Cell lines and cell culture. GM08505 is an SV40-transformed skin fibroblast cell line

Size: px
Start display at page:

Download "Cell lines and cell culture. GM08505 is an SV40-transformed skin fibroblast cell line"

Transcription

1 Materials and Methods Cell lines and cell culture. GM08505 is an SV40-transformed skin fibroblast cell line derived from a BS patient and contains the BLM Ash founder mutation identified in patients of Ashkenazi Jewish origin 1. The PSNF5 and PSNG13 cells have been described previously 2,3 and were derived from GM08505 cells following transfection with a construct expressing flag epitope-tagged BLM protein or the pcdna3 vector, respectively. PSNF5 cells are considered to be phenotypically corrected in that the high frequency of sister-chromatid exchanges (SCEs) diagnostic of BS cells is suppressed to near normal levels in this cell line 2,3. Stable transfectants of GM08505 cell line expressing BLM-T99A, BLM-T122A or BLM- T99A/T122A have been described previously 2. The GM08505 derivatives expressing wildtype BLM or BLM-K695T protein were a kind gift of M. Sanz and J. German, and were described elsewhere 4. All cells were grown in α-mem (minimal essential medium) culture medium containing 10% fetal calf serum and 3mM glutamine at 37 C in a humidified atmosphere containing 5% CO 2. DNA replication inhibitors and clonogenic cell survival analyses. Aphidicolin, HU, gemcytabine and cytosine arabinoside (Ara C) were obtained from Sigma. The CDK inhibitor, roscovitine, was obtained from Calbiochem. Aphidicolin was dissolved in DMSO, and the other agents were dissolved in water. Clonogenic survival analyses were performed as described by Davies et al. 2.

2 Western blotting. Cell extracts were prepared and Western blotting for BLM was conducted using the IHIC34 rabbit polyclonal antibody, as described by Wu et al. 5. β-tubulin was used as a loading control and was detected using the tub2.1 monoclonal antibody (Sigma). Preparation and immunolabeling of chromosome fibers. Cells were exposed to 20 M IdU for 10 minutes to label sites of active replication. Following a 15 minute exposure to 50 M thymidine, cells were left untreated or were exposed to either aphidicolin (30 M) or HU (4mM) for up to 6 hours. The cells were then incubated in drug-free medium for 20 minutes to allow for replication fork re-start in the presence of 100 M CldU, unless stated otherwise. Chromosome spreads were prepared as described by Jackson and Pombo 6 with the modifications described by Merrick et al. 7. Slides were acid treated with 2.5M HCl for 1 hour, neutralized in 0.1M Na 3 B 4 O 7, ph 8.5, for 7 minutes, and were then washed several times in phosphate buffered saline (PBS). Samples were then blocked for 30 minutes with 1% BSA and 0.1% Tween 20 in PBS. Antibodies were diluted in blocking buffer as follows: anti-cldu, 1:40; anti-mouse Alexafluor 488, 1:200; anti-idu, 1:2; anti-rat Cy3, 1:900. Incubations with antibodies were carried out at 37 C for 1 hour (for primary antibodies) or 45 minutes (for secondary antibodies). The incubation with the IdU antibody was followed by a high salt wash with buffer (29.2g NaCl, 4.44g Tris-HCI, 0.5% Tween 20 and 1 litre H 2 O) at 20 C for 7 minutes, to increase antibody specificity and discrimination. Slides were mounted in anti-fade (90% glycerol, 20mM Tris-HCl, ph 8.0, 50 g/ml paraphenylenediamine) prior to analysis using a Zeiss Axioskop microscope. Replication fork activity was calculated by dividing the number of sites of continuing replication [A+B; as depicted on the right of panel (a)] by the total number of IdU-containing sites [A+B+D]. More than 50 individual fibers were analyzed in each experiment and the data presented represent the mean of at least 3 independent experiments.

3 Supplementary References 1. Ellis, N.A. et al. Cell 83, (1995). 2. Davies, S.L., North, P.S., Dart, A., Lakin, N.D. & Hickson, I.D. Mol. Cell. Biol. 24, (2004). 3. Gaymes, T.J. et al. Oncogene 21, (2002). 4. Neff, N.F. et al.. J. Biol. Chem. 275, (2000). 6. Jackson, D.A. & Pombo, A. J. Cell Biol. 140, (1998). 7. Merrick, C.J., Jackson, D. & Diffley, J.F. J. Biol. Chem. 279, (2004).

4 Supplementary Figure Legends Supplementary Figure 1. BS cells are hypersensitive to drugs that inhibit DNA replication. Clonogenic cell survival analyses were conducted on PSNF5 (BLM + ; ) and PSNG13 (BLM - ; ϒ) cells following a 24 hour exposure to aphidicolin (panel a), gemcytabine (panel b) or ara C (panel c) at the doses indicated. Experiments were performed in triplicate and the error bars represent the standard errors of the mean. Supplementary Figure 2. BLM is required for efficient replication fork restart following replication blockade. (a) Effect of varying recovery time on replication fork activity following aphidicolin treatment of 30 M for 6 hours. (b) Effects of a 6 hour exposure to aphidicolin or HU compared to untreated controls in untransformed MRC5 cells (BLM + ; black bars) and GM1492 (BLM - ; open bars) cells. Supplementary Figure 3. The active site lysine (K695) and the Thr-99 target site for ATR are required for cell survival after replication blockade. Survival curves were generated for the cell lines indicated as described in the Supplementary Figure 1 legend. Panels (a) and (c) show sensitivity to aphidicoln and panels (b) and (d) show sensitivity to HU. Supplementary Figure 4. Expression of BLM proteins in transfected BS cells. Western blotting analysis to indicate levels of the BLM, BLM-T99A, BLMT122A, and BLM- T99A/T122A proteins in the different transfectants. β-tubulin was used as a loading control. Supplementary Figure 5. The active site of BLM is required for suppression of new origin firing. Number of new sites of replication visible during a 20 minute recovery period

5 following exposure to 30 M or 4mM HU in an isogenic set of cell lines expressing wild-type BLM (black), no BLM (white) or BLM-K695T (red).

Phosphorylation of the Bloom s Syndrome Helicase and Its Role in Recovery from S-Phase Arrest

Phosphorylation of the Bloom s Syndrome Helicase and Its Role in Recovery from S-Phase Arrest MOLECULAR AND CELLULAR BIOLOGY, Feb. 2004, p. 1279 1291 Vol. 24, No. 3 0270-7306/04/$08.00 0 DOI: 10.1128/MCB.24.3.1279 1291.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved.

More information

SUPPLEMENTARY INFORMATION FIGURE 1 - 1

SUPPLEMENTARY INFORMATION FIGURE 1 - 1 SUPPLEMENTARY INFORMATION FIGURE 1-1 SUPPLEMENTARY INFORMATION FIGURE 2-2 SUPPLEMENTARY INFORMATION METHODS GST-Pull-Down. Cultures of E. Coli (BL21) were transformed with pgex (Clontech) and pgex recombinant

More information

Supplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto

Supplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in

More information

HEK293A cells were cultured in high glucose (4.500 mg/l) Dulbecco s modified

HEK293A cells were cultured in high glucose (4.500 mg/l) Dulbecco s modified Additional methods: HEK293A and C7 cell cultures HEK293A cells were cultured in high glucose (4.500 mg/l) Dulbecco s modified Eagle s medium (DMEM) with GlutaMAX I (Invitrogen, Cergy Pontoise, France),

More information

Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous

Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous Preparation and purification of polyclonal antibodies Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous injections of glutathione S-transferase-ARHGAP25-(509-619) (GST-coiled

More information

Protocol for induction of expression and cell lysate production

Protocol for induction of expression and cell lysate production Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected

More information

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,

More information

ab Ubiquitylation Assay Kit (HeLa lysate-based)

ab Ubiquitylation Assay Kit (HeLa lysate-based) ab139471 Ubiquitylation Assay Kit (HeLa lysate-based) Instructions for Use For the generation of ubiquitin-conjugated lysate proteins This product is for research use only and is not intended for diagnostic

More information

Modified Rapid MAIPA Protocol

Modified Rapid MAIPA Protocol Modified Rapid MAIPA Protocol This method is based on the following publication; K Campbell, K Rishi, G Howkins, D Gilby, R Mushens, C Ghevaert, P Metcalfe, WH Ouwehand, G Lucas. A modified fast MAIPA

More information

For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells.

For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells. ab110216 MitoBiogenesis TM In-Cell ELISA Kit (IR) Instructions for Use For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells. This product is for research use

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with

More information

MitoBiogenesis In-Cell ELISA Kit (Colorimetric)

MitoBiogenesis In-Cell ELISA Kit (Colorimetric) PROTOCOL MitoBiogenesis In-Cell ELISA Kit (Colorimetric) DESCRIPTION 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 MS643 Rev.2 For identifying inhibitors and activators of mitochondrial biogenesis

More information

Anti-Piscirickettsia salmonis monoclonal antibody. Product no: P05

Anti-Piscirickettsia salmonis monoclonal antibody. Product no: P05 Anti-Piscirickettsia salmonis monoclonal antibody Product no: P05 Product Description The monoclonal antibody (Mab) against Piscirickettsia salmonis is specific for this bacterium. The specificity of the

More information

Anti-Asian Sea bass (Lates calcarifer) IgM monoclonal antibody labelled with horseradish peroxidase. Product no: C2-HRP

Anti-Asian Sea bass (Lates calcarifer) IgM monoclonal antibody labelled with horseradish peroxidase. Product no: C2-HRP Anti-Asian Sea bass (Lates calcarifer) IgM monoclonal antibody labelled with horseradish peroxidase Product no: C2-HRP Product Description This monoclonal antibody (Mab) reacts with Asian Sea bass (Lates

More information

Manuscript Skeletal muscle Heat shock protein 60 increases after endurance training and induces peroxisome proliferator-activated

Manuscript Skeletal muscle Heat shock protein 60 increases after endurance training and induces peroxisome proliferator-activated Supplementary informations Manuscript Skeletal muscle Heat shock protein 60 increases after endurance training and induces peroxisome proliferator-activated receptor gamma coactivator 1 α1 expression Rosario

More information

Supplemental Data Supplementary Figure Legends and Scheme Figure S1.

Supplemental Data Supplementary Figure Legends and Scheme Figure S1. Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,

More information

O-GlcNAcase Activity Assay

O-GlcNAcase Activity Assay O-GlcNAcase Activity Assay Prepared by Jen Groves and Junfeng Ma, The Johns Hopkins Unviersity School of Medicine Based on: Macauley MS et al., 2005. O-GlcNAcase uses substrate-assisted catalysis: kinetic

More information

Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands).

Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands). Methods Materials Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands). Bovine fibroblast growth factor (BFGF), thrombin, forskolin, IBMX, H-89, BAPTA-AM and

More information

*Corresponding author. Tel: ;

*Corresponding author. Tel: ; 1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland

More information

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental

More information

SUPPLEMENTARY INFORMATION. Transcriptional output transiently spikes upon mitotic exit

SUPPLEMENTARY INFORMATION. Transcriptional output transiently spikes upon mitotic exit SUPPLEMENTARY INFORMATION Transcriptional output transiently spikes upon mitotic exit Viola Vaňková Hausnerová 1, 2, Christian Lanctôt 1* 1 BIOCEV and Department of Cell Biology, Faculty of Science, Charles

More information

Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand

Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin

More information

This Document Contains:

This Document Contains: This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular

More information

Human IL-10 ELISA MAX Set Deluxe

Human IL-10 ELISA MAX Set Deluxe Human IL-10 ELISA MAX Set Deluxe Cat. No. 430604 (5 plates) 430605 (10 plates) 430606 (20 plates) ELISA Set for Accurate Cytokine Quantification from Cell Culture Supernatant, Serum, Plasma or Other Body

More information

Anti-White Spot Syndrome Virus (WSSV) monoclonal antibody. Product no: P13

Anti-White Spot Syndrome Virus (WSSV) monoclonal antibody. Product no: P13 Anti-White Spot Syndrome Virus (WSSV) monoclonal antibody Product no: P13 Product Description The monoclonal antibody (Mab) against the Vp28 protein of White Spot Syndrome Virus (WSSV) is specific for

More information

Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation

Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang

More information

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of

More information

Electronic Supplementary Information Sensitive detection of polynucleotide kinase using rolling circle amplification-induced chemiluminescence

Electronic Supplementary Information Sensitive detection of polynucleotide kinase using rolling circle amplification-induced chemiluminescence Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Sensitive detection of polynucleotide kinase

More information

Confocal immunofluorescence microscopy

Confocal immunofluorescence microscopy Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,

More information

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective

More information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

More information

Human IgG Antigen ELISA Kit

Human IgG Antigen ELISA Kit Human IgG Antigen ELISA Kit Catalog No: IHUIGGKT Lot No: SAMPLE INTENDED USE This human immunoglobulin G antigen assay is intended for the quantitative determination of total human IgG antigen in serum,

More information

PROTOCOL TO PREPARE PLANTAR FOOTSKIN FOR MORPHOMETRY. I. Removal and Fixation of Plantar Skin (see video)

PROTOCOL TO PREPARE PLANTAR FOOTSKIN FOR MORPHOMETRY. I. Removal and Fixation of Plantar Skin (see video) PROTOCOL TO PREPARE PLANTAR FOOTSKIN FOR MORPHOMETRY I. Removal and Fixation of Plantar Skin (see video) 1. Sacrifice the animal a. Anaesthetize the animal by placing in a closed chamber with isoflurane.

More information

Supplemental information

Supplemental information Supplemental information - Control samples (200 subjects) - Immunohistochemistry of rat brain - Immunocytochemistry on neuronal cultures - Immunocompetition assay - Immunoprecipitation - Immunocytochemistry

More information

Generic DELFIA Reagents

Generic DELFIA Reagents AD0005P-12 (en) 1 Generic DELFIA Reagents For Research Use Only These instructions for use apply to the following reagents: AD0038 DELFIA Eu-N1 PY20 antibody 50 µg vial AD0039 DELFIA Eu-N1 PY20 antibody

More information

WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits

WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits Code N221-KIT N220-KIT Description WesternMAX Chemiluminescent AP Kit, Anti-Mouse Includes: Alkaline Phosphatase (AP) Conjugated Anti-Mouse

More information

by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL

by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL Supplementary Materials and methods Neuronal cultures and transfection The hippocampus was dissected from E8 rat embryos, dissociated, and neurons plated onto glass coverslips coated with poly-ornithine

More information

Detection and identification of body fluid stains using antibodynanoparticle

Detection and identification of body fluid stains using antibodynanoparticle Electronic Supplementary Information Detection and identification of body fluid stains using antibodynanoparticle conjugates Nunzianda Frascione,* a Richard Thorogate a, Barbara Daniel a and Sue Jickells

More information

Human IL10RB ELISA Pair Set ( CRFB4 )

Human IL10RB ELISA Pair Set ( CRFB4 ) Human IL10RB ELISA Pair Set ( CRFB4 ) Catalog Number : SEK10945 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in the

More information

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* Catalog # Kit Size SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* AS-55550 One 96-well strip plate This kit is optimized to detect human/mouse/rat alpha-synuclein

More information

Whole Mount IHC Protocol

Whole Mount IHC Protocol Whole Mount IHC Protocol Authors: Ruth Sullivan, Ryan Trevena and Kyle Wegner Creation Date: 03/17/2016 All steps should be conducted with gentle agitation on an orbital shaker, unless otherwise instructed.

More information

Kinase Reaction and Alkylation Protocol

Kinase Reaction and Alkylation Protocol Kinase Reaction and Alkylation Protocol Protocol for the treatment of substrates prior to detection by Thiophosphate Ester antibodies This product is for research use only and is not intended for diagnostic

More information

For the development of sandwich ELISAs to measure phosphorylated Vascular Endothelial Growth Factor Receptor 1 (VEGF R1/Flt-1) in cell lysates.

For the development of sandwich ELISAs to measure phosphorylated Vascular Endothelial Growth Factor Receptor 1 (VEGF R1/Flt-1) in cell lysates. DuoSet IC Human Phospho-VEGF R1/Flt-1 Catalog Number DYC4170-2 Catalog Number DYC4170-5 For the development of sandwich ELISAs to measure phosphorylated Vascular Endothelial Growth Factor Receptor 1 (VEGF

More information

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- #1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals

More information

How to run Alpha assay: How to setup an Alpha assay Make your own assay!

How to run Alpha assay: How to setup an Alpha assay Make your own assay! How to run Alpha assay: How to setup an Alpha assay Make your own assay! 1 2009 PerkinElmer AlphaLISA kits - recommendations before starting the assay Samples: Phenol red and hemoglobin: choose AlphaLISA

More information

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα

More information

Human Granulin / GRN / Progranulin ELISA Pair Set

Human Granulin / GRN / Progranulin ELISA Pair Set Human Granulin / GRN / Progranulin ELISA Pair Set Catalog Number : SEKA10826 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized

More information

CytoGLOW. IKK-α/β. Colorimetric Cell-Based ELISA Kit. Catalog #: CB5358

CytoGLOW. IKK-α/β. Colorimetric Cell-Based ELISA Kit. Catalog #: CB5358 CytoGLOW IKK-α/β Colorimetric Cell-Based ELISA Kit Catalog #: CB5358 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only.

More information

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal

More information

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43

More information

Convoy TM Transfection Reagent

Convoy TM Transfection Reagent Convoy TM Transfection Reagent Catalog No.11103 0.25ml (40-80 transfections in 35mm dishes) Catalog No.11105 0.5 ml (80-165 transfections in 35mm dishes) Catalog No.11110 1.0 ml (165-330 transfections

More information

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

More information

Materials and Methods: All strains were derivatives of SK1 and are listed in Supplemental Table 1.

Materials and Methods: All strains were derivatives of SK1 and are listed in Supplemental Table 1. Supplemental Online Material: Materials and Methods: All strains were derivatives of SK1 and are listed in Supplemental Table 1. Constructs: pclb2-3ha-cdc5 and pclb2-3ha-cdc2 strains were constructed by

More information

Mouse Factor XII Total ELISA Kit

Mouse Factor XII Total ELISA Kit Mouse Factor XII Total ELISA Kit Catalog No: IMFXIIKT-TOT Lot No: SAMPLE INTENDED USE This mouse coagulation Factor XII antigen assay is intended for the quantitative determination of total Factor XII

More information

OPPF-UK Standard Protocols: Mammalian Expression

OPPF-UK Standard Protocols: Mammalian Expression OPPF-UK Standard Protocols: Mammalian Expression Joanne Nettleship joanne@strubi.ox.ac.uk Table of Contents 1. Materials... 3 2. Cell Maintenance... 4 3. 24-Well Transient Expression Screen... 5 4. DNA

More information

MATERIAL DATA SHEET. NOTE: Kit contains reagents sufficient for 10 x 30 μl reactions and 5 Western Blots (minigel. Reagents Provided in Kit

MATERIAL DATA SHEET. NOTE: Kit contains reagents sufficient for 10 x 30 μl reactions and 5 Western Blots (minigel. Reagents Provided in Kit Lot # XXXXX ITCH/AIP4 Ubiquitin Ligase Kit Cat. # K-270 MATERIAL DATA SHEET The mammalian Itchy homolog, or ITCH, (also known as Atrophin-1-interacting protein 4 or AIP4) is a HECT domain class ubiquitin

More information

ab G alpha i Activation Assay Kit

ab G alpha i Activation Assay Kit ab173234 G alpha i Activation Assay Kit Instructions for Use For the simple and fast measurement of G alpha i activation. This product is for research use only and is not intended for diagnostic use. Version

More information

IMMUNOPRECIPITATION (IP)

IMMUNOPRECIPITATION (IP) 1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us

More information

Cell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential

Cell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential Supporting Online Material Materials and methods Cell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential Medium (Gibco BRL, Invitrogen Corporation, Carlsbad, CA, USA), supplemented

More information

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA

More information

ApoTrack Cytochrome c Apoptosis ICC Antibody

ApoTrack Cytochrome c Apoptosis ICC Antibody ab110417 ApoTrack Cytochrome c Apoptosis ICC Antibody Instructions for Use For the Immunocytochemistry analysis of cytochrome c and a mitochondrial marker (Complex Vα) in apoptotic cells and nonapoptotic

More information

Immunohistochemistry with APAAPstaining Authors

Immunohistochemistry with APAAPstaining Authors v Immunohistochemistry with APAAPstaining Authors S. Raffegerst Date 30-10-2007 Background Version 1.0 The immunohistochemistry method allows the identification of cells with expression of specific surface

More information

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Contacts: Marty Simonetti martysimonetti@gmail.com Kirby Alton kirby.alton@abeomecorp.com Rick Shimkets

More information

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure Cell-Based ELISA Kit for detecting phospho-stat3 (ptyr 705 ) in cultured cell lines adequate for 96 assays (1 96 well plate) Catalog Number RAB0444 Storage Temperature 20 C TECHNICAL BULLETIN Product Description

More information

Strep-tag detection in Western blots

Strep-tag detection in Western blots Strep-tag detection in Western blots General protocol for the detection of Strep-tag fusion proteins Last date of revision April 2012 Version PR07-0010 www.strep-tag.com For research use only Important

More information

Preparing Cell Cultures of Human Embryonic Kidney

Preparing Cell Cultures of Human Embryonic Kidney Preparing Cell Cultures of Human Embryonic Kidney Cells: Clone 293T Submitted by Devin Mollegard, Lab Partner: Megan Wydner 4 November 2015 Abstract Biology is the complex study of life which studies time

More information

Multiplex Fluorescent Western Blot Starter Kit for the Bio- Rad ChemiDoc MP

Multiplex Fluorescent Western Blot Starter Kit for the Bio- Rad ChemiDoc MP Page 1 of 7 INSTRUCTIONS: Z-310 Multiplex Fluorescent Western Blot Starter Kit for the Bio- Rad ChemiDoc MP Rockland Immunochemicals and Bio-Rad Laboratories have jointly developed an easy to use multiplex

More information

Mouse ICAM-1 / CD54 ELISA Pair Set

Mouse ICAM-1 / CD54 ELISA Pair Set Mouse ICAM-1 / CD54 ELISA Pair Set Catalog Number : SEK50440 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in the General

More information

ab Ubiquitylation Assay Kit

ab Ubiquitylation Assay Kit ab139467 Ubiquitylation Assay Kit Instructions for Use For the activation of ubiquitin for use in ubiquitylation experiments This product is for research use only and is not intended for diagnostic use.

More information

ab Alkaline Phosphatase Conjugation Kit Protocol

ab Alkaline Phosphatase Conjugation Kit Protocol ab102850 Alkaline Phosphatase Conjugation Kit Protocol Antibody and protein modification This product is for research use only and is not intended for diagnostic use. Version 2 Last Updated 12 March 2014

More information

A Bridging Immunogenicity Assay Using SPARCL TM Technology

A Bridging Immunogenicity Assay Using SPARCL TM Technology A Bridging Immunogenicity Assay Using SPARCL TM Technology Wenhua F. Xie Lumigen Inc., a Beckman Coulter Company INTRODUCTION Evaluating the immune response in patients is an important aspect associated

More information

Supporting Information

Supporting Information Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS

More information

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807 INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended

More information

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at

More information

SUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement

SUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement SUPPLEMENTAL MATERIAL Supplemental Methods Reagents Cumate solution was from System Biosciences. Human complement Cq and complement C-esterase inhibitor (C-INH) were from Calbiochem. C-INH (Berinert) for

More information

PARP-1 (cleaved) Human In-Cell ELISA Kit (IR)

PARP-1 (cleaved) Human In-Cell ELISA Kit (IR) ab110215 PARP-1 (cleaved) Human In-Cell ELISA Kit (IR) Instructions for Use For the quantitative measurement of Human PARP-1 (cleaved) concentrations in cultured adherent and suspension cells. This product

More information

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications Protein Purification Products Complete Solutions for All of Your Protein Purification Applications FLAG-Tagged Protein Products EXPRESS with the pcmv-dykddddk Vector Set Fuse your protein of interest to

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Contaminant bovine transferrin assay

Contaminant bovine transferrin assay ILA Application Note Contaminant bovine transferrin assay INTRODUCTION Bovine transferrin, a 76, Dalton glycoprotein, is one of the constituents of bovine serum. Transferrin found in serum can be associated

More information

Simplifying Kinase Profiling Using ADP Detection with the Transcreener Kinase Assay Introduction Figure 1. Transcreener Kinase Assay Principle

Simplifying Kinase Profiling Using ADP Detection with the Transcreener Kinase Assay Introduction Figure 1. Transcreener Kinase Assay Principle Simplifying Kinase Profiling Using ADP Detection with the Transcreener Kinase Assay Karen M. Kleman-Leyer, Tony A. Klink, Thane A. Westermeyer and Robert G. Lowery Introduction A variety of HTS kinase

More information

ab Antibody Serum Purification Kit (Protein A) Protocol

ab Antibody Serum Purification Kit (Protein A) Protocol ab109209 Antibody Serum Purification Kit (Protein A) Protocol For preparing antibodies for conjugation The components of Ab109209 are fully compatible with our Conjugation kits however they are not compatible

More information

ab Ran Activation Assay Kit

ab Ran Activation Assay Kit ab173247 Ran Activation Assay Kit Instructions for Use For the simple and fast measurement of Ran activation. This product is for research use only and is not intended for diagnostic use. Version 1 Last

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact

More information

Conjugation Kit Protocol

Conjugation Kit Protocol ab102890 HRP Conjugation Kit Protocol Antibody and protein modification This product is for research use only and is not intended for diagnostic use. Version 5 Last Updated 1 July 2016 Table of Contents

More information

Total Histone H3 Acetylation Detection Fast Kit (Fluorometric)

Total Histone H3 Acetylation Detection Fast Kit (Fluorometric) Total Histone H3 Acetylation Detection Fast Kit (Fluorometric) Catalog Number KA1539 48 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use...

More information

Rabbit (monoclonal) Anti-FAK [py 397 ] Phosphospecific Antibody, Unconjugated

Rabbit (monoclonal) Anti-FAK [py 397 ] Phosphospecific Antibody, Unconjugated Rabbit (monoclonal) Anti-FAK [py 397 ] Phosphospecific Antibody, Unconjugated PRODUCT ANALYSIS SHEET Catalog Number: Lot Number: Volume: 44-625G (10 mini-blot size) See product label 100 μl Clone Number:

More information

Reducing Non-Specific Binding in Surface Plasmon Resonance Experiments

Reducing Non-Specific Binding in Surface Plasmon Resonance Experiments 1 Reducing Non-Specific Binding in Surface Plasmon Resonance Experiments SUMMARY Reducing non-specific binding (NSB) is essential to generating accurate data with SPR The effect of bovine serum albumin,

More information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid

More information

Human TGF-beta1 ELISA

Human TGF-beta1 ELISA K-ASSAY Human TGF-beta1 ELISA For the quantitative determination of TGF-beta1 in human cell culture supernates, serum, plasma (EDTA) and urine Cat. No. KT-1471 For Research Use Only. Not for diagnostic

More information

Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA

Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted

More information

Converting your ELISA from horseradish peroxidase to alkaline phosphatase using NovaBright chemiluminescence detection reagents

Converting your ELISA from horseradish peroxidase to alkaline phosphatase using NovaBright chemiluminescence detection reagents Application note DynaLight Substrate with RapidGlow Enhancer Converting your ELISA from horseradish peroxidase to alkaline phosphatase using NovaBright chemiluminescence detection reagents Introduction

More information

EGFR (Phospho-Ser695)

EGFR (Phospho-Ser695) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely

More information

Manufactured by. Zyagen Barnes Canyon Road San Diego, CA 92121, USA

Manufactured by. Zyagen Barnes Canyon Road San Diego, CA 92121, USA Alkaline Phosphatase Immunohistochemistry Detection kits For detection of mouse, rabbit, goat, rat, sheep, chicken, guinea pig, and human primary antibodies Size: 500 Tests Catalog #: AK-011, Mouse Kit

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

ab Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit

ab Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit ab128967 - Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit Instructions for Use For the detection of a specific antibody bound to an antigen in tissue sections. This product is for research use only

More information

In Vitro Diagnostic Products

In Vitro Diagnostic Products In Vitro Diagnostic Products Rely on Rockland for Unparalleled Quality Diagnostic: Overview For over 50 years Rockland has provided a dedicated portfolio of general purpose reagents (GPR) used to collect,

More information

Supplementary Figure Legend

Supplementary Figure Legend Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss

More information