Triticeae Gene Nomenclature
|
|
- Conrad Hardy
- 6 years ago
- Views:
Transcription
1 A Wheat Initiative workshop Triticeae Gene Nomenclature October 2016, Munich (Germany) Report 1
2 Background A number of high quality genome sequences have been completed in recent years for species of the Triticeae tribe. In early 2016 the International Wheat Genome Sequencing Consortium (IWGSC) announced the completion of a whole-genome reference sequence for the Chinese Spring reference cultivar of the large hexaploid genome. This follows the generation of high quality genome sequences for other related Triticeae species that have also recently been sequenced and made available including wheat progenitors, barley and the first durum wheat genome. This will soon be followed by the re-sequencing of a number of wheat varieties and other related species adding to the plethora of increasing genomic resources. Most of these genomes have been annotated using high-throughput automatic approaches based on evidence from RNA-sequencing experiments and ab-initio methods. In addition comparative analyses to associate orthologous genes have also been performed across the Triticeae species offering more supporting evidence for the annotation of genes. Annotated gene structures are available at genome browsers such as Ensembl Plants 1, URGI 2, GrainGenes 3 and Gramene 4. There is, however, limited information regarding gene symbols for wheat and other Triticeae species associated to the current annotations restricting the adoption and access of the data. Since 1968 the gene symbols of wheat have been curated and compiled by the Catalogue of Gene Symbols of Wheat (the Catalogue). As a recognised authority in the wheat community the Catalogue is a reference used by researchers and breeders to identify standard names and symbols for genes within wheat and related species as well as the multiple alleles described for each of the genes. The correct identification of gene structures in annotated genome references using a coherent and standard nomenclature across the Triticeae species will support the wider adoption of the recently generated genomics resources. The Triticeae Gene Nomenclature Workshop was organised with the sponsorship of the Wheat Initiative by the Wheat Information System and Improving Wheat Quality for Processing and Health Expert Working Groups. The meeting was held in Munich on October at the Helmholtz Centrum in Munich (Germany). The aim of the workshop was to set the foundations for the development of a gene nomenclature scheme to define and assign names and symbols for gene structures across the Triticeae species. Workshop Objectives and Agenda Overview The workshop congregated bioinformaticians, genomicists and wheat geneticists to discuss and set up the principles for providing gene symbols across the Triticeae genomes (see Appendix B for attendee list). The objectives of the workshop were Identify the current challenges in the development of the wheat gene catalogue and how this could support the provision of gene symbols and names across the Triticeae tribe. 1 plants.ensembl.org 2 urgi.versailles.inra.fr 3 wheat.pw.usda.gov/gg3/ 4 2
3 Propose guidelines, criteria and a scheme for the annotation of gene symbols across the Triticeae species. Identify gaps in the current datasets to inform and guide projects for Triticeae species in the generation of genomic resources. The agenda of the workshop covered three days of work. The first day was focused on presentations by the attendees about the history and current activities of the Catalogue of Gene Symbols of Wheat and the current annotation of the wheat and other Triticeae genomes. The second day was focused on the work required to define a gene scheme across the Triticeae tribe. The workshop attendees were divided in groups with the task to identify key areas of development and the proposition for a set of actions to deliver the objectives of the workshops. Finally the third day was focused on the agreement of actions and next steps (see Appendix A for a detailed agenda). Findings and Outcomes 1. Discrepancies in the definition of key concepts 1.1. The understanding of the definitions of key concepts such as gene, locus and variant alleles differs between geneticists and genomicists and bioinformaticians. The Catalogue adopts the more traditional definition of these concepts based on the morphological and physiological traits. Genomicists and bioinformaticians use definitions that are driven by a sequence-based characterisation of these concepts The discrepancies in the understanding these key concepts can lead to misinterpretations. There was an agreement to work towards avoiding confusions in future communications by recognising and addressing these discrepancies. 2. Identification of different categories of genes 2.1. Four categories of gene objects (in the broadest sense) were identified drawing both from the Catalogue entries and the gene structures annotated in the databases as it follows Category I. These are the genes for which the Catalogue provides sequences (either DNA or peptide) that could be used to unambiguously identify a gene structure in a sequence reference. Although this category represents only a handful of genes, these are the ones that are present in the current literature and the best characterised across the mapping populations and germplasm collections Category II. These are high-quality annotated gene structures, which are not yet recognised as entries in the Catalogue, but which can be associated to orthologous genes in other species. These gene structures are the largest collection and have emerged from the highthroughput annotation efforts Category III. These are genes in the Catalogue which at the moment can only be characterised by genetic mapping. These genes are mapped as Quantitative Trait Loci (QTL) but have neither been cloned nor sequenced. The characterisation of these genes might result in more than one gene structure that will require to be named accordingly. 3
4 2.5. Category IV. These are the annotated gene structures for which there is no reliable predicted orthologue. A correct identification of these objects that can be tracked over annotation releases is already maintained by the databases (e.g. Ensembl gene estable ids). 3. Gene nomenclature scheme for the Triticeae tribe 3.1. A gene nomenclature that can be adopted across the Triticeae tribe was proposed. The nomenclature will need to be discussed by the wider community including colleagues working on related species. We expect that the adoption of the unified nomenclature will improve the use of genetic and genomic resources justifying the effort of the deployment and development of a scheme The proposed scheme focused on gene symbols assigned to the hexaploid bread wheat that can then be associated to genes in other related species via orthologous relationship. Figure 1 below exemplifies the scheme for an example gene symbol GX. The identification of the three homeoelogous genes in the A, B and D sub-genomes is associated to corresponding orthologous genes in the A and D progenitors (T. urartu and Ae. tauschii). Orthologous genes are also identified in other Triticeae species such as barley (identified by the letter H). Figure 1 Proposed gene nomenclature for the Triticeae - example gene symbol GX 3.3. Events such as gene gain and loss, or the effect of translocations, will require addressing on a case-by-case basis as different scenarios will present different challenges. We will work with the Catalogue to resolve these cases to ensure the proposed solutions are consistent with other similar cases and are also aligned with the current use in the literature (example Waxy genes) The proposed gene nomenclature scheme will not represent allele information. With more genetic diversity resources being currently generated by the community there will be an 4
5 increasing demand for the representation of allele information in the genomics databases. This is an area for future development. 4. High-throughout Assignment of Gene Names 4.1. We propose to adopt a high-throughout method to assign putative gene symbols, descriptions and names to genes in Category II (see above). This information will be assigned based on sequence similarity and other criteria such as conservation of synteny using orthologous sequences from barley, brachypodium, rice and Arabidopsis genes The gene symbols will include the prefix similar_to and the suffix will indicate the source of the name, e.g. similar_to_gx_in _At (for an GX gene in Arabidopsis thaliana) These gene symbols will be temporary and will be replaced by Catalogue symbols as they are curated and adopted. 5. Gene Name Authority for the Triticeae 5.1. Establishing a gene nomenclature authority for the Triticeae tribe was identified as a priority. One of the current priorities of the research community is the generation of highquality gene annotations by closing existing known gaps in available gene collections. These efforts are complemented by the increasing availability of genetic resources such as the wheat TILLING populations, the access to genotype information for seed banks (e.g. Seeds of Discovery project at CIMMYT) and the generation of diversity data (e.g. Whealbi project and CerealsDB). The annotation will require a level of coordination across several organisations that should be supported by the development of the Catalogue as the recognised authority The successful implementation of a gene nomenclature authority will be required to be resourced accordingly. This will need support for the recruitment of manual curators and bioinformaticians to support the generation of data and the hosting of informatics tools Building bridges with researchers working on data generated for related species will be a priority. Priorities As a conclusion of the workshop discussions on a number of priority areas were identified with the purpose to deliver on the objectives. 1. Establishing of a gene nomenclature authority for the Triticeae 2. Development of the Catalogue 3. Dissemination of the work of the Catalogue and the outcomes of the workshop 4. Work will be focused as a priority on genes in Category I. 5. Engage with the communities working with other Triticeae species. 5
6 Appendix Triticeae Gene Nomenclature Workshop October 2016 Munich, Germany A. Workshop agenda Tuesday 11 October - Afternoon 12:00pm 1:00pm Welcome and Lunch 1:00pm - 1:30pm Workshop objectives Mario Caccamo 1:30pm 3:30pm 3:30pm 4:00pm Wheat gene catalogue history, current status, challenges and opportunities Coffee break Craig Morris John Rogers 4:00pm 5:30pm Triticeae genome annotation (barley, wheat) Manuel Spannagl 5:30pm - 6:00pm Day conclusions and wrap up Mario Caccamo Carlos Guzman Wednesday 12 October 9:00am 10:30am Databases and browsers for Triticeae genomes current annotation for Triticeae species, challenges and opportunities. Paul Kersey Thomas Letellier 10:30am - 11:00am 11:00am 12:30pm 12:30pm 2:00pm 2:00pm 3:30pm 3:30pm 4:00pm 4:00pm - 6:00pm Coffee break Gene symbols in the context of homoeology orthology paralogy / subfunctionalisation alleles Examples from quality genes. Lunch Defining a strategy Break out groups to work on the annotation of few selected genes Coffee break Defining principles and strategy for gene symbol annotation. Bruno Santos Tatsuya Ikeda All All 6
7 Thursday 13 October Morning 9:00am 10:30am Revision of objectives and next steps Mario Caccamo Carlos Guzman Manuel Spannagl 10:30am - 11:00am Coffee break 11:00pm 12:30pm Agreement on Actions All 12:30pm 1:00pm Lunch and departure B. Attendees list Tatsuya Ikeda Quality EWG NARO tmikeda@affrc.go.jp John Rogers Quality EWG CONICET rogers@faa.unicen.edu.ar Craig Morris Quality EWG USDA morrisc@wsu.edu Carlos Guzman Quality EWG CIMMYT c.guzman@cgiar.org Manuel Spannagl WheatIS EWG PGSB manuel.spannagl@helmholtz-muenchen.de Heidrun Gundlach WheatIS EWG PGSB h.gundlach@helmholtz-muenchen.de Sven Twardziok WheatIS EWG PGSB sven.twardziok@helmholtz-muenchen.de Thomas Lux WheatIS EWG PGSB thomas.lux@helmholtz-muenchen.de Paul Kersey WheatIS EWG EBI pkersey@ebi.ac.uk Thomas Lettelier WheatIS EWG INRA thomas.letellier@inra.fr Bruno Santos WheatIS EWG NIAB bruno.santos@niab.com Mario Caccamo WheatIS EWG NIAB mario.caccamo@niab.com C. Agreed Actions 1. Regular conference calls meetings The group will meet on regular basis (monthly if possibly) to assess progress on the priority areas. The preferred option will be using Skype. We have set up a drop box space that we will use to share information. 2. Task Groups We will organise a task group to tackle the genes in category 1. The first objective is to produce a list of canonical sequences that can be used by the browsers to assign names to gene structures. 3. Funding 7
8 We will explore funding opportunities to implement a longer-term strategy to improve the functionality of the Catalogue. We will seek advice from the Wheat Initiative to coordinate this effort. 4. Outreach We will engage with other groups working in species related to wheat focused initially on the Triticeae tribe. Similarly we will engage with other groups working on the generation of genomics resources for wheat (e.g. Whealbi, IWGSC). 5. Conferences and Meetings a. PAG 2017 we will submit a poster and prepare a presentation for the IWGSC standard and tools workshop. b. Monogram (UK) we will approach the organisers to present in this meeting in April. c. Wheat Genetics Symposium we will submit an abstract. D. Photographs from the workshop Figure 2 - group picture 8
9 Triticeae Gene Nomenclature Workshop October 2016 Munich, Germany Figure 3 - group deliberations 9
Integrating and Leveraging Cereal and Grass Genome Resources. David Marshall Information and Computational Sciences Group
Integrating and Leveraging Cereal and Grass Genome Resources David Marshall Information and Computational Sciences Group David.Marshall@hutton.ac.uk What I m going to cover Brief overview of the new barley
More informationGenomic resources and gene/qtl discovery in cereals
Genomic resources and gene/qtl discovery in cereals Roberto Tuberosa Dept. of Agroenvironmental Sciences & Technology University of Bologna, Italy The ABDC Congress 1-4 March 2010 Gudalajara, Mexico Outline
More informationOBJECTIVES-ACTIVITIES 2-4
OBJECTIVES-ACTIVITIES 2-4 Germplasm Phenotyping Genomics PBA BIMS MAB Pipeline Implementation GOALS, ACTIVITIES, & DELIVERABLES Cameron Peace, project co-director & MAB Pipeline Team leader Outline of
More informationEnsembl: A Genomic Toolset for pigs, poultry, plants, pests, pathogens and pollinators. Paul Kersey
Ensembl: A Genomic Toolset for pigs, poultry, plants, pests, pathogens and pollinators Paul Kersey A brief history of genome sequencing 1995 Haemophilus influenzae 1.8 Mb 1996 Saccharomyces cerevisiae
More information(1) MaizeGDB needs greater resources.
MaizeGDB Working Group Report 2006 Volker Brendel, Ed Buckler, Karen Cone, Mike Freeling, Owen Hoekenga, Lukas Mueller, Marty Sachs, Pat Schnable, Tom Slezak, Anne Sylvester, Doreen Ware MaizeGDB is one
More informationA tutorial introduction into the MIPS PlantsDB barley&wheat databases. Manuel Spannagl&Kai Bader transplant user training Poznan June 2013
A tutorial introduction into the MIPS PlantsDB barley&wheat databases Manuel Spannagl&Kai Bader transplant user training Poznan June 2013 MIPS PlantsDB tutorial - some exercises Please go to: http://mips.helmholtz-muenchen.de/plant/genomes.jsp
More informationThe 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential
The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential Applications Richard Finkers Researcher Plant Breeding, Wageningen UR Plant Breeding, P.O. Box 16, 6700 AA, Wageningen, The Netherlands,
More informationTraining materials.
Training materials Ensembl training materials are protected by a CC BY license http://creativecommons.org/licenses/by/4.0/ If you wish to re-use these materials, please credit Ensembl for their creation
More informationThe IWGSC: Strategies & Activities to Sequence the Bread Wheat Genome Jane Rogers IWGSC Deputy Executive Director
The IWGSC: Strategies & Activities to Sequence the Bread Wheat Genome Jane Rogers IWGSC Deputy Executive Director ACPFG Seminar University of Adelaide 1st May 2014 The International Wheat Genome Sequencing
More informationGene banks Challenges for the future. Susan McCouch Dept. Plant Breeding & Genetic Cornell University
Gene banks Challenges for the future Susan McCouch Dept. Plant Breeding & Genetic Cornell University Grand Challenges Population & income growth Land & water resources Climate change Nutrition, Health,
More informationUtilization of the IWGSC Resources: Application to Wheat Breeding
Utilization of the IWGSC Resources: Application to Wheat Breeding Wheat Breeding: Securing Tomorrow s Profitability. Dr. Curtis J. Pozniak IWGSC Workshop, PAG, Jan 2014 Use and/or distribution of these
More informationWheat Chromosome Engineering and Breeding Jianli Chen
Wheat Chromosome Engineering and Breeding Jianli Chen Chromosome Engineering A process to transfer favorable alleles through inter-specific hybridization and interchange of chromatin using aneupolids Aneuploids?
More informationTIGR THE INSTITUTE FOR GENOMIC RESEARCH
Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,
More informationAssociation Mapping in Wheat: Issues and Trends
Association Mapping in Wheat: Issues and Trends Dr. Pawan L. Kulwal Mahatma Phule Agricultural University, Rahuri-413 722 (MS), India Contents Status of AM studies in wheat Comparison with other important
More informationA. COVER PAGE. Oswaldo Chicaiza, Alicia del Blanco (50%), Xiaoqin Zhang (70%), and Marcelo Soria (20%).
A. COVER PAGE PROJECT TITLE Development of wheat varieties for California 2017-2018 PRINCIPAL INVESTIGATOR Jorge Dubcovsky OTHER INVESTIGATORS Oswaldo Chicaiza, Alicia del Blanco (50%), Xiaoqin Zhang (70%),
More informationGene-centered resources at NCBI
COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving
More informationThe Genome Analysis Centre. Building Excellence in Genomics and Computational Bioscience
Building Excellence in Genomics and Computational Bioscience Wheat genome sequencing: an update from TGAC Sequencing Technology Development now Plant & Microbial Genomics Group Leader Matthew Clark matt.clark@tgac.ac.uk
More informationCGIAR Platform on Excellence in Breeding
CGIAR Platform on Excellence in Breeding Tools and services that create synergies and accelerate genetic gains of breeding programs targeting the developing world Executive Summary CGIAR Platform on Excellence
More informationAssociation Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010
Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of
More informationSupporting Information
Supporting Information Yuan et al. 10.1073/pnas.0906869106 Fig. S1. Heat map showing that Populus ICS is coregulated with orthologs of Arabidopsis genes involved in PhQ biosynthesis and PSI function, but
More informationDelight Customers. Always. ASUG and SAP Solution Manager Education Summit November 28-30, 2017 Newtown Square, PA.
ASUG and SAP Solution Manager Education Summit November 28-30, 2017 Newtown Square, PA. Agenda: ASUG and SAP Solution Manager Education Summit Tuesday, November 28, 2017 8:00am-9:00am Check-In and Breakfast
More informationIntrogression of genetic material from primary synthetic hexaploids into an Australian bread wheat (Triticum aestivum L.)
Introgression of genetic material from primary synthetic hexaploids into an Australian bread wheat (Triticum aestivum L.) A thesis submitted in fulfilment of the requirements for the degree of Master of
More informationFundamentals of Clinical Genomics
Fundamentals of Clinical Genomics Wellcome Genome Campus Hinxton, Cambridge, UK 17-19 January 2018 Lectures and Workshops to be held in the Rosalind Franklin Pavilion Lunch and Dinner to be held in the
More informationOutline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018
Outline Overview of the GEP annotation projects Annotation of Drosophila Primer January 2018 GEP annotation workflow Practice applying the GEP annotation strategy Wilson Leung and Chris Shaffer AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCT
More informationBasic Bioinformatics: Homology, Sequence Alignment,
Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi
More informationA working model network of tree improvement for competitive, multifunctional and sustainable European forestry
6th framework programme Research Infrastructures Action Integrating activity A working model network of tree improvement for competitive, multifunctional and sustainable European forestry "Structuring
More informationUK Wheat Productivity Research Targets and Needs. Commercial Wheat Breeding Perspective. Dr. Richard Summers RAGT Seeds
UK Wheat Productivity Research Targets and Needs Commercial Wheat Breeding Perspective Dr. Richard Summers RAGT Seeds UK Wheat Productivity Research Targets and Needs Global population growth Increased
More informationPROPOSAL AND APPLICATION GUIDELINES. International Wheat Yield Partnership 1st Competitive Call
PROPOSAL AND APPLICATION GUIDELINES International Wheat Yield Partnership 1st Competitive Call Launch: 15 January 2015 Closing Date for Pre-proposals: 15 March 2015 24:00 GMT Contents Summary.... Page
More informationSNPs - GWAS - eqtls. Sebastian Schmeier
SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association
More informationPulse Crop Genetic Improvement Network:
Pulse Crop Genetic Improvement Network: Abstract: Pulse crops and Defra policy objectives: Crop diversification and lowering inputs are major drivers for sustainable agricultural policy. Pulse crops can
More informationLeonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
More informationWheat Genomic Resources in a post reference sequence era: a road map to establish priorities, timelines and outcomes
Wheat Genomic Resources in a post reference sequence era: a road map to establish priorities, timelines and outcomes Prospects in Wheat Genomics -- what is needed from a research perspective Rudi Appels,
More informationMAS refers to the use of DNA markers that are tightly-linked to target loci as a substitute for or to assist phenotypic screening.
Marker assisted selection in rice Introduction The development of DNA (or molecular) markers has irreversibly changed the disciplines of plant genetics and plant breeding. While there are several applications
More informationRethinking Realizing Value from Genetic Resources
Rethinking Realizing Value from Genetic Resources Philip G. Pardey University of Minnesota Funding the CGIAR Genebanks Side Meeting to the CGIAR System Council Meeting, 9 May 2017 Royal Tropical Institute,
More informationMICROSATELLITE MARKER AND ITS UTILITY
Your full article ( between 500 to 5000 words) - - Do check for grammatical errors or spelling mistakes MICROSATELLITE MARKER AND ITS UTILITY 1 Prasenjit, D., 2 Anirudha, S. K. and 3 Mallar, N.K. 1,2 M.Sc.(Agri.),
More informationEUROPEAN COMMISSION JOINT RESEARCH CENTRE. Training Workshop on "Practical aspects of regulatory GMO testing" Ispra, March 2015 PROGRAMME
Training Workshop on "Practical aspects of regulatory GMO testing" Ispra, 25-27 March 2015 PROGRAMME DAY 1 (Wednesday 25 March 2015) Morning: 9:00 12:30 (incl. coffee break 10:30-11:00) General welcome
More informationAgenda. Web Databases for Drosophila. Gene annotation workflow. GEP Drosophila annotation projects 01/01/2018. Annotation adding labels to a sequence
Agenda GEP annotation project overview Web Databases for Drosophila An introduction to web tools, databases and NCBI BLAST Web databases for Drosophila annotation UCSC Genome Browser NCBI / BLAST FlyBase
More informationFrom Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
More informationUSDA NRSP-8 BIOINFORMATICS COORDINATION PROGRAM ACTIVITIES
USDA NRSP-8 BIOINFORMATICS COORDINATION PROGRAM ACTIVITIES Supported by Regional Research Funds, Hatch Act for the Period 10/1/15-9/30/16 James Reecy, Sue Lamont, Chris Tuggle, Max Rothschild and Fiona
More informationANNUAL MEETING OF SENIOR OFFICIALS FROM CENTRES OF GOVERNMENT POLITICAL ECONOMY OF REFORM: ENSURING STAKEHOLDER SUPPORT
ANNUAL MEETING OF SENIOR OFFICIALS FROM CENTRES OF GOVERNMENT POLITICAL ECONOMY OF REFORM: ENSURING STAKEHOLDER SUPPORT 25-26 September 2008 Residencia Oficial de los Pinos, Mexico City, Mexico ANNOTATED
More informationGramene: development and integration of trait and gene ontologies for rice
Comparative and Functional Genomics Comp Funct Genom 2002; 3: 132 136. Published online 14 March 2002 in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002 / cfg.156 Conference Review Gramene:
More informationAir quality. Report. Environmental Audit Committee, Environment, Food and Rural Affairs Committee, Health Committee and Transport Committee
A picture of the National Audit Office logo Report by the Comptroller and Auditor General Environmental Audit Committee, Environment, Food and Rural Affairs Committee, Health Committee and Transport Committee
More informationAdvanced Bioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2018
Advanced Bioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2018 Anthony Gitter gitter@biostat.wisc.edu www.biostat.wisc.edu/bmi776/ These slides, excluding third-party
More informationCourse Presentation. Ignacio Medina Presentation
Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital
More informationThomas Blake, Victoria Carollo Blake and Jackie Campbell Department of Plant Sciences and Plant Pathology, Montana State University, USA
PLANT GENOMICS Thomas Blake, Victoria Carollo Blake and Department of Plant Sciences and Plant Pathology, Montana State University, USA Keywords: DNA, gene expression, gene regulation, genome, mapping,
More informationMARKET SCOPING MISSION INFORMATION ENVIRONMENT & WATER TECHNOLOGIES MAY 2018, JAPAN
EU Gateway Business Avenues eu-gateway.eu MARKET SCOPING MISSION INFORMATION ENVIRONMENT & WATER TECHNOLOGIES 21 25 MAY 2018, JAPAN Are you interested in applying for the Environment & Water Technologies
More informationSTATISTICAL AND COMPUTATIONAL TOOLS IN MOLECULAR BREEDING AND BIOTECHNOLOGY
STATISTICAL AND COMPUTATIONAL TOOLS IN MOLECULAR BREEDING AND BIOTECHNOLOGY B. M. Prasanna, Division of Genetics, I.A.R.I., New Delhi - 110012 1. Introduction The complexity of problems in statistical
More informationAppointment of. Head of Plant Genomics
Appointment of Head of Plant Genomics March 2016 Contents Executive Summary 3 Background and Overview 4 TGAC Structure 6 TGAC s Governance 6 TGAC Scientific Advisory Board 6 Science Strategy 7 Science
More informationHow is the NRSP consistent with the mission? 8000 character max.
Prerequisite Criteria How is the NRSP consistent with the mission? 8000 character max. INTRODUCTION The NRSP-8 National Animal Genome Research Support Program has played a major role in enabling genomic
More informationWORKING GROUP ON BIOCHEMICAL AND MOLECULAR TECHNIQUES AND DNA PROFILING IN PARTICULAR. Eleventh Session Madrid, September 16 to 18, 2008
ORIGINAL: English DATE: September 1, 2008 INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA E WORKING GROUP ON BIOCHEMICAL AND MOLECULAR TECHNIQUES AND DNA PROFILING IN PARTICULAR
More informationAAFC Policy on Field Crop Germplasm
1 Effective date AAFC Policy on Field Crop Germplasm 1.1 This policy takes effect on ***** 2 Application 2.1 This policy applies to the Science and Technology Branch (STB) of Agriculture and Agri Food
More informationGuided tour to Ensembl
Guided tour to Ensembl Introduction Introduction to the Ensembl project Walk-through of the browser Variations and Functional Genomics Comparative Genomics BioMart Ensembl Genome browser http://www.ensembl.org
More informationACCELERATING GENOMIC ANALYSIS ON THE CLOUD. Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia to analyze thousands of genomes
ACCELERATING GENOMIC ANALYSIS ON THE CLOUD Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia to analyze thousands of genomes Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia
More informationUC Davis UC Davis Previously Published Works
UC Davis UC Davis Previously Published Works Title Annotation-based genome-wide SNP discovery in the large and complex Aegilops tauschii genome using next-generation sequencing without a reference genome
More informationSpeeding up discovery in plant genetics and breeding
Science Association mapping Speeding up discovery in plant genetics and breeding by Madeline Fisher Not long after joining the USDA-ARS in 1998, maize geneticist Ed Buckler set out to bridge a scientific
More informationMenlo Park, California - June 8, 2017 Munich, Germany - June 20, 2017 Maidenhead, UK - September 21, Register Now!
Menlo Park, California - June 8, 2017 Munich, Germany - June 20, 2017 Maidenhead, UK - September 21, 2017 Register Now! Dates & Locations Menlo Park, CA - Thursday, 8 June 2017 Rosewood Hotel Sand Hill
More informationAdvanced Plant Technology Program Vocabulary
Advanced Plant Technology Program Vocabulary A Below you ll find a list of words (and their simplified definitions) that our researchers use on a daily basis. Abiotic stress (noun): Stress brought on by
More informationThe Rice Genome. How to Map a Marker Associated with a Major Gene. How do I start finding a marker in all this? About 430 million bp of DNA in genome
How to Map a Marker Associated with a Major Gene Bob Fjellstrom USDA-ARS Beaumont, TX About 430 million bp of DNA in genome 12 chromosomes Provides the code for the 35,000+ genes of rice. The Rice Genome
More informationVII. MAIZE GENETICS CONFERENCE. Maize Genetics Executive Committee Report at the 51st Maize Genetics Conference, St. Charles, IL March 2009.
VII. MAIZE GENETICS CONFERENCE Maize Genetics Executive Committee Report at the 51st Maize Genetics Conference, St. Charles, IL March 2009. Slides 2 and 4 from the online powerpoint http: http://www.maizegdb.org/mgec.php
More informationBiological resources in the Plant Biology and Breeding division of INRA
Plant Biology and Breeding Division Biological resources in the Plant Biology and Breeding division of INRA A-F Adam-Blondon Eurisco workshop, Angers, October 12th 2016 French National Institute for Research
More informationLinking Genetic Variation to Important Phenotypes
Linking Genetic Variation to Important Phenotypes BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2018 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under
More informationBBISR Do it Yourself Workshops Bioinformatics & Biostatistics Tools for Cancer Research
BBISR Do it Yourself Workshops Bioinformatics & Biostatistics Tools for Cancer Research Description: BBISR is pleased announced our first ever series of do it yourself workshops to introduce biostatistics
More informationOPTIMIZATION OF BREEDING SCHEMES USING GENOMIC PREDICTIONS AND SIMULATIONS
OPTIMIZATION OF BREEDING SCHEMES USING GENOMIC PREDICTIONS AND SIMULATIONS Sophie Bouchet, Stéphane Lemarie, Aline Fugeray-Scarbel, Jérôme Auzanneau, Gilles Charmet INRA GDEC unit : Genetic, Diversity
More informationMapping and Mapping Populations
Mapping and Mapping Populations Types of mapping populations F 2 o Two F 1 individuals are intermated Backcross o Cross of a recurrent parent to a F 1 Recombinant Inbred Lines (RILs; F 2 -derived lines)
More informationGenome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does
More informationResearch Article A High-Density SNP and SSR Consensus Map Reveals Segregation Distortion Regions in Wheat
BioMed Research International Volume 2015, Article ID 830618, 10 pages http://dx.doi.org/10.1155/2015/830618 Research Article A High-Density SNP and SSR Consensus Map Reveals Segregation Distortion Regions
More informationClick to edit Master subtitle style
Flexible Work Arrangements Job Sharing Deutsche Bank Click to edit Master title style Click to edit Master subtitle style Policy Implementation Guideline: Job Sharing Page 1 of 23 Flexible Work Arrangements
More informationHigh-throughput scale. Desktop simplicity.
High-throughput scale. Desktop simplicity. NextSeq 500 System. Flexible power. Speed and simplicity for whole-genome, exome, and transcriptome sequencing. Harness the power of next-generation sequencing.
More informationForum for exports and internationalisation June 2018 Messe Stuttgart, Germany. Program For International Visitors
Forum for exports and internationalisation 20 21 June 2018 Messe Stuttgart, Germany Program For International Visitors GlobalConnect Forum for Exports and Internationalisation International Visitors welcome
More informationMARKET SCOPING MISSION INFORMATION RAILWAY TECHNOLOGIES & SERVICES 27 NOVEMBER 1 DECEMBER 2017, JAPAN
EU Gateway Business Avenues eu-gateway.eu MARKET SCOPING MISSION INFORMATION RAILWAY TECHNOLOGIES & SERVICES 27 NOVEMBER 1 DECEMBER 2017, JAPAN Are you interested in applying for the Railway Technologies
More informationLori Yackanicz Administrator, Enterprise Analytics Lehigh Valley Health Network
Journey to HIMSS18: Data Analytics/Clinical and Business Intelligence Sponsored by: Lori Yackanicz Administrator, Enterprise Analytics Lehigh Valley Health Network Today s Speaker Lori Yackanicz Administrator,
More information2018 MOBILE CARRIERS SHOW March 27 29, 2018 Caesar s Palace; Las Vegas
2018 MOBILE CARRIERS SHOW March 27 29, 2018 Caesar s Palace; Las Vegas Updated as of 1//24/2018 Tuesday, March 27 10:00am 6:00pm 12:00pm 5:00pm Wireless Repair Expo 2018 Produced by: The Branding Network
More informationPathway approach for candidate gene identification and introduction to metabolic pathway databases.
Marker Assisted Selection in Tomato Pathway approach for candidate gene identification and introduction to metabolic pathway databases. Identification of polymorphisms in data-based sequences MAS forward
More informationBig picture and history
Big picture and history (and Computational Biology) CS-5700 / BIO-5323 Outline 1 2 3 4 Outline 1 2 3 4 First to be databased were proteins The development of protein- s (Sanger and Tuppy 1951) led to the
More informationUsing semantic web technology to accelerate plant breeding.
Using semantic web technology to accelerate plant breeding. Pierre-Yves Chibon 1,2,3, Benoît Carrères 1, Heleena de Weerd 1, Richard G. F. Visser 1,2,3, and Richard Finkers 1,3 1 Wageningen UR Plant Breeding,
More informationTargeted Sequencing of Leukemia-Associated Genes Using 454 Sequencing Systems
Sequencing Application Note March 2012 Targeted Sequencing of Leukemia-Associated Genes Using 454 Sequencing Systems GS GType TET2/CBL/KRAS and RUNX1 Primer Sets for the GS Junior and GS FLX Systems. Introduction
More informationNew techniques for genetic modification of plants
New techniques for genetic modification of plants Connor T March 2010 An internal report prepared for: The New Zealand Institute for Plant & Food Research Limited Connor T Plant & Food Research, Lincoln
More informationName: WELCOME TO JURASSIC WORLD!
Name: WELCOME TO JURASSIC WORLD! Total POINTS earned (out of 80 points): In Jurassic World, Indominis Rex was obviously scary because its genome (genes) were a combination of the DNA from many different
More informationCrop Science Society of America
Crop Science Society of America Grand Challenge Statements Crop science is a highly integrative science employing the disciplines of conventional plant breeding, transgenic crop improvement, plant physiology,
More informationCOLOSS Work Shop. Genetic discrimination Lab of Agricultural Zoology &Entomology. Agricultural University of Athens
Action FA0803 COLOSS Work Shop Genetic discrimination 17.-19.05.2012 Lab of Agricultural Zoology &Entomology Agricultural University of Athens 75, Iera Odos Str, 11855, Athens, Greece. Tel.: +30 210 529
More informationTraining Courses International Business Hub 2018
Training Courses International Business Hub 2018 Connecting you to first class training Welcome to our new training programme for 2018. We have expanded the number of courses in response to the needs of
More informationAdvanced breeding of solanaceous crops using BreeDB
Part 6 3 rd transplant Training Workshop - October 2014 Exploiting and understanding Solanaceous genomes Advanced breeding of solanaceous crops using BreeDB Richard Finkers Plant Breeding, Wageningen UR
More informationUser Guide. Etarmis. Creating A New Working Schedule
User Guide Etarmis Creating A New Working Schedule Creating A New Working Schedule The following information is designed to assist you with creating a new Working Schedule. There are 3 stages to producing
More informationSEEDS OF DISCOVERY HARNESSING BIODIVERSITY FOR FOOD SECURITY
SEEDS OF DISCOVERY HARNESSING BIODIVERSITY FOR FOOD SECURITY Crop biodiversity is a major underutilized resource to meet increasing demands for food, adapt to climate change and ensure a food-secure and
More informationGenome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)
Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA
More informationSupplementary Text. eqtl mapping in the Bay x Sha recombinant population.
Supplementary Text eqtl mapping in the Bay x Sha recombinant population. Expression levels for 24,576 traits (Gene-specific Sequence Tags: GSTs, CATMA array version 2) was measured in RNA extracted from
More informationLecture 2: Biology Basics Continued
Lecture 2: Biology Basics Continued Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine, Guanine, Thymine, and Cytosine which pair A-T and
More informationMutation entries in SMA databases Guidelines for national curators
1 Mutation entries in SMA databases Guidelines for national curators GENERAL CONSIDERATIONS Role of the curator(s) of a national database Molecular data can be collected by many different ways. There are
More informationRust Resistance Gene Cloning
University of Minnesota Rust Resistance Gene Cloning perfect markers and cassette development Peter Dodds BGRI technical workshop March 2014 Outlook: R gene pyramids via GM gene cassettes Stacking of multiple
More informationNext-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX
Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX Technical Overview Introduction RNA Sequencing (RNA-Seq) is one of the most commonly used next-generation sequencing (NGS)
More informationAnnouncements. Soybean Genetics Newsletter. Volume 5 Article
Volume 5 Article 2 4-1-1978 Announcements Soybean Genetics Newsletter Follow this and additional works at: http://lib.dr.iastate.edu/soybeangenetics Part of the Agronomy and Crop Sciences Commons Recommended
More informationOrganisation de Coopération et de Développement Economiques Organisation for Economic Co-operation and Development
Unclassified ENV/JM/MONO(2002)7 ENV/JM/MONO(2002)7 Unclassified Organisation de Coopération et de Développement Economiques Organisation for Economic Co-operation and Development 20-Oct-2004 English -
More informationIPAD-MD Data and Resources Expert Group Workshop on. Improving curation and annotation tooling for mouse models of rare disease (D7.
IPAD-MD Data and Resources Expert Group Workshop on Improving curation and annotation tooling for mouse models of rare disease (D7.2) 08-09 December 2016 Freising, Germany MEETING MINUTES [IPAD-MD disease
More informationCS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016
CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene
More informationPhenotypic response conferred by the Lr22a leaf rust resistance gene against ten Swiss P. triticina isolates.
Supplementary Figure 1 Phenotypic response conferred by the leaf rust resistance gene against ten Swiss P. triticina isolates. The third leaf of Thatcher (left) and RL6044 (right) is shown ten days after
More informationWide Hybridization in Plant Breeding
Wide Hybridization in Plant Breeding Wide hybridization - a cross of two individuals belonging to different species (also called interspecific hybridization) - Such a cross can be (rarely) realized in
More informationInitiating maize pre-breeding programs using genomic selection to harness polygenic variation from landrace populations
Gorjanc et al. BMC Genomics (2016) 17:30 DOI 10.1186/s12864-015-2345-z RESEARCH ARTICLE Open Access Initiating maize pre-breeding programs using genomic selection to harness polygenic variation from landrace
More informationCertified Change Agent Program. (incl. Developing Change Agents) Rich Batchelor Day 2
Certified Change Agent Program (incl. Developing Change Agents) Rich Batchelor Day 2 Workshop Agenda Day 1 Morning Welcome & Introduction The Challenge of Change What is change Types of change Human emotions
More informationMedSavant: An open source platform for personal genome interpretation
MedSavant: An open source platform for personal genome interpretation Marc Fiume 1, James Vlasblom 2, Ron Ammar 3, Orion Buske 1, Eric Smith 1, Andrew Brook 1, Sergiu Dumitriu 2, Christian R. Marshall
More informationComments on Use of Databases for Establishing the Clinical Relevance of Human Genetic Variants
Division of Dockets Management (HFA-305) Food and Drug Administration 5630 Fishers Lane, Rm. 1061 Rockville, MD 20852 The American Society of Human Genetics 9650 Rockville Pike Bethesda, MD 20814 24 December
More information