Chapter 3. Enzyme manipulation of DNA and RNA

Size: px
Start display at page:

Download "Chapter 3. Enzyme manipulation of DNA and RNA"

Transcription

1 Chapter 3 Enzyme manipulation of DNA and RNA

2 To measure incorporation of radioactivity (to see if the probe is good or not for hybridization) Acid precipitation method: - Add sonicated salmon sperm DNA and cold acid (HCl) solution, - Collect the precipitate on a glass microfiber filter (Whatman GF/A), - Measure radioactivity

3 To separate radio-labelled probe from dntps Spin column method (Fig ), Resin (Sephadex G-50, Bio-Gel P-60) Silanized glass wool Dye (phenol red)

4

5 Labeling RNA by run-off in vitro transcription (unit 2.13) - Linealized DNA by restriction digestion immediately downstream of the fragment to be labeled - Mix: DNA, SP6 (T7, T3 etc) RNA polymerse, A, C, G, and [α-32p]u, RNase inhibitor, and incubate RNase free DNase I incubation - Stop reaction by EDTA, can be stored at C for 2 days before use. (During hybridization, use low-stringency wash firstly, Then, RNase A and RNase T1 to remove unhybridized probe, Finally moderate- and high-stringency washes.)

6 Labeling DNA by nick translation - Mix: DNA fragment da, dc, dg, α-32p]du, DNase I, E. coli DNA polymerase I, and incubate - Stop reaction by EDTA (and trna) - Phenol extraction - Spin column

7 Labeling DNA by random priming -Mix DNA fragment and random hexanucleotides, boil and ice - Add da, dc, dg, [α-32p]du, Klenow fragment, and incubate - Stop reaction by EDTA (and trna) - Phenol extraction - Spin column

8 Labeling 3 -end of dsdna with 5 overhang (fill in) Repair 3 or 5 overhangs to become blunt ends all by Klenow fragment

9

10 Restriction digestion Complete digestion Partial digestion: by reduction enzyme concentration or digestion time, or combination. (DNA treated with DNA methylase will resistant to digestion of the corresponding RE.)

11 Synthesis of homopolymer tails (tailing) or biotin-11-dutp labeling by Terminal (deoxynucleotidyl) transferase - template independent - tailing or biotin-labeling to 3 -end of dsdna or ssdna - best with ssdna and dsdna with 3 - overgangs)

12 Removing of 5 -protruding ends of dsdna (for further tailing by terminal transferase) by Lambda exonuclease (λexo)

13 Synthesis of cdna by Reverse transcriptase (using either oligo (dt) primers, or random primers) - RT can degrade the RNA in an RNA::DNA hybrid or RNA can be destroyed by NaOH

14 Dephosphorylation of 5 -end of DNA, RNA, dntps, and NTPs by CIP (calf intestine phosphatase) or BAP (bacterial alkaline phosphatase) - to avoid self-ligation of vector DNA

15 Phosphorylation of oligonucleotides, ssdna, or dsdna with 5 -OH ends by T4 polynucleotide kinase (transfer γ phosphate of ATP to 5 -OH of DNA, RNA) - for ligation of linkers best with 5 protruding ends, blunt ends are OK. - for RE mapping, ds DNA first dephosphorylated by CIP, then labeled by T4 polynucleotide kinase using [γ-32p]atp, then partial digestion of the labeled DNA.

16 Exonuclease Exo VII: work on 3 and 5 end of ssdna, processive λexo: work on 5 overhangs of dsdna, processive, work on 5-P T4 gene 6 exonuclease: work on 5 overhangs of dsdna, non- processive, work on 5-P and 5-OH Exo VIII: work on 3 -OH of dsdna, non-processive

17 Endonclease Bal 31: degrade ssdna, rrna, trna, ss region of ccc, 5 end and 3 end of linear dsdna (controlled shortening of dsdna) S1, mung bean nuclease: degrade ss DNA, ss region of ccc Micrococcal nuclease: degrade DNA and RNA DNase I (RNase-free DNase I): degrade ds DNA, nicks dsdna in the presence of Mg +2 ; generates ds breaks in the presence of Mn +2

18 Ribonuclease RNase A (DNase-free RNase A): degrade RNA after C and U (inhibited by RNase inhibitor: eg., RNasin from Promega) RNase H: degrade RNA in RNA:DNA duplex. RNase T1: degrade RNA after G

19 Ligase T4 DNA ligase: ligation between 5 -P and 3 -OH in duplex DNA T4 RNA ligase: ligation of 5 -P ssdna or RNA to 3 -OH of ssdna or RNA.

20

21

22

23

24 Sub-cloning - RE, CIP. Klenow, linker, T4 DNA ligase - can be done in low-gelling gel slices

25

26

27 Construction of recombinant DNA molecules by PCR Fig Fig Fig

28

29

30

31 Detection by non-isotopic probes Non-isotopic probes: labeled with biotin or digoxigenin, stable for 2 years.

32 I. Biotin-labeled probe and detection Biotin binds to streptavidin (4 x 13 kd) tightly.

33 Biotin probes Nick translation reaction Biotin-11-dUTP is substituted for dttp no phenol extraction (biotinylated probe will go to interphase or phenol layer) Random priming Biotinylated random octamers (NEB, Millipore) Biotin-11-dUTP is substituted for dttp

34 For QC of biotinylated probes, colorimetric method ( color α biotin/ kb) Dot blot biotinylated standard DNA (Life Technologies) test probe Uncharged nylon membrane Hybridization Streptavidin-alkaline phosphatase (AP) conjugate Nitriblue tetrazolium (NBT) 5-bromo-4 chloro-3-indoyl phosphate (BCIP)

35

36 Detection by biotinylated probes Chemiluminescent method (can detect 1 copy of gene in 1μg human genomic DNA) Uncharged nylon membrane blot with DNA or RNA Biotinylated probe Strepavidin Biotinylataed AP Chemiluminescent substrates (eg. Western lightning chemiluminescence Rreagent plus, PekinElmer Life Science)

37

38 II. Digoxigenin -labeled probe and detection (Genius kit, BM) Digoxigenin Labeling nick translation or random priming, replacing dttp by digoxigenin-11-dutp/dttp QC by digoxigenin-labelled stand DNA (part of kit) Detection color or chemiluminescent method using AP conjugated anti-digoxigenin antibody.

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries

More information

DNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010.

DNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010. Technical Bulletin DNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010. PRINTED IN USA. Revised 12/12 DNA 5 End-Labeling System All technical literature is available on the Internet at: www.promega.com/protocols/

More information

Recombinant DNA Technology

Recombinant DNA Technology History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists

More information

Gene Cloning & DNA Analysis

Gene Cloning & DNA Analysis CSS451 CSS/HRT 451 Gene Cloning & DNA Analysis Chapter 4-5 T-DNA LB auxin cytokin opine Oncogenic genes RB vir genes ori opine catabolism Guo-qing Song Part 1 Basic principles Gene Cloning & DNA Analysis

More information

Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...

Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol... Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

DuraScribe T7 Transcription Kit

DuraScribe T7 Transcription Kit DuraScribe T7 Transcription Kit Cat. Nos. DS010910 and DS010925 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA170E DuraScribe T7 Transcription Kit 7/2017 1 1. Introduction The

More information

Basic Protocol (v. 2.0, May, 2003)

Basic Protocol (v. 2.0, May, 2003) Basic Protocol (v. 2.0, May, 2003) Preparation of RNA:DNA Handles For the two handles (called A and B), you will need the following oligos: Product 1 : Name=B_reverse : Synthesis=1 umole : Purification=HPLC

More information

PureSpin DNA Clean Up Kit

PureSpin DNA Clean Up Kit PureSpin DNA Clean Up Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin DNA Clean Up Kit, Micro Columns w/out Caps (Kit Size) OD2080 (50 Preps.) OD2080-2 (200 Preps.) Storage

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

Instruction Manual cdna Synthesis System

Instruction Manual cdna Synthesis System Instruction Manual cdna Synthesis System CAT. NO. 18267-013 Table of Contents 1. Notices to Customer........................................1 1.1 Important Information.............................................1

More information

Bacterial DNA replication

Bacterial DNA replication Bacterial DNA replication Summary: What problems do these proteins solve? Tyr OH attacks PO4 and forms a covalent intermediate Structural changes in the protein open the gap by 20 Å! 1 Summary: What problems

More information

AMV First Strand cdna Synthesis Kit

AMV First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR AMV First Strand cdna Synthesis Kit Instruction Manual NEB #E6550S Store at 20 C ISO 9001 Registered Quality Management ISO 14001 Registered Environmental Management ISO 13485 Registered

More information

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics

More information

Biotin 3' End DNA Labeling Kit

Biotin 3' End DNA Labeling Kit INSTRUCTIONS Biotin 3' End DNA Labeling Kit 3747 N. Meridian Road P.O. Box 117 Rockford, IL 61105 89818 1290.4 Number Description 89818 Biotin 3' End DNA Labeling Kit, sufficient reagents to perform 20

More information

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques

More information

PrimeScript RT Master Mix (Perfect Real Time)

PrimeScript RT Master Mix (Perfect Real Time) Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.

More information

First Strand cdna Synthesis Kit (#K1611 for 10 reactions)

First Strand cdna Synthesis Kit (#K1611 for 10 reactions) 3 First Strand cdna Synthesis Kit (#K1611 for 10 reactions) Kit is designed for preparation of full-length fi rst strand cdna from RNA templates. The fi rst strand cdna synthesis kit relies on a cloned

More information

Reverse Transcriptase Reverse Transcriptase 100 µl 5X RT Buffer 0.1 M DTT 500 µl Storage -20 C for 24 months

Reverse Transcriptase Reverse Transcriptase 100 µl 5X RT Buffer 0.1 M DTT 500 µl Storage -20 C for 24 months www.smobio.com Product Information Reverse Transcriptase ExcelRT series RP1000 20,000 units Reverse Transcriptase 100 µl 5X RT Buffer 1 ml 0.1 M DTT 500 µl Storage -20 C for 24 months Description The ExcelRT

More information

778/779 DIG Hyb ManualCover_1AK :32 Uhr Seite 3 C M Y CM MY CY CMY K Probedruck

778/779 DIG Hyb ManualCover_1AK :32 Uhr Seite 3 C M Y CM MY CY CMY K Probedruck 778/779 DIG Hyb ManualCover_1AK 0.07.2008 14:2 Uhr Seite C Probedruck M Y CM MY CY CMY K Intended use Our preparations are exclusively intended to be used in life science research applications.* They must

More information

Sensitivity vs Specificity

Sensitivity vs Specificity Viral Detection Animal Inoculation Culturing the Virus Definitive Length of time Serology Detecting antibodies to the infectious agent Detecting Viral Proteins Western Blot ELISA Detecting the Viral Genome

More information

II First Strand cdna Synthesis Kit

II First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR ProtoScript II First Strand cdna Synthesis Kit Instruction Manual NEB #E6560S/L 30/150 reactions Version 1.5 12/17 be INSPIRED drive DISCOVERY stay GENUINE This product is intended

More information

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis

More information

Conversion of plasmids into Gateway compatible cloning

Conversion of plasmids into Gateway compatible cloning Conversion of plasmids into Gateway compatible cloning Rafael Martinez 14072011 Overview: 1. Select the right Gateway cassette (A, B or C). 2. Design primers to amplify the right Gateway cassette from

More information

PrimeScript RT reagent Kit (Perfect Real Time)

PrimeScript RT reagent Kit (Perfect Real Time) Cat. # RR037A For Research Use PrimeScript RT reagent Kit (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Features... 4 V. Precautions...

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

Enzymatic assembly of DNA molecules up to several hundred kilobases

Enzymatic assembly of DNA molecules up to several hundred kilobases nature methods Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & Hamilton O Smith Supplementary figures

More information

Lecture 18. PCR Technology. Growing PCR Industry

Lecture 18. PCR Technology. Growing PCR Industry Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

ReverTra Ace qpcr RT Master Mix

ReverTra Ace qpcr RT Master Mix Instruction manual ReverTra Ace qpcr RT Master Mix 1203 F1173K ReverTra Ace qpcr RT Master Mix FSQ-201 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Protocol 1. RNA template

More information

PrimeScript 1st strand cdna Synthesis Kit

PrimeScript 1st strand cdna Synthesis Kit Cat. # 6110A For Research Use PrimeScript 1st strand cdna Synthesis Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 3 IV. Storage...

More information

#FD µl (for 200 rxns) Expiry Date: Description. 1 ml of 10X FastDigest Green Buffer. Store at -20 C

#FD µl (for 200 rxns) Expiry Date: Description. 1 ml of 10X FastDigest Green Buffer. Store at -20 C PRODUCT INFORMATION Thermo Scientific FastDigest SalI #FD0644 Lot: 5'...G T C G A C...3' 3'...C A G C T G...5' Supplied with: Store at -20 C 200 µl (for 200 rxns) Expiry Date: BSA included www.thermoscientific.com/onebio

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Applications for Eppendorf Thermomixer comfort* 1, Thermomixer compact* 2 and ThermoStat plus TM. Purification of DNA, RNA and proteins

Applications for Eppendorf Thermomixer comfort* 1, Thermomixer compact* 2 and ThermoStat plus TM. Purification of DNA, RNA and proteins Userguide Eppendorf Thermomixer, ThermoStat plus No 001 November 2010 Applications for Eppendorf Thermomixer comfort* 1, Thermomixer compact* 2 and ThermoStat plus TM Cells/ Tissue Analysis of tissue sections

More information

The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity

The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega

More information

ProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2.

ProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2. DNA AMPLIFICATION & PCR ProtoScript First Strand cdna Synthesis Kit Instruction Manual NEB #E6300S/L 30/150 reactions Version 2.2 11/16 be INSPIRED drive DISCOVERY stay GENUINE This product is intended

More information

Quant One Step RT-PCR Kit

Quant One Step RT-PCR Kit 1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant

More information

Amino-allyl Dye Coupling Protocol

Amino-allyl Dye Coupling Protocol Amino-allyl Dye Coupling Protocol Joseph DeRisi, June 2001 Typically, fluorescently labeled cdna is generated by incorporation of dyeconjugated nucleotide analogs during the reverse transcription process.

More information

Premix Ex Taq (Probe qpcr)

Premix Ex Taq (Probe qpcr) For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.

More information

USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr

USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate

More information

RP RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O

RP RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O www.smobio.com Product Information Reverse Transcription Kit II RP1400 100 RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O ExcelRT series 100 μl 500 μl 100

More information

small RNA Cloning Kit

small RNA Cloning Kit Cat. # RR065 For Research Use small RNA Cloning Kit Product Manual Table of Contents I. Description... 3 II. Components... 4 III. Materials Required but not Provided... 5 IV. Storage... 6 V. Precautions

More information

T4 DNA ligase. Manual for catalog numbers C0005 and C0006. Upon Receipt Store Kits at -20ºC. anvaxbiotech.com

T4 DNA ligase. Manual for catalog numbers C0005 and C0006. Upon Receipt Store Kits at -20ºC. anvaxbiotech.com T4 DNA ligase Manual for catalog numbers C0005 and C0006 Upon Receipt Store Kits at -20ºC www.c anvaxbiotech.com PRODUCT MANUAL Version 2.0 Last updated: February 2010 Table of contents Table of contents...

More information

RNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation

RNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation RNA Isolation and Technology Applications Nadine Nassif Senior Research Scientist Promega Corporation verview Brief overview of basic RNA/DNA chemistry. verview of total and poly(a+) RNA isolation. Discuss

More information

T7-Based RNA Amplification Protocol (in progress)

T7-Based RNA Amplification Protocol (in progress) T7-Based RNA Amplification Protocol (in progress) Jacqueline Ann Lopez (modifications) Amy Cash & Justen Andrews INTRODUCTION T7 RNA Amplification, a technique originally developed in the laboratory of

More information

Score winning cdna yields with SuperScript III RT

Score winning cdna yields with SuperScript III RT Score winning cdna yields with RT SuperScript III offers: Higher cdna yields Higher thermal stability Longer half-life than any other RT you could use Announcing SuperScript III Reverse Transcriptase How

More information

Southern Blotting MSU Potato Lab

Southern Blotting MSU Potato Lab Southern Blotting MSU Potato Lab A. DNA AGAROSE GEL 1. Prepare a 1% agarose gel and load 5 μl of BMB Molecular Weight Marker DIG labeled in one lane. 2. Mix 20μg Plant Genome DNA (which has been digested

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Restriction Endonucleases, (cutting dna) (ligation)

More information

Cat. # R006A. For Research Use. TaKaRa Z-Taq DNA Polymerase. Product Manual. v201411da

Cat. # R006A. For Research Use. TaKaRa Z-Taq DNA Polymerase. Product Manual. v201411da Cat. # R006A For Research Use TaKaRa Z-Taq DNA Polymerase Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Specifications... 3 IV. Optimization of Reaction Conditions... 4

More information

Copy Kit. Version G Copy Kit. cdna Synthesis System. Catalog no. L

Copy Kit. Version G Copy Kit. cdna Synthesis System. Catalog no. L Copy Kit Version G 022002 25-0013 Copy Kit cdna Synthesis System Catalog no. L1311-03 www.invitrogen.com tech_service@invitrogen.com ii Table of Contents Table of Contents...iii Kit Contents and Storage...

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

Learning Objectives :

Learning Objectives : Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in

More information

3'-Full RACE Core Set

3'-Full RACE Core Set Table of Contents Description... 2 Principle... 4 Preparation of RNA Sample... 5 Note... 5 Protocol 1. General Protocol... 6 2. Application example... 8 Also available from Takara PCR related products

More information

BCMB Chapters 34 & 35 DNA Replication and Repair

BCMB Chapters 34 & 35 DNA Replication and Repair BCMB 3100 - Chapters 34 & 35 DNA Replication and Repair Semi-conservative DNA replication DNA polymerase DNA replication Replication fork; Okazaki fragments Sanger method for DNA sequencing DNA repair

More information

Product Name : Simple mirna Detection Kit

Product Name : Simple mirna Detection Kit Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components

More information

NEBNext Ultra Ligation Module

NEBNext Ultra Ligation Module LIBRARY PREPARATION NEBNext Ultra Ligation Module Instruction Manual NEB #E7445S/L 24/96 reactions This product is intended for research purposes only. This product is not intended to be used for therapeutic

More information

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template

More information

Strep-tag detection in Western blots

Strep-tag detection in Western blots Strep-tag detection in Western blots General protocol for the detection of Strep-tag fusion proteins Last date of revision April 2012 Version PR07-0010 www.strep-tag.com For research use only Important

More information

BIOO RESEARCH PRODUCTS. ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205

BIOO RESEARCH PRODUCTS. ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205 BIOO RESEARCH PRODUCTS ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205 BIOO Scientific Corp. 2010 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure Overview... 2 Kit

More information

Guidelines for Preventing Contamination of PCR Reference Guidelines for Primer Design Estimation of Primer Melting Temperature

Guidelines for Preventing Contamination of PCR Reference Guidelines for Primer Design Estimation of Primer Melting Temperature Guidelines for Preventing Contamination of PCR During PCR more than 10 million copies of a template DNA are generated. Therefore, care must be taken to avoid contamination with other templates and amplicons

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

Cut Smarter with NEB Restriction Enzymes

Cut Smarter with NEB Restriction Enzymes ut Smarter with EB Restriction Enzymes A Smarter Look Keep track of your enzyme data with our new, streamlined protocol cards. These collectible cards contain all the information you need for setting up

More information

Lecture 14 - PCR Applications and Lab Practicum (AMG text pp ) October 9, 2001

Lecture 14 - PCR Applications and Lab Practicum (AMG text pp ) October 9, 2001 Lecture 14 - PCR Applications and Lab Practicum (AMG text pp. 159-169) October 9, 2001 Diagnostic Applications of PCR There are three primary diagnostic applications of PCR: - detecting pathogens using

More information

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

Dephosphorylated DNA. 5 HO OH 3 + [γ- P]ATP 3 HO OH 5. FIGURE 1. T4 Polynucleotide Kinase Forward Reaction. OH 3 + ADP + [γ- P 5

Dephosphorylated DNA. 5 HO OH 3 + [γ- P]ATP 3 HO OH 5. FIGURE 1. T4 Polynucleotide Kinase Forward Reaction. OH 3 + ADP + [γ- P 5 FOCUS Introduction ON APPLICATIONS T4 Polynucleotide Kinase Technical Bulletin 18004-2 T4 polynucleotide kinase contains a 5 kinase activity and a 3 phosphatase activity (1-3). It catalyzes the addition

More information

Technical tips Session 5

Technical tips Session 5 Technical tips Session 5 Chromatine Immunoprecipitation (ChIP): This is a powerful in vivo method to quantitate interaction of proteins associated with specific regions of the genome. It involves the immunoprecipitation

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

KAPA Library Preparation Kits

KAPA Library Preparation Kits Technical Data Sheet KAPA Library Preparation Kits Illumina series Product Description The KAPA Library Preparation Kit provides all of the enzymes and reaction buffers required for constructing libraries

More information

Why adapter ligation? Ligases. Oligonucleotide ligases. Definition of ligase

Why adapter ligation? Ligases. Oligonucleotide ligases. Definition of ligase Why adapter ligation? Ligases Introduction to s in general, and RA 1 / RA 2, truncated in particular mira bacterial mra -P unknown sequence 3 -H -PPP unknown sequence 3 -H 3 adapter LIGASE catalyzed known

More information

Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA).

Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA). 175 Appendix III Chapter 4 Methods General. Unless otherwise noted, reagents were purchased from the commercial suppliers Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further

More information

Transcription & post transcriptional modification

Transcription & post transcriptional modification Transcription & post transcriptional modification Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be transferred from DNA to RNA Similarity

More information

Cat. # For Research Use. BcaBEST Labeling Kit. Product Manual. v201701da

Cat. # For Research Use. BcaBEST Labeling Kit. Product Manual. v201701da Cat. # 6046 For Research Use BcaBEST Labeling Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Principles... 4 V. Protocol... 5 VI. Effect of Template

More information

Protoscript II RT-PCR Kit. I n s t r u c t i o n M a n u a l NEW ENGLAND. BioLabs. Version 1.2 3/07. Catalog #E6400S Store at 20 C. Inc.

Protoscript II RT-PCR Kit. I n s t r u c t i o n M a n u a l NEW ENGLAND. BioLabs. Version 1.2 3/07. Catalog #E6400S Store at 20 C. Inc. Protoscript II RT-PCR Kit I n s t r u c t i o n M a n u a l Catalog #E6400S Store at 20 C NEW ENGLAND BioLabs Inc. Version 1.2 3/07 Table of Contents: Supplied Components.................................................................................

More information

TECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70

TECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70 GenElute mrna Miniprep Kit Catalog Numbers MRN 10, MRN 70 TECHNICAL BULLETIN Product Description The GenElute mrna Miniprep Kit provides a simple and convenient way to purify polyadenylated mrna from previously

More information

Introduction to Real-Time PCR: Basic Principles and Chemistries

Introduction to Real-Time PCR: Basic Principles and Chemistries Introduction to Real-Time PCR: Basic Principles and Chemistries Leta Steffen, PhD Applications Scientist Promega Corporation Outline I. Real-Time PCR overview Basics of Real-Time PCR Understanding the

More information

1. COMPONENTS. PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) 2. STORAGE 3. DESCRIPTION

1. COMPONENTS. PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) 2. STORAGE 3. DESCRIPTION 1 2 1 PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) TABLE OF CONTENTS 1. COMPONENTS... 2 2. STORAGE... 2 3. DESCRIPTION... 2 4. PROTOCOL FOR FAST PCR... 3 4.1. General Considerations...

More information

CELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector)

CELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Catalog number: CTG-CAS9-18 Introduction The vector Lenti-EF1 -Cas9-EGFP-U6 sgrna is designed for

More information

NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1)

NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) LIBRARY PREPARATION NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) Instruction Manual NEB #E7300S/L 24/96 reactions Sign up for the NEBNext e-newsletter Scan this code or visit www.neb.com/

More information

TrueORF TM cdna Clones and PrecisionShuttle TM Vector System

TrueORF TM cdna Clones and PrecisionShuttle TM Vector System TrueORF TM cdna Clones and PrecisionShuttle TM Vector System Application Guide Table of Contents Package Contents and Storage Conditions... 2 Related, Optional Reagents... 2 Related Products... 2 Available

More information

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time) Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.

More information

DNA Hybridization and Detection

DNA Hybridization and Detection Chapter 6 DNA Hybridization and Detection Fluorescence Polarization Detection of DNA Hybridization........................................................ 6-2 Introduction.............................................................................................................

More information

RNA LA PCR Kit (AMV) Ver.1.1

RNA LA PCR Kit (AMV) Ver.1.1 Table of Contents I. Description... 2 II. Kit Components... 2 III. Reagents not supplied in the kit... 3 IV. Equipment required... 3 V. Storage... 3 VI. References... 3 VII. Principle... 4 VIII. Features...

More information

RNA Clean-Up and Concentration Kit Product # 23600, 43200

RNA Clean-Up and Concentration Kit Product # 23600, 43200 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com RNA Clean-Up and Concentration Kit Product # 23600, 43200 Product

More information

DNA Replication II Biochemistry 302. January 25, 2006

DNA Replication II Biochemistry 302. January 25, 2006 DNA Replication II Biochemistry 302 January 25, 2006 Following in Dad s footsteps Original A. Kornberg E. coli DNA Pol I is a lousy replicative enzyme. 400 molecules/cell but ~2 replication forks/cell

More information

Site-directed Mutagenesis

Site-directed Mutagenesis Site-directed Mutagenesis Applications Subtilisin (Met à Ala mutation resistant to oxidation) Fluorescent proteins Protein structure-function Substrate trapping mutants Identify regulatory regions/sequences

More information

Library Preparation for Illumina Sequencing

Library Preparation for Illumina Sequencing Materials Library Preparation for Illumina Sequencing Cleanup Kits: Ampure Store in +4 o C: Fermentas 1kb Ladder, Low Mass Ladder Phusion DNA polymerase, NEB Cat# F-531 (-20 o C for long term storage)

More information

in-situ PCR Presented for: Presented by: Date:

in-situ PCR Presented for: Presented by: Date: in-situ PCR Presented for: Presented by: Date: 2 in situ Hybridization - Definition in situ PCR is a method in which the polymerase chain reaction actually takes place in the cell on a slide, and the product

More information

Manipulation of Purified DNA

Manipulation of Purified DNA Manipulation of Purified DNA To produce the recombinant DNA molecule, the vector, as well as the DNA to be cloned, must be cut at specific points and then joined together in a controlled manner by DNA

More information

Microarray Protocols Version 1 December 21, 2007

Microarray Protocols Version 1 December 21, 2007 Microarray Protocols Version 1 December 21, 2007 Table of Contents: Genomic DNA Labelling 2 Post-Processing of Oligo Arrays on Epoxy and Amine Coated Slides 4 RNA Extraction 5 cdna Labelling 8 RNA Isolation

More information

PRODUCT INFORMATION Long PCR Enzyme Mix #K0182 500 u Lot Exp. 00.0000 Store at -20 C. CERTIFICATE OF ANALYSIS Long PCR Enzyme Mix is functionally tested in PCR amplification of 47.4 kb fragment from lambda

More information

Table of contents. I. Description...2. Kit Components...2. Reagents not supplied in the kit...3. Equipment required...3. V. Storage...3. Reference...

Table of contents. I. Description...2. Kit Components...2. Reagents not supplied in the kit...3. Equipment required...3. V. Storage...3. Reference... Table of contents I. Description...2 II. III. IV. Kit Components...2 Reagents not supplied in the kit...3 Equipment required...3 V. Storage...3 VI. Reference...3 VII. Principles...4 VIII. Features...5

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

CELLTECHGEN For Research Only. Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector)

CELLTECHGEN For Research Only. Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector) Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector) Catalog number: CTG-CAS9-11 Introduction The vector Lenti-U6 sgrna-ef1 -Puro is designed for expression

More information