Cell lines and cell culture. GM08505 is an SV40-transformed skin fibroblast cell line
|
|
- Lawrence Parks
- 6 years ago
- Views:
Transcription
1 Materials and Methods Cell lines and cell culture. GM08505 is an SV40-transformed skin fibroblast cell line derived from a BS patient and contains the BLM Ash founder mutation identified in patients of Ashkenazi Jewish origin 1. The PSNF5 and PSNG13 cells have been described previously 2,3 and were derived from GM08505 cells following transfection with a construct expressing flag epitope-tagged BLM protein or the pcdna3 vector, respectively. PSNF5 cells are considered to be phenotypically corrected in that the high frequency of sister-chromatid exchanges (SCEs) diagnostic of BS cells is suppressed to near normal levels in this cell line 2,3. Stable transfectants of GM08505 cell line expressing BLM-T99A, BLM-T122A or BLM- T99A/T122A have been described previously 2. The GM08505 derivatives expressing wildtype BLM or BLM-K695T protein were a kind gift of M. Sanz and J. German, and were described elsewhere 4. All cells were grown in α-mem (minimal essential medium) culture medium containing 10% fetal calf serum and 3mM glutamine at 37 C in a humidified atmosphere containing 5% CO 2. DNA replication inhibitors and clonogenic cell survival analyses. Aphidicolin, HU, gemcytabine and cytosine arabinoside (Ara C) were obtained from Sigma. The CDK inhibitor, roscovitine, was obtained from Calbiochem. Aphidicolin was dissolved in DMSO, and the other agents were dissolved in water. Clonogenic survival analyses were performed as described by Davies et al. 2.
2 Western blotting. Cell extracts were prepared and Western blotting for BLM was conducted using the IHIC34 rabbit polyclonal antibody, as described by Wu et al. 5. β-tubulin was used as a loading control and was detected using the tub2.1 monoclonal antibody (Sigma). Preparation and immunolabeling of chromosome fibers. Cells were exposed to 20 M IdU for 10 minutes to label sites of active replication. Following a 15 minute exposure to 50 M thymidine, cells were left untreated or were exposed to either aphidicolin (30 M) or HU (4mM) for up to 6 hours. The cells were then incubated in drug-free medium for 20 minutes to allow for replication fork re-start in the presence of 100 M CldU, unless stated otherwise. Chromosome spreads were prepared as described by Jackson and Pombo 6 with the modifications described by Merrick et al. 7. Slides were acid treated with 2.5M HCl for 1 hour, neutralized in 0.1M Na 3 B 4 O 7, ph 8.5, for 7 minutes, and were then washed several times in phosphate buffered saline (PBS). Samples were then blocked for 30 minutes with 1% BSA and 0.1% Tween 20 in PBS. Antibodies were diluted in blocking buffer as follows: anti-cldu, 1:40; anti-mouse Alexafluor 488, 1:200; anti-idu, 1:2; anti-rat Cy3, 1:900. Incubations with antibodies were carried out at 37 C for 1 hour (for primary antibodies) or 45 minutes (for secondary antibodies). The incubation with the IdU antibody was followed by a high salt wash with buffer (29.2g NaCl, 4.44g Tris-HCI, 0.5% Tween 20 and 1 litre H 2 O) at 20 C for 7 minutes, to increase antibody specificity and discrimination. Slides were mounted in anti-fade (90% glycerol, 20mM Tris-HCl, ph 8.0, 50 g/ml paraphenylenediamine) prior to analysis using a Zeiss Axioskop microscope. Replication fork activity was calculated by dividing the number of sites of continuing replication [A+B; as depicted on the right of panel (a)] by the total number of IdU-containing sites [A+B+D]. More than 50 individual fibers were analyzed in each experiment and the data presented represent the mean of at least 3 independent experiments.
3 Supplementary References 1. Ellis, N.A. et al. Cell 83, (1995). 2. Davies, S.L., North, P.S., Dart, A., Lakin, N.D. & Hickson, I.D. Mol. Cell. Biol. 24, (2004). 3. Gaymes, T.J. et al. Oncogene 21, (2002). 4. Neff, N.F. et al.. J. Biol. Chem. 275, (2000). 6. Jackson, D.A. & Pombo, A. J. Cell Biol. 140, (1998). 7. Merrick, C.J., Jackson, D. & Diffley, J.F. J. Biol. Chem. 279, (2004).
4 Supplementary Figure Legends Supplementary Figure 1. BS cells are hypersensitive to drugs that inhibit DNA replication. Clonogenic cell survival analyses were conducted on PSNF5 (BLM + ; ) and PSNG13 (BLM - ; ϒ) cells following a 24 hour exposure to aphidicolin (panel a), gemcytabine (panel b) or ara C (panel c) at the doses indicated. Experiments were performed in triplicate and the error bars represent the standard errors of the mean. Supplementary Figure 2. BLM is required for efficient replication fork restart following replication blockade. (a) Effect of varying recovery time on replication fork activity following aphidicolin treatment of 30 M for 6 hours. (b) Effects of a 6 hour exposure to aphidicolin or HU compared to untreated controls in untransformed MRC5 cells (BLM + ; black bars) and GM1492 (BLM - ; open bars) cells. Supplementary Figure 3. The active site lysine (K695) and the Thr-99 target site for ATR are required for cell survival after replication blockade. Survival curves were generated for the cell lines indicated as described in the Supplementary Figure 1 legend. Panels (a) and (c) show sensitivity to aphidicoln and panels (b) and (d) show sensitivity to HU. Supplementary Figure 4. Expression of BLM proteins in transfected BS cells. Western blotting analysis to indicate levels of the BLM, BLM-T99A, BLMT122A, and BLM- T99A/T122A proteins in the different transfectants. β-tubulin was used as a loading control. Supplementary Figure 5. The active site of BLM is required for suppression of new origin firing. Number of new sites of replication visible during a 20 minute recovery period
5 following exposure to 30 M or 4mM HU in an isogenic set of cell lines expressing wild-type BLM (black), no BLM (white) or BLM-K695T (red).
Phosphorylation of the Bloom s Syndrome Helicase and Its Role in Recovery from S-Phase Arrest
MOLECULAR AND CELLULAR BIOLOGY, Feb. 2004, p. 1279 1291 Vol. 24, No. 3 0270-7306/04/$08.00 0 DOI: 10.1128/MCB.24.3.1279 1291.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved.
More informationSUPPLEMENTARY INFORMATION FIGURE 1 - 1
SUPPLEMENTARY INFORMATION FIGURE 1-1 SUPPLEMENTARY INFORMATION FIGURE 2-2 SUPPLEMENTARY INFORMATION METHODS GST-Pull-Down. Cultures of E. Coli (BL21) were transformed with pgex (Clontech) and pgex recombinant
More informationSupplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto
Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in
More informationHEK293A cells were cultured in high glucose (4.500 mg/l) Dulbecco s modified
Additional methods: HEK293A and C7 cell cultures HEK293A cells were cultured in high glucose (4.500 mg/l) Dulbecco s modified Eagle s medium (DMEM) with GlutaMAX I (Invitrogen, Cergy Pontoise, France),
More informationPolyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous
Preparation and purification of polyclonal antibodies Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous injections of glutathione S-transferase-ARHGAP25-(509-619) (GST-coiled
More informationProtocol for induction of expression and cell lysate production
Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected
More informationPlasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System
Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,
More informationab Ubiquitylation Assay Kit (HeLa lysate-based)
ab139471 Ubiquitylation Assay Kit (HeLa lysate-based) Instructions for Use For the generation of ubiquitin-conjugated lysate proteins This product is for research use only and is not intended for diagnostic
More informationModified Rapid MAIPA Protocol
Modified Rapid MAIPA Protocol This method is based on the following publication; K Campbell, K Rishi, G Howkins, D Gilby, R Mushens, C Ghevaert, P Metcalfe, WH Ouwehand, G Lucas. A modified fast MAIPA
More informationFor identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells.
ab110216 MitoBiogenesis TM In-Cell ELISA Kit (IR) Instructions for Use For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells. This product is for research use
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationSegments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
More informationMitoBiogenesis In-Cell ELISA Kit (Colorimetric)
PROTOCOL MitoBiogenesis In-Cell ELISA Kit (Colorimetric) DESCRIPTION 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 MS643 Rev.2 For identifying inhibitors and activators of mitochondrial biogenesis
More informationAnti-Piscirickettsia salmonis monoclonal antibody. Product no: P05
Anti-Piscirickettsia salmonis monoclonal antibody Product no: P05 Product Description The monoclonal antibody (Mab) against Piscirickettsia salmonis is specific for this bacterium. The specificity of the
More informationAnti-Asian Sea bass (Lates calcarifer) IgM monoclonal antibody labelled with horseradish peroxidase. Product no: C2-HRP
Anti-Asian Sea bass (Lates calcarifer) IgM monoclonal antibody labelled with horseradish peroxidase Product no: C2-HRP Product Description This monoclonal antibody (Mab) reacts with Asian Sea bass (Lates
More informationManuscript Skeletal muscle Heat shock protein 60 increases after endurance training and induces peroxisome proliferator-activated
Supplementary informations Manuscript Skeletal muscle Heat shock protein 60 increases after endurance training and induces peroxisome proliferator-activated receptor gamma coactivator 1 α1 expression Rosario
More informationSupplemental Data Supplementary Figure Legends and Scheme Figure S1.
Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,
More informationO-GlcNAcase Activity Assay
O-GlcNAcase Activity Assay Prepared by Jen Groves and Junfeng Ma, The Johns Hopkins Unviersity School of Medicine Based on: Macauley MS et al., 2005. O-GlcNAcase uses substrate-assisted catalysis: kinetic
More informationCulture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands).
Methods Materials Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands). Bovine fibroblast growth factor (BFGF), thrombin, forskolin, IBMX, H-89, BAPTA-AM and
More information*Corresponding author. Tel: ;
1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland
More informationSupplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
More informationSUPPLEMENTARY INFORMATION. Transcriptional output transiently spikes upon mitotic exit
SUPPLEMENTARY INFORMATION Transcriptional output transiently spikes upon mitotic exit Viola Vaňková Hausnerová 1, 2, Christian Lanctôt 1* 1 BIOCEV and Department of Cell Biology, Faculty of Science, Charles
More informationBeta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand
SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin
More informationThis Document Contains:
This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular
More informationHuman IL-10 ELISA MAX Set Deluxe
Human IL-10 ELISA MAX Set Deluxe Cat. No. 430604 (5 plates) 430605 (10 plates) 430606 (20 plates) ELISA Set for Accurate Cytokine Quantification from Cell Culture Supernatant, Serum, Plasma or Other Body
More informationAnti-White Spot Syndrome Virus (WSSV) monoclonal antibody. Product no: P13
Anti-White Spot Syndrome Virus (WSSV) monoclonal antibody Product no: P13 Product Description The monoclonal antibody (Mab) against the Vp28 protein of White Spot Syndrome Virus (WSSV) is specific for
More informationSmooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation
Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationElectronic Supplementary Information Sensitive detection of polynucleotide kinase using rolling circle amplification-induced chemiluminescence
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Sensitive detection of polynucleotide kinase
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationIgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only
IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationHuman IgG Antigen ELISA Kit
Human IgG Antigen ELISA Kit Catalog No: IHUIGGKT Lot No: SAMPLE INTENDED USE This human immunoglobulin G antigen assay is intended for the quantitative determination of total human IgG antigen in serum,
More informationPROTOCOL TO PREPARE PLANTAR FOOTSKIN FOR MORPHOMETRY. I. Removal and Fixation of Plantar Skin (see video)
PROTOCOL TO PREPARE PLANTAR FOOTSKIN FOR MORPHOMETRY I. Removal and Fixation of Plantar Skin (see video) 1. Sacrifice the animal a. Anaesthetize the animal by placing in a closed chamber with isoflurane.
More informationSupplemental information
Supplemental information - Control samples (200 subjects) - Immunohistochemistry of rat brain - Immunocytochemistry on neuronal cultures - Immunocompetition assay - Immunoprecipitation - Immunocytochemistry
More informationGeneric DELFIA Reagents
AD0005P-12 (en) 1 Generic DELFIA Reagents For Research Use Only These instructions for use apply to the following reagents: AD0038 DELFIA Eu-N1 PY20 antibody 50 µg vial AD0039 DELFIA Eu-N1 PY20 antibody
More informationWesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits
WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits Code N221-KIT N220-KIT Description WesternMAX Chemiluminescent AP Kit, Anti-Mouse Includes: Alkaline Phosphatase (AP) Conjugated Anti-Mouse
More informationby Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL
Supplementary Materials and methods Neuronal cultures and transfection The hippocampus was dissected from E8 rat embryos, dissociated, and neurons plated onto glass coverslips coated with poly-ornithine
More informationDetection and identification of body fluid stains using antibodynanoparticle
Electronic Supplementary Information Detection and identification of body fluid stains using antibodynanoparticle conjugates Nunzianda Frascione,* a Richard Thorogate a, Barbara Daniel a and Sue Jickells
More informationHuman IL10RB ELISA Pair Set ( CRFB4 )
Human IL10RB ELISA Pair Set ( CRFB4 ) Catalog Number : SEK10945 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in the
More informationSensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*
Catalog # Kit Size SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* AS-55550 One 96-well strip plate This kit is optimized to detect human/mouse/rat alpha-synuclein
More informationWhole Mount IHC Protocol
Whole Mount IHC Protocol Authors: Ruth Sullivan, Ryan Trevena and Kyle Wegner Creation Date: 03/17/2016 All steps should be conducted with gentle agitation on an orbital shaker, unless otherwise instructed.
More informationKinase Reaction and Alkylation Protocol
Kinase Reaction and Alkylation Protocol Protocol for the treatment of substrates prior to detection by Thiophosphate Ester antibodies This product is for research use only and is not intended for diagnostic
More informationFor the development of sandwich ELISAs to measure phosphorylated Vascular Endothelial Growth Factor Receptor 1 (VEGF R1/Flt-1) in cell lysates.
DuoSet IC Human Phospho-VEGF R1/Flt-1 Catalog Number DYC4170-2 Catalog Number DYC4170-5 For the development of sandwich ELISAs to measure phosphorylated Vascular Endothelial Growth Factor Receptor 1 (VEGF
More informationSupplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
More informationHow to run Alpha assay: How to setup an Alpha assay Make your own assay!
How to run Alpha assay: How to setup an Alpha assay Make your own assay! 1 2009 PerkinElmer AlphaLISA kits - recommendations before starting the assay Samples: Phenol red and hemoglobin: choose AlphaLISA
More informationIKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα
More informationHuman Granulin / GRN / Progranulin ELISA Pair Set
Human Granulin / GRN / Progranulin ELISA Pair Set Catalog Number : SEKA10826 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized
More informationCytoGLOW. IKK-α/β. Colorimetric Cell-Based ELISA Kit. Catalog #: CB5358
CytoGLOW IKK-α/β Colorimetric Cell-Based ELISA Kit Catalog #: CB5358 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only.
More informationSUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells
SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal
More informationFigure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
More informationConvoy TM Transfection Reagent
Convoy TM Transfection Reagent Catalog No.11103 0.25ml (40-80 transfections in 35mm dishes) Catalog No.11105 0.5 ml (80-165 transfections in 35mm dishes) Catalog No.11110 1.0 ml (165-330 transfections
More informationColeman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
More informationMaterials and Methods: All strains were derivatives of SK1 and are listed in Supplemental Table 1.
Supplemental Online Material: Materials and Methods: All strains were derivatives of SK1 and are listed in Supplemental Table 1. Constructs: pclb2-3ha-cdc5 and pclb2-3ha-cdc2 strains were constructed by
More informationMouse Factor XII Total ELISA Kit
Mouse Factor XII Total ELISA Kit Catalog No: IMFXIIKT-TOT Lot No: SAMPLE INTENDED USE This mouse coagulation Factor XII antigen assay is intended for the quantitative determination of total Factor XII
More informationOPPF-UK Standard Protocols: Mammalian Expression
OPPF-UK Standard Protocols: Mammalian Expression Joanne Nettleship joanne@strubi.ox.ac.uk Table of Contents 1. Materials... 3 2. Cell Maintenance... 4 3. 24-Well Transient Expression Screen... 5 4. DNA
More informationMATERIAL DATA SHEET. NOTE: Kit contains reagents sufficient for 10 x 30 μl reactions and 5 Western Blots (minigel. Reagents Provided in Kit
Lot # XXXXX ITCH/AIP4 Ubiquitin Ligase Kit Cat. # K-270 MATERIAL DATA SHEET The mammalian Itchy homolog, or ITCH, (also known as Atrophin-1-interacting protein 4 or AIP4) is a HECT domain class ubiquitin
More informationab G alpha i Activation Assay Kit
ab173234 G alpha i Activation Assay Kit Instructions for Use For the simple and fast measurement of G alpha i activation. This product is for research use only and is not intended for diagnostic use. Version
More informationIMMUNOPRECIPITATION (IP)
1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us
More informationCell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential
Supporting Online Material Materials and methods Cell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential Medium (Gibco BRL, Invitrogen Corporation, Carlsbad, CA, USA), supplemented
More informationTransfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
More informationApoTrack Cytochrome c Apoptosis ICC Antibody
ab110417 ApoTrack Cytochrome c Apoptosis ICC Antibody Instructions for Use For the Immunocytochemistry analysis of cytochrome c and a mitochondrial marker (Complex Vα) in apoptotic cells and nonapoptotic
More informationImmunohistochemistry with APAAPstaining Authors
v Immunohistochemistry with APAAPstaining Authors S. Raffegerst Date 30-10-2007 Background Version 1.0 The immunohistochemistry method allows the identification of cells with expression of specific surface
More informationDiscovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A
Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Contacts: Marty Simonetti martysimonetti@gmail.com Kirby Alton kirby.alton@abeomecorp.com Rick Shimkets
More informationTECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure
Cell-Based ELISA Kit for detecting phospho-stat3 (ptyr 705 ) in cultured cell lines adequate for 96 assays (1 96 well plate) Catalog Number RAB0444 Storage Temperature 20 C TECHNICAL BULLETIN Product Description
More informationStrep-tag detection in Western blots
Strep-tag detection in Western blots General protocol for the detection of Strep-tag fusion proteins Last date of revision April 2012 Version PR07-0010 www.strep-tag.com For research use only Important
More informationPreparing Cell Cultures of Human Embryonic Kidney
Preparing Cell Cultures of Human Embryonic Kidney Cells: Clone 293T Submitted by Devin Mollegard, Lab Partner: Megan Wydner 4 November 2015 Abstract Biology is the complex study of life which studies time
More informationMultiplex Fluorescent Western Blot Starter Kit for the Bio- Rad ChemiDoc MP
Page 1 of 7 INSTRUCTIONS: Z-310 Multiplex Fluorescent Western Blot Starter Kit for the Bio- Rad ChemiDoc MP Rockland Immunochemicals and Bio-Rad Laboratories have jointly developed an easy to use multiplex
More informationMouse ICAM-1 / CD54 ELISA Pair Set
Mouse ICAM-1 / CD54 ELISA Pair Set Catalog Number : SEK50440 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in the General
More informationab Ubiquitylation Assay Kit
ab139467 Ubiquitylation Assay Kit Instructions for Use For the activation of ubiquitin for use in ubiquitylation experiments This product is for research use only and is not intended for diagnostic use.
More informationab Alkaline Phosphatase Conjugation Kit Protocol
ab102850 Alkaline Phosphatase Conjugation Kit Protocol Antibody and protein modification This product is for research use only and is not intended for diagnostic use. Version 2 Last Updated 12 March 2014
More informationA Bridging Immunogenicity Assay Using SPARCL TM Technology
A Bridging Immunogenicity Assay Using SPARCL TM Technology Wenhua F. Xie Lumigen Inc., a Beckman Coulter Company INTRODUCTION Evaluating the immune response in patients is an important aspect associated
More informationSupporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
More informationINOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807
INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended
More informationTo isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well
Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at
More informationSUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement
SUPPLEMENTAL MATERIAL Supplemental Methods Reagents Cumate solution was from System Biosciences. Human complement Cq and complement C-esterase inhibitor (C-INH) were from Calbiochem. C-INH (Berinert) for
More informationPARP-1 (cleaved) Human In-Cell ELISA Kit (IR)
ab110215 PARP-1 (cleaved) Human In-Cell ELISA Kit (IR) Instructions for Use For the quantitative measurement of Human PARP-1 (cleaved) concentrations in cultured adherent and suspension cells. This product
More informationProtein Purification Products. Complete Solutions for All of Your Protein Purification Applications
Protein Purification Products Complete Solutions for All of Your Protein Purification Applications FLAG-Tagged Protein Products EXPRESS with the pcmv-dykddddk Vector Set Fuse your protein of interest to
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationContaminant bovine transferrin assay
ILA Application Note Contaminant bovine transferrin assay INTRODUCTION Bovine transferrin, a 76, Dalton glycoprotein, is one of the constituents of bovine serum. Transferrin found in serum can be associated
More informationSimplifying Kinase Profiling Using ADP Detection with the Transcreener Kinase Assay Introduction Figure 1. Transcreener Kinase Assay Principle
Simplifying Kinase Profiling Using ADP Detection with the Transcreener Kinase Assay Karen M. Kleman-Leyer, Tony A. Klink, Thane A. Westermeyer and Robert G. Lowery Introduction A variety of HTS kinase
More informationab Antibody Serum Purification Kit (Protein A) Protocol
ab109209 Antibody Serum Purification Kit (Protein A) Protocol For preparing antibodies for conjugation The components of Ab109209 are fully compatible with our Conjugation kits however they are not compatible
More informationab Ran Activation Assay Kit
ab173247 Ran Activation Assay Kit Instructions for Use For the simple and fast measurement of Ran activation. This product is for research use only and is not intended for diagnostic use. Version 1 Last
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact
More informationConjugation Kit Protocol
ab102890 HRP Conjugation Kit Protocol Antibody and protein modification This product is for research use only and is not intended for diagnostic use. Version 5 Last Updated 1 July 2016 Table of Contents
More informationTotal Histone H3 Acetylation Detection Fast Kit (Fluorometric)
Total Histone H3 Acetylation Detection Fast Kit (Fluorometric) Catalog Number KA1539 48 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use...
More informationRabbit (monoclonal) Anti-FAK [py 397 ] Phosphospecific Antibody, Unconjugated
Rabbit (monoclonal) Anti-FAK [py 397 ] Phosphospecific Antibody, Unconjugated PRODUCT ANALYSIS SHEET Catalog Number: Lot Number: Volume: 44-625G (10 mini-blot size) See product label 100 μl Clone Number:
More informationReducing Non-Specific Binding in Surface Plasmon Resonance Experiments
1 Reducing Non-Specific Binding in Surface Plasmon Resonance Experiments SUMMARY Reducing non-specific binding (NSB) is essential to generating accurate data with SPR The effect of bovine serum albumin,
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
More informationHuman TGF-beta1 ELISA
K-ASSAY Human TGF-beta1 ELISA For the quantitative determination of TGF-beta1 in human cell culture supernates, serum, plasma (EDTA) and urine Cat. No. KT-1471 For Research Use Only. Not for diagnostic
More informationSupplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
More informationConverting your ELISA from horseradish peroxidase to alkaline phosphatase using NovaBright chemiluminescence detection reagents
Application note DynaLight Substrate with RapidGlow Enhancer Converting your ELISA from horseradish peroxidase to alkaline phosphatase using NovaBright chemiluminescence detection reagents Introduction
More informationEGFR (Phospho-Ser695)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely
More informationManufactured by. Zyagen Barnes Canyon Road San Diego, CA 92121, USA
Alkaline Phosphatase Immunohistochemistry Detection kits For detection of mouse, rabbit, goat, rat, sheep, chicken, guinea pig, and human primary antibodies Size: 500 Tests Catalog #: AK-011, Mouse Kit
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationab Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit
ab128967 - Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit Instructions for Use For the detection of a specific antibody bound to an antigen in tissue sections. This product is for research use only
More informationIn Vitro Diagnostic Products
In Vitro Diagnostic Products Rely on Rockland for Unparalleled Quality Diagnostic: Overview For over 50 years Rockland has provided a dedicated portfolio of general purpose reagents (GPR) used to collect,
More informationSupplementary Figure Legend
Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss
More information