gel 10w 30ul $ % gel 15w 15ul $ % gel 15w 15ul $ % gel 10w 50ul $ % gel 10w 50ul $ Criterion Gel 4-15% 18w 30ul $ Criterion Gel 4-20% 45ul $ TGX Gels 4 15% 18-well, 30 μl $ TGX Gels 4 15% 26-well, 15 μl $ protein assay $ % acrylamide 19:1 $ % acrylamide 29:1 $ % acrylamide 37.5:1 $ SIGMA INVENTORY G8898 1K GLYCINE, ELECTROPHORESIS REAGENT $ S G SODIUM CHLORIDE SIGMA GRADE $ H ML HEPES FREE ACID 1M SOLUTION, BIOTECHNOLOGY GRADE $ T ML TRYPAN BLUE $ 8.01 H6648 6/500ML HANKS' BALANCED SALT SOLUTION, MODIFIED $ T G TRIZMA HYDROCHLORIDE $ D8537 1L DULBECCO'S PHOSPHATE BUFFERED SALINE $ 8.68 PLN70 GENELUTE PLASMID MINIPREP KIT $ ml Molecular biology water $ D ML DIMETHYL SULFOXIDE HYBRIMAX STERILE $ R ML 1.2 ml Redextract-n-amp $ A ML ANTIBIOTIC ANTIMYCOTIC SOLUTION $ T ML TRYPSIN-EDTA SOLUTION CELL CULTURE $ 8.43 S MG streptozocin $ G ml L-glutamine $ P rxn jumpstart redtaq $ P ml penicillin/streptomycin $ 9.77 T ml trypsin $ 8.18 XNAT-1KT Redextract-n-amp for tissue $ F FBS $ F FBS heated $ P8340 1ML PROTEASE INHIBITOR COCKTAIL $ T ML TRI REAGENT $ D6429 DMEM-high $ 7.20 D6046 DMEM-low $ D5796 DMEM-high $ 3.74
4 D8062 DMEM-nutri $ 7.20 R8758 RPMI-1640 $ 3.84 D5671 DMEM-high $ 3.54 M2279 MEM-auto $ 3.41 M8042 MEM MODIFIED $ 9.55 M9309 McCoys $ S ml sodium pyruvate $ 7.07 C ml cell dissociation solution $ S ml sodium bicarb $ 8.26 M ml MEM non-essential aa $ 9.55 Fermentas INVENTORY K0701 GeneJET PCR Purification Kit - 50 preps $ K0691 GeneJET Gel Extraction Kit - 50 preps $ K0503 GeneJET Plasmid Miniprep Kit $ K1422 Rapid DNA Ligation Kit $ FD0694 FastDigest XhoI $ EN0531 RNase A (DNase and Protease Free) $ FD0054 FastDigest BamHI $ R0181 dntp Set (datp, dctp, dgtp, dttp) $ K0171 2X Taq PCR Master Mix $ FD0594 FastDigest NotI $ FD0644 FastDigest SalI $ EF0651 FastAP Alkaline Phosphatase $ SM0671 PageRuler Prestained Protein Ladder $ EK0031 T4 Polynucleotide Kinase $ EL0011 T4 DNA Ligase $ EL0014 T4 DNA Ligase $ SM0243 GeneRuler 100bp DNA Ladder, ready-to-use $ SM0323 GeneRuler 100bp Plus DNA Ladder, ready-to-use $ SM1811 PageRuler Plus Prestained Protein Ladder $ R0611 6X DNA Loading Dye $ EN0521 DNase I (RNase Free) $ EP0402 Taq DNA Polymerase (recombinant) $ FD0574 FastDigest NcoI $ R0391 IPTG (dioxane free) $ R0401 X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside) $ EP0441 RevertAid Reverse Transcriptase $ R0531 TurboFect in vitro Transfection Reagent $ K0222 Maxima SYBR Green/ROX qpcr Master Mix (2X) $ EP0711 DreamTaq Green DNA Polymerase (5u/µl) $ SM1841 Spectra Multicolor Broad Range Protein Ladder $ FD0684 FastDigest XbaI $ FD0614 FastDigest PstI $ FD0504 FastDigest HindIII $ FD0584 FastDigest NdeI $ FD2204 FastDigest PacI $ FD0274 FastDigest EcoRI $ 46.03
5 R0191 dntp Mix (10mM solution) $ FD0524 FastDigest KpnI $ NEB INVENTORY M0202S T4 DNA Ligase - 20,000 units $ R0101S EcoRI- 10,000 units $ R0146S Xho I - 5,000 units $ R0147M 2,500 units [25,000 units/ml] $ R0176S Dpn I- 1,000 units $ R0182L Sph I - 2,500 units $ R0189S Not I units $ R0547L Pad - 1,250 units $ R0547S Pac I units $ FISHER INVENTORY MT25052CI TRYPSN EDTA $ 6.78 BP L WATER RNA GRADE $ SCGPU05RE STERICUP- 500ML $ 8.41 SCGP00525 STERIFLP 50ML $ 83.45
#FD µl (for 200 rxns) Expiry Date: Description. 1 ml of 10X FastDigest Green Buffer. Store at -20 C
PRODUCT INFORMATION Thermo Scientific FastDigest SalI #FD0644 Lot: 5'...G T C G A C...3' 3'...C A G C T G...5' Supplied with: Store at -20 C 200 µl (for 200 rxns) Expiry Date: BSA included www.thermoscientific.com/onebio
More informationTBE Buffer, 10X. Product Data Sheet Catalog No. Quantity ml liter. Please recycle Version:
TBE Buffer, 10X (Tris-borate-EDTA) Product Data Sheet Catalog No. Quantity 15002-500 15002-1000 1 liter Please recycle Version: 01042012 1 Description TBE Buffer is used for polyacrylamide and agarose
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More information5 PRIME Catalog Number Reference Guide April Generation Products
5 PRIME Catalog Number Reference Guide April 2007 Generation Products UC10 UC10 2301870 GENERATION CAPTURE CARDS READY PCR DNA CARD - 10 GC0010 GC0010 2301500 GENERATION CAPTURE COLUMN KIT READY PCR DNA
More informationCore Store. grcf.jhmi.edu. GRCF Mission Catalog grcf.jhmi.edu/core-store
grcf Core Store Agilent Technologies Bio-Rad Cell Signaling Corning Cellgro Faster Better Media GE-Healthcare Hyclone Life Technologies New England Biolabs Promega QIAGEN Quality Biological Roche Applied
More informationDNA ladder SM0332 GeneRuler DNA Ladder Mix 25 x 50 mg Restriction enzyme FD1464 FastDigest BshTI 20 reactions Restriction enzyme FD0644 FastDigest
카테고리 SKU Des. size Revers Transcriptase EP0441 RevertAid Reverse Transcriptase 10,000 units Revers Transcriptase EP0442 RevertAid Reverse Transcriptase 5 x 10,000 units Revers Transcriptase EP0451 RevertAid
More informationMolekulargenetische Reagenzien. Raumtemperaturstabile PCR und qpcr Reagenzien
Molekulargenetische Reagenzien Raumtemperaturstabile PCR und qpcr Reagenzien Polypeptide Stabilization Technology: Stability TAG Ice-free reaction set-up Our temperature stable enzymes allow you to change
More informationSuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes
WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus
More informationMagListo 5M Nucleic Acid Extraction Kit MagListo Magnetic Separation Rack
Bioneer s magnetic nanobead-based solution for DNA/RNA extraction and purification 20150910 Ver.1(EN) MagListo 5M Nucleic Acid Extraction Kit MagListo Magnetic Separation Rack Fast, easy separation - Just
More informationFisher BioReagents Buffers for Life Science Research
Fisher BioReagents Buffers for Life Science Research The Water Makes a Difference. CellPURE Biological Buffers are of the highest quality (purity 99%). They are tested for low heavy metal content and the
More informationRP RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O
www.smobio.com Product Information Reverse Transcription Kit II RP1400 100 RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O ExcelRT series 100 μl 500 μl 100
More informationFisher BioReagents Buffers for Life Science Research
Fisher BioReagents Buffers for Life Science Research The Water Makes a Difference. CellPURE Biological Buffers are of the highest quality (purity 99%). They are tested for low heavy metal content and the
More informationTHE BIOLOGY STOCKROOM. Room 004 Marsh Life Science
THE BIOLOGY STOCKROOM Room 004 Marsh Life Science 656-0436 Hours of Operation: 8:00 4:00 (Closed during lunch: 11:30 12:30) Hours are subject to change. For further assistance, please see Room 120A Marsh
More informationProteinase K Solution Product Data Sheet
Proteinase K Solution Product Data Sheet Catalog No. Quantity 1222-2 2 ml This product is for research purposes only. Not for diagnostic use. Description Proteinase K Solution from Tritirachium Album (Endopeptidase
More informationBIOO RESEARCH PRODUCTS. ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205
BIOO RESEARCH PRODUCTS ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205 BIOO Scientific Corp. 2010 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure Overview... 2 Kit
More informationmmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More informationTECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70
GenElute mrna Miniprep Kit Catalog Numbers MRN 10, MRN 70 TECHNICAL BULLETIN Product Description The GenElute mrna Miniprep Kit provides a simple and convenient way to purify polyadenylated mrna from previously
More informationAmino-allyl Dye Coupling Protocol
Amino-allyl Dye Coupling Protocol Joseph DeRisi, June 2001 Typically, fluorescently labeled cdna is generated by incorporation of dyeconjugated nucleotide analogs during the reverse transcription process.
More informationENDEXT Technology. Instruction manual for protein synthesis. with wheat germ cell-free system
ENDEXT Technology Instruction manual for protein synthesis with wheat germ cell-free system 1 Protocol Overview Plasmid DNA construction (see Section 3.1) Preparation of plasmid DNA for transcription (see
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationmmu-mir-34a Real-time RT-PCR Detection Kit User Manual
mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not
More informationMMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit
MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis
More informationFisher Scientific -tuotteet / Biomedicum, Hki
Fisher Scientific -tuotteet / Biomedicum, Hki FastDigest Restriktioentsyymit (Thermo Scientific Fermentas) FD1484 FastDigest AccI (XmiI) 50 rxn FD1464 FastDigest AgeI (BshTI) 20 rxn FD1414 FastDigest ApaI
More informationT7-Based RNA Amplification Protocol (in progress)
T7-Based RNA Amplification Protocol (in progress) Jacqueline Ann Lopez (modifications) Amy Cash & Justen Andrews INTRODUCTION T7 RNA Amplification, a technique originally developed in the laboratory of
More informationBio-Rad Supply Centre
Maximize Your Time for Science Bio-Rad Supply Centre Supplies at your fingertips PRODUCT LIST 2017 University of Guelph The Science Complex - Room 1110 Jamie Jones biobar@uoguelph.ca, (519) 824-4120 x
More informationPrimeScript RT Master Mix (Perfect Real Time)
Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.
More informationChapter 3. Enzyme manipulation of DNA and RNA
Chapter 3 Enzyme manipulation of DNA and RNA To measure incorporation of radioactivity (to see if the probe is good or not for hybridization) Acid precipitation method: - Add sonicated salmon sperm DNA
More informationQuant One Step RT-PCR Kit
1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationQUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)
QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.
More informationFMF NIRCA PROTOCOL STEP 1.
FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are
More information1. COMPONENTS. PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) 2. STORAGE 3. DESCRIPTION
1 2 1 PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) TABLE OF CONTENTS 1. COMPONENTS... 2 2. STORAGE... 2 3. DESCRIPTION... 2 4. PROTOCOL FOR FAST PCR... 3 4.1. General Considerations...
More informationThe Isolation and Sequence Analysis of the Cryptochrome (Cry1) Gene From a Petunia hybrida Plant. By Jenalyn Quevedo
The Isolation and Sequence Analysis of the Cryptochrome (Cry1) Gene From a Petunia hybrida Plant By Jenalyn Quevedo Biology 115L June 6, 2005 1 Abstract The blue-light photoreceptor cryptochrome (cry1)
More informationConversion of plasmids into Gateway compatible cloning
Conversion of plasmids into Gateway compatible cloning Rafael Martinez 14072011 Overview: 1. Select the right Gateway cassette (A, B or C). 2. Design primers to amplify the right Gateway cassette from
More informationReverse Transcriptase Reverse Transcriptase 100 µl 5X RT Buffer 0.1 M DTT 500 µl Storage -20 C for 24 months
www.smobio.com Product Information Reverse Transcriptase ExcelRT series RP1000 20,000 units Reverse Transcriptase 100 µl 5X RT Buffer 1 ml 0.1 M DTT 500 µl Storage -20 C for 24 months Description The ExcelRT
More informationTaKaRa Taq HS PCR Kit, UNG plus
Cat. # R013S/A For Research Use TaKaRa Taq HS PCR Kit, UNG plus Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 4 IV. Materials Required but not Provided... 4 V.
More informationMolecular Techniques Third-year Biology
PLANNING Genetics Lab practices Molecular Techniques. Genetics Lab practices protocol. 2015-16 PCR-DIRECTED MUTAGENESIS, MOLECULAR CLONING AND RESTRICTION ANALYSIS Sessions 1 & 2 (2x3 hours): PCR-directed
More informationInstructions for Use Life Science Kits & Assays
Instructions for Use Life Science Kits & Assays Product specifications 1 Product specifications The innumix Standard PCR MasterMix contains all reagents required for routine high throughput PCR amplifications
More informationTHE INSTITUTE FOR GENOMIC RESEARCH Standard Operating Procedure SOP #: M004 REVISION LEVEL:.3 EFFECTIVE DATE: 9/16/03
Standard Operating Procedure PAGE: 1 of 8 SOP #: M004 REVISION LEVEL:.3 EFFECTIVE DATE: 9/16/03 AUTHOR: Jeremy Hasseman PRIMARY REVIEWERS: Renee Gaspard, Bryan Frank 1. PURPOSE This protocol describes
More informationCloning small RNAs for Solexa Sequencing version 2.0 by Nelson Lau Page 1 of 5 (Modified from Solexa sequencing protocol from Bartel lab)
Cloning small RNAs for Solexa Sequencing version 2.0 by Nelson Lau 09162008 Page 1 of 5 General Cloning Protocol: Gel-purification 1. Pour 1mm thick, urea denaturing 10% or 15% polyacrylamide gels, with
More informationScore winning cdna yields with SuperScript III RT
Score winning cdna yields with RT SuperScript III offers: Higher cdna yields Higher thermal stability Longer half-life than any other RT you could use Announcing SuperScript III Reverse Transcriptase How
More informationfrom different sources
Thermo Scientific GeneJET Nucleic Acid Purification Kits high yields of pure & RNA from different sources High Yields Exceptional Purity Incredible Value Reliable and RNA purification The Thermo Scientific
More informationBasic Protocol (v. 2.0, May, 2003)
Basic Protocol (v. 2.0, May, 2003) Preparation of RNA:DNA Handles For the two handles (called A and B), you will need the following oligos: Product 1 : Name=B_reverse : Synthesis=1 umole : Purification=HPLC
More informationLow cost and non-toxic genomic DNA extraction for use in molecular marker studies.
Low cost and non-toxic genomic DNA extraction for use in molecular marker studies. Version 1.4, February 28 th, 2013. Prepared by Bernhard Hofinger, Owen Huynh and Brad Till. 1. OBJECTIVE To develop and
More informationSYBR Real-Time PCR Kit
SYBR Real-Time PCR Kit For Amplification and detection of DNA in Quantitative real-time PCR (qpcr). Catalog No. QPG-040/QPG-041/QPG-042/QPG-043 User Manual Table of Contents Kit Contents and Storage...
More informationMicroarray Protocol for Agilent Inkjet-Deposited Presynthesized Oligo Arrays Aminoallyl Method AfCS Procedure Protocol PP Version 1, 10/20/03
Microarray Protocol for Agilent Inkjet-Deposited Presynthesized Oligo Arrays AfCS Procedure Protocol PP00000184 Version 1, 10/20/03 The following procedure details the preparation of fluorescently labeled
More informationTQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 5
www.smobio.com Product Information ExcelTaq series 2X Q-PCR Master Mix (SYBR, no ROX) TQ1100 200 RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ1101 500 RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x
More informationSYBR Green Realtime PCR Master Mix
Instruction manual SYBR Green Realtime PCR Master Mix 0810 F0924K SYBR Green Realtime PCR Master Mix QPK-201T 1 ml x 1 QPK-201 1 ml x 5 Contents [1] Introduction [2] Components [3] Primer design [4] Detection
More informationPureSpin DNA Clean Up Kit
PureSpin DNA Clean Up Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin DNA Clean Up Kit, Micro Columns w/out Caps (Kit Size) OD2080 (50 Preps.) OD2080-2 (200 Preps.) Storage
More informationPrimeScript 1st strand cdna Synthesis Kit
Cat. # 6110A For Research Use PrimeScript 1st strand cdna Synthesis Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 3 IV. Storage...
More informationBio Rad Itaq Manual For Western Blot Transfer System
Bio Rad Itaq Manual For Western Blot Transfer System Earn a FREE one year service contract on your Bio-Plex MAGPIX system when For a limited time, receive your third vial of itaq Univeral Supermix. Bio-Rad
More informationMicroarray protocol Emmanuela Marchi PhD Dept. Pharmacology UFIR - Comparative nutritional systems biology Focus Team Post-doc emanuela.marchi@unifi.it 16 April 2009 When citing this SOP you should acknowledge
More informationUSB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr
USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate
More informationSYBR Green PCR and RT-PCR Reagents Protocol
SYBR Green PCR and RT-PCR Reagents Protocol For Research Use Only. Not for use in diagnostic procedures. Copyright 2001, Applied Biosystems For Research Use Only. Not for use in diagnostic procedures.
More informationReverTra Ace qpcr RT Master Mix
Instruction manual ReverTra Ace qpcr RT Master Mix 1203 F1173K ReverTra Ace qpcr RT Master Mix FSQ-201 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Protocol 1. RNA template
More informationFirst Strand cdna Synthesis Kit (#K1611 for 10 reactions)
3 First Strand cdna Synthesis Kit (#K1611 for 10 reactions) Kit is designed for preparation of full-length fi rst strand cdna from RNA templates. The fi rst strand cdna synthesis kit relies on a cloned
More informationNucleic Acid Electrophoresis APPLICATION GUIDE
AGAROSE BUFFERS LADDERS EQUIPMENT Nucleic Acid Electrophoresis APPLICATION GUIDE Reagents: Agarose Thermo Scientific and Fisher Scientific products deliver an end-to-end solution that can meet your most
More informationDescription...1 Components...1 Storage... 1 Technical Information...1 Protocol...2 Examples using the kit...4 Troubleshooting...
QuickClean II Gel Extraction Kit Cat. No. L00418 Technical Manual No. TM0594 Version: 03042011 I II III IV V VI VII VIII Description......1 Components.....1 Storage.... 1 Technical Information....1 Protocol.....2
More informationProtoscript II RT-PCR Kit. I n s t r u c t i o n M a n u a l NEW ENGLAND. BioLabs. Version 1.2 3/07. Catalog #E6400S Store at 20 C. Inc.
Protoscript II RT-PCR Kit I n s t r u c t i o n M a n u a l Catalog #E6400S Store at 20 C NEW ENGLAND BioLabs Inc. Version 1.2 3/07 Table of Contents: Supplied Components.................................................................................
More informationChIP-chip protocol adapted for the mod-encode project
ChIP-chip protocol adapted for the mod-encode project Version 1.2 : August 2007 Nicolas Nègre, Xiaochun Ni, Sergey Lavrov, Giacomo Cavalli and Kevin P. White University of Chicago, Department of Human
More informationRT 2 Easy First Strand Handbook
March 2011 RT 2 Easy First Strand Handbook For cdna synthesis Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and assay technologies,
More informationAMV First Strand cdna Synthesis Kit
DNA AMPLIFICATION & PCR AMV First Strand cdna Synthesis Kit Instruction Manual NEB #E6550S Store at 20 C ISO 9001 Registered Quality Management ISO 14001 Registered Environmental Management ISO 13485 Registered
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationSOP: SYBR Green-based real-time RT-PCR
SOP: SYBR Green-based real-time RT-PCR By Richard Yu Research fellow Centre for Marine Environmental Research and Innovative Technology (MERIT) Department of Biology and Chemistry City University of Hong
More information2x PCR LongNova-RED PCR Master Mix
2x PCR LongNova-RED Components RP85L 100 reactions (50 μl) RP85L-10 1000 reactions (50 μl) 2x PCR LongNova-RED 2 x 1.25 ml 20 x 1.25 ml PCR grade water 2 x 1.5 ml 20 x 1.5 ml Storage & Shiing Storage conditions
More informationBiology Stockroom Catalog
10654 Agar, 1lb $ 84.35 ea Affymetrix/USB 32802-100g Agarose LE, 100g $ 150.63 ea Affymetrix/USB 15397 Dithiothreitol (DTT), 5g $ 98.81 ea Affymetrix/USB 70704 DNA M12MP18 Control, 50ul $ 13.10 ea Affymetrix/USB
More informationProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2.
DNA AMPLIFICATION & PCR ProtoScript First Strand cdna Synthesis Kit Instruction Manual NEB #E6300S/L 30/150 reactions Version 2.2 11/16 be INSPIRED drive DISCOVERY stay GENUINE This product is intended
More informationAccuPower PCR PreMix 73. AccuPower Taq PCR PreMix 77. AccuPower PCR PreMix (with UDG) 79. AccuPower HotStart PCR PreMix 81
PCR PreMix 73 AccuPower Taq PCR PreMix 77 AccuPower PCR PreMix (with UDG) 79 AccuPower HotStart PCR PreMix 81 AccuPower PyroHotStart Taq PCR PreMix 84 AccuPower HotStart PCR PreMix (with UDG) 87 AccuPower
More informationMyers Lab ChIP-seq Protocol v Modified January 10, 2014
Myers Lab ChIP-seq Protocol V011014 1 Contact information: Dr. Florencia Pauli Behn HudsonAlpha Institute for Biotechnology 601 Genome Way Huntsville, AL 35806 Telephone: 256-327-5229 Email: fpauli@hudsonalpha.org
More informationGateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab
Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab With the Gateway cloning system, a PCR fragment is
More informationOne Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)
Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.
More informationCLIP (in vivo Cross-Linking and ImmunoPrecipitation) method
CLIP (in vivo Cross-Linking and ImmunoPrecipitation) method I. general method for UV crosslinking of tissue/cell lines For mice tissue: Harvest forebrain / hindbrain from P8 mice (ICR strain); let tissue
More informationPrimeScript RT reagent Kit (Perfect Real Time)
Cat. # RR037A For Research Use PrimeScript RT reagent Kit (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Features... 4 V. Precautions...
More informationII First Strand cdna Synthesis Kit
DNA AMPLIFICATION & PCR ProtoScript II First Strand cdna Synthesis Kit Instruction Manual NEB #E6560S/L 30/150 reactions Version 1.5 12/17 be INSPIRED drive DISCOVERY stay GENUINE This product is intended
More informationGuidelines for Preventing Contamination of PCR Reference Guidelines for Primer Design Estimation of Primer Melting Temperature
Guidelines for Preventing Contamination of PCR During PCR more than 10 million copies of a template DNA are generated. Therefore, care must be taken to avoid contamination with other templates and amplicons
More informationCatalog Number Description Price Unit Vendor
Biology Stockroom Catalog Note, prices in red are being discontinued and being offered at a reduced price. Catalog Number Description Price Unit Vendor 10654 Agar, 1lb $84.35 ea Affymetrix/USB 15397 Dithiothreitol
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationNEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1)
LIBRARY PREPARATION NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) Instruction Manual NEB #E7300S/L 24/96 reactions Sign up for the NEBNext e-newsletter Scan this code or visit www.neb.com/
More informationBauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04
Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04 Author(s): Claire Reardon Reviewers: Christian Daly Contact: claire@cgr.harvard.edu
More informationOrdering Information QIAGEN Promotion March 2017
Ordering Information QIAGEN Promotion March 2017 Until March 24, 2017 you can save 24% * on selected assay and sample prepration products when you order through your eprocurement system. Simply enter the
More informationCloning Small RNAs for Sequencing with 454 Technology
Cloning Small RNAs for Sequencing with 454 Technology Protocol provided by Dr. Greg Hannon, Cold Spring Harbor Laboratory 1. RNA preparation 1. Total RNA is isolated from tissue or cells with TRIZOL followed
More informationPositively Charged Membrane
BIOBOND NYLON MEMBRANES ProductInformation Technical Bulletin No. MB-570 June 1999 Size Quantity Positively Charged Membrane Neutral Membrane 30 cm x 3.5 m 1 roll N4781 N1031 30 cm x 12 m 1 roll N4906
More informationPreparation of Reduced Representation Bisulfite Sequencing (RRBS) libraries
Preparation of Reduced Representation Bisulfite Sequencing (RRBS) libraries Ambre Bender and Michael Weber CNRS University of Strasbourg UMR7242 Biotechnology and Cell signalling 300, Bd Sébastien Brant
More informationAmplification: MyiQ and iq5 Real-Time PCR Systems. MyiQ and iq 5 Real-Time PCR Detection Systems
Amplification: MyiQ and iq5 Real-Time PCR Systems MyiQ and iq 5 Real-Time PCR Detection Systems Genomic Research Solutions From Bio-Rad Bio-Rad is well known for making advanced genomic technologies accessible
More informationAn improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues
An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues Yoshikazu Nishiguchi 1*, Koichi Kitamura 1, Naoko Watanabe 2, Anna Kozaki 3, Hayato Otani
More informationProducts for Molecular Biology
Promo Code: DS2BF14 Products for Molecular Biology Plates & Seals for qpcr and Real-Time PCR #352-PCR FAST Type 96 Well Low Profile PCR Plate Half-Skirted Compatible with ABI 9800 FAST & 7500 FAST Raised
More informationPremix Ex Taq (Probe qpcr)
For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.
More informationInstructions for Use Life Science Kits & Assays
Instructions for Use Life Science Kits & Assays Content Content 1 Product and order number... I 2 Storage conditions... I 3 Description... II 3.1 Quality data... II 3.2 Unit definition... II 4 Delivered
More informationUser Bulletin #2. ABI PRISM 7700 Sequence Detection System. Introduction. Contents. December 11, 1997
User Bulletin #2 ABI PRISM 7700 Sequence Detection System December 11, 1997 SUBJECT: Relative Quantitation of Gene Expression Introduction Amplification of an endogenous control may be performed to standardize
More informationProtocol for induction of expression and cell lysate production
Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected
More informationQuantiTect Primer Assay Handbook
July 2011 QuantiTect Primer Assay Handbook For genomewide, ready-to-use real-time RT-PCR assays using SYBR Green detection Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the
More informationAmpliScribe T7-Flash Transcription Kit
AmpliScribe T7-Flash Transcription Kit Cat. Nos. ASF3257 and ASF3507 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA191E AmpliScribe T7-Flash Transcription Kit 12/2016 1 1. Introduction
More informationFisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA).
175 Appendix III Chapter 4 Methods General. Unless otherwise noted, reagents were purchased from the commercial suppliers Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further
More informationReal-Time PCR Validations
Real-Time PCR Validations Relative gene expression Example experiment: I have 2 samples: untreated and treated. Question: What happens to the expression of gene X when I treat the cells? Answer: Expressed
More informationSession 3 Cloning Overview & Polymerase Chain Reaction
Session 3 Cloning Overview & Polymerase Chain Reaction Learning Objective: In this lab exercise, you will become familiar with the steps of a polymerase chain reaction, the required reagents for a successful
More informationDepartment of Biochemistry and Molecular Biophysics, Columbia University, New York, USA
RNA Chromatin Immunoprecipitation (RNA-ChIP) in Caenorhabditis elegans Germano Cecere * and Alla Grishok Department of Biochemistry and Molecular Biophysics, Columbia University, New York, USA * For correspondence:
More informationIntroduction To Real-Time Quantitative PCR (qpcr)
Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular
More informationMultiplex RT for TaqMan Array Human MicroRNA Panel
f Multiplex RT for TaqMan Low Density Array Multiplex RT for TaqMan Array Human MicroRNA Panel Quick Reference Card For safety and biohazard guidelines, refer to the Safety section in the Multiplex RT
More informationInstructions for Use. RealStar Lassa Virus RT-PCR Kit /2017 EN
Instructions for Use RealStar Lassa Virus RT-PCR Kit 1.0 04/2017 EN RealStar Lassa Virus RT-PCR Kit 1.0 For research use only! (RUO) 641003 INS-641000-EN-S01 96 04 2017 altona Diagnostics GmbH Mörkenstr.
More information