The Rice Genome. How to Map a Marker Associated with a Major Gene. How do I start finding a marker in all this? About 430 million bp of DNA in genome

Size: px
Start display at page:

Download "The Rice Genome. How to Map a Marker Associated with a Major Gene. How do I start finding a marker in all this? About 430 million bp of DNA in genome"

Transcription

1 How to Map a Marker Associated with a Major Gene Bob Fjellstrom USDA-ARS Beaumont, TX About 430 million bp of DNA in genome 12 chromosomes Provides the code for the 35,000+ genes of rice. The Rice Genome How do I start finding a marker in all this? 1

2 Previous Knowledge about Trait Is inheritance known? trait simply inherited? Has it been mapped? consult Gramene ( what markers are available? Trait location not known If simply inherited, have two main ways of finding linked markers: 1) Whole genome mapping assay 120 (+/-) markers (polymorphic, well-distributed) and look for linkage association. 2) Bulk segregant analysis. If complex inheritance, look at whole genome mapping of quantitative trait loci (QTL) 2

3 Whole Genome Mapping Utilize 120 (+/-) polymorphic markers Microsatellites (SSRs) Codominant markers, technologically easy to use Work well for wide (indica/japonica) crosses Medium grain/long grain crosses useful too AFLP markers can be more useful for narrower crosses (e.g., within long grain japonicas) More polymorphisms found (because of large number of markers scored per run) Predominantly dominant markers Technologically more demanding SSR and AFLP marker gels SSR markers Can run 2 to 8 SSRs in each lane scored. AFLP markers Several bands in each lane, possible to score many polymorphisms per lane. 3

4 Whole Genome Mapping SNPs another alternative Single nucleotide polymorphisms. Becoming the new marker of choice. Will cover later. RFLP markers Still used, but labor intensive. SSRs often used instead RG447 RG472 C131 RZ288 RG140 RG532x RZ382 R210 RG811x CDO226a CDO348 RZ776x CDO455 CDO118 RG462 RG957 RZ14 RZ801 RG236 C112x RG RG G1327 RG RZ RZ476a 3.1 RG437 RZ476b G294c CDO718 RZ386x 37.4 G C624x 14.9 RG139 RZ RZ260x RG654, RG654 RZ446a RZ446b RG RG G RZ C944x 4.8 CDO C RZ CDO795x 7.5 RG RZ403x RG RG C74x 8.8 RG341b 6.2 RG C636x 7.5 RG348x 5.0 C RG104 Y1065Lc RG1094e RG RZ69x C949 G200b, G271 RZ740x G379 RG214 RZ590x, G177 RG143x HHU39x gl-1 Y1049 R569x RG13 CDSR49 RG wx RZ762 C76 RZ516 RZ2 C G200a RZ667 C235x G294x G1468b RG424 G1314b HHU37 RZ682 C236 RG653 RZ RG29 RG30 G20 C285, RG678 CDO385 BCD855 CDO497 CDO405 C C424x RZ143 C825x G104 G1314a G2140, RZ323x C225x G2132a, L457a C1073x G187 G56x R C397 G103b RZ698 G95 C147, G103a CDO395 CDO1081 RZ777 CDO226b RG570 RZ404 RG G1084 RZ400 RG241x CDO98 Y1065La, RG752 RG1094f C16 RG561 C223 Rice Genetic Marker Map Lemont/TeQing - Pinson et al RZ525x RG1022 C975 RZ781 RZ53 RG1094b RG1094d, RZ900 G44 RZ797b RG16 RZ537x RG1109 RZ536x G2132b L457b G RG RZ797a 20.3 RZ RZ L102, G1468a 7.2 RG341a, RG RG91q 6.0 RG20q 5.4 G RG901x 22.7 G1106 4

5 DNA Marker Example DNA from rice plants analyzed for disease resistance marker S S S S S R R R S R S S S S S S S S S S S S S S RR S RRR DNA marker associated with disease resistance gene Whole Genome Mapping Looking for the reproducible presence of marker in progeny that display the trait. Markers closer to trait on chromosome will show tighter linkage to trait. Measured in centimorgans (recombination distance) 95% correct, 5% wrong marker is 5 centimorgans from gene controlling trait 5

6 Whole Genome Mapping Whole genome mapping can allow analysis of multiple genomic regions if simple inheritance is not clear. Most markers will be unlinked and have little association with trait expression. Good to reduce the number of markers analyzed. Candidate genes: Knowledge of metabolic pathways and genes involved in metabolism Bulk segregant analysis (BSA) Bulk segregant analysis Focus only on region of interest if trait is simply inherited. One gene or two genes able to be analyzed, but advanced generations typically needed to identify single gene locations. Rapidly eliminates uninformative markers 6

7 Bulk segregant analysis Progeny are bulked (combined) into groups of 8 (or so) individuals that have or do not have the trait. e.g., bulk of resistant vs. bulk of susceptible plants after a disease resistance screen can simultaneously look at several bulks Markers are run on the bulks and parents to look for the change in presence of a DNA marker band when comparing the bulked progeny. e.g., look for a band that is only in the resistant bulk Bulk Segregant Analysis AFLP marker screen R S R S R S R S R S R S R S RS RS R S R S 7

8 Bulk segregant analysis Commonly use RAPD or AFLP markers Genetic markers showing numerous polymorphisms on single gel RAPD markers cheap and easy, but frequently hard to reproduce results AFLP markers more technically demanding, but highly reproducible Resistant gene analogs (RGAs) used for finding candidate disease resistance markers Bulk segregant analysis After finding band of interest when comparing bulks, look at separate individuals that make up bulk. Confirm linkage of candidate marker bands with trait of interest in larger mapping population (100 + progeny). Find genomic location of candidate marker. 8

9 Bulks R S R Individual Plants S Bulk segregant analysis Finding location of BSA candidate marker Isolate marker band and confirm linkage with trait (easier said than done) Sequence candidate marker and perform sequence search to find physical location in genome. BLAST searches using web-based software protocols Gramene, NCBI, TIGR, others have BLAST tools 9

10 Gene location also identified by... Prior gene mapping efforts Gramene Cornucopia of information on trait inheritance, trait mapping, and detailed cross-referenced genome maps. Gene has been cloned identified and sequenced in rice or other species cloned doesn t mean there is a marker Prior gene mapping efforts Very broad background of genetic information available Most work done in exotic or foreign rice Wide crosses between tropical (indica) and temperate (japonica) rice. Limited amount of work done in USA rice Determine if trait or inheritance is relevant to USA germplasm. 10

11 Now that location is known Inheritance studies indicate chromosomal location of gene (or genes) controlling trait. Location may encompass 5-10 (+) cm region. Previously identified markers in region may have limitations. Reinvestigate location to identify markers useful for marker assisted breeding. Preferably less than 2 cm from trait. Useful in USA germplasm. Suitable for high throughput analysis. gene location Markers already in region of interest Types of markers that should be replaced Low throughput markers: RFLP, AFLP Poorly reproducible markers: RAPD Markers that are not polymorphic for your germplasm Distant markers depends on level of need, value of trait, cost of phenotyping try replacing if more than 2 cm away from gene Lab limitations: isozymes (plant proteins) 11

12 Markers already in region of interest Types of markers to keep: SSR, STS, SNP markers Must consider lab capabilities, what kind of markers you are able to score. Still need to test marker polymorphism for germplasm in use. Finding new markers in gene region Good to test mapped SSR markers in region Gramene database of SSR markers Over 2,500 SSRs available (now 18,000 +) Test for polymorphism in parents/germplasm of interest May have to test linkage with trait if genetic distance not known 12

13 Candidate SSR marker identification Entire Chromosome (180 cm) Focus on specific region (15 cm) Usually many SSRs available to test in region of interest Finding new markers in gene region Sometimes no polymorphic SSRs mapped in region of interest. Identify new SSR markers by searching within Nipponbare sequenced genome. Gramene, TIGR, etc database access points Download BAC sequences to find candidate SSR markers 13

14 SSR markers for Pi-z gene Gene mapped to center of chromosome 6. SSR markers available, but limitations on polymorphism and linkage distance. Wanted to find SSR markers more closely linked with gene than those already published. SSR markers for Pi-z gene Downloaded DNA sequence information from 20 BAC clones ( kbp in length) found in 8 cm region surrounding the Pi-z gene. 14

15 SSR markers for Pi-z gene Looked for SSR regions (repeats of CT, AG, AAT, ATT, etc.) having 10 or more repeats. Tested 72 candidate SSR markers (2 from Gramene) for polymorphisms and quality of amplification. Tested on parents from three crosses 19 did not work 18 were monomorphic 34 had limited polymorphism 14 polymorphic for two or three crosses SSR markers for Pi-z gene Note that 1 cm 593,000 bp of DNA in Pi-z region 15

16 STS markers Sequence Tagged Site markers Developed out of sequence info from: RFLP markers AFLP markers Cloned genes DNA sequence in region of interest PCR primers developed from sequence info for subsequent testing for marker polymorphism. STS markers PCR products analyzed for polymorphism Dominant marker: presence/absence of marker Codominant marker Length difference: directly scored Sequence difference CAPS marker: Test for differential digestion with restriction endonucleases SSCP, Tilling, etc. Leads to SNP-type marker 16

17 STS dominant marker for Pi-b gene Marker derived from cloned Pi-b gene sequence. Cultivars with Pi-b gene display amplification product, those without Pi-b gene show no amplification products. STS marker for aroma derived from RFLP marker RG28 Single nucleotide length difference in PCR amplification products. Marker is co-dominant. 17

18 SNP markers Single Nucleotide Polymorphism Can be in genes or intergenic regions. Can be in coding (exons) or non-coding regions of genes. Can be linked to gene/trait or Can be THE functional single base change that effects the trait you are looking at. SNP markers The vast majority of SNPs in your region of interest will not be in the gene controlling the trait. Identified by comparative sequencing. Limited database of SNP markers presently available. Won t (yet) find a set of SNP markers waiting to be used like the SSR or other markers available in the Gramene database. 18

19 SNP markers Markers can be found by independent sequencing efforts (in your own lab). Can also be found by in silico sequence comparisons. Download sequences and look for polymorphisms. Nipponbare and comparisons. cdna comparisons between various randomly sequenced accessions. SNP markers for the Pi-z locus Example of SNP marker linked to gene, not in gene itself. Hayashi et al. (2004) performed exhaustive DNA sequencing efforts (over 79,000 bp sequenced) in Pi-z gene region to find SNP markers linked with Pi-z and Pi-zt genes. Presented 19 SNP markers. 19

20 SNP markers for the Pi-z gene Hayashi et al. (2004) SNP markers for Pi-z shown on bottom. Waxy gene SNP markers TheWaxy gene encodes the enzyme called granule-bound starch synthase (GBSS), and is the major gene controlling amylose content in rice. Two mutations in the Waxy gene have been identified that are associate with either low or intermediate amylose content (Larkin and Park 2004; Chen et al. 2004). 20

21 Waxy gene SNP markers G/Ttatac----- Exon 1 SNP in the leader intron 5 splice site. G present in intermediate and high amylose content rice. T present in low amylose content rice. Waxy gene SNP markers Exon 6 SNP of non-glutinous accessions: A associated with highamylose and low-amylose rice accessions C associated with intermediate-amylose rice accessions 21

22 Waxy gene SNP markers Combine Exon 1 and Exon 6 SNPs: Four Haplotypes G-A G-C T-A T-C Associated with highamylose rice accessions Dixiebelle Jodon A201 Associated with intermediateamylose rice accessions Lemont Associated with lowamylose rice accessions Rico 1 Bengal Associated with glutinous rice accessions* Development of SNP markers Potentially many more SNPs than SSRs. Technology developing for very high throughput, many instruments and platforms being devised to score SNPs. Expensive to develop markers/find polymorphisms. Many SNPs found in indica/japonica comparisons. Only subset of above polymorphisms (10% or less) found in any single japonica/japonica cross, different polymorphisms found in different crosses. 22

23 Thanking the combined efforts of: Molecular Genetics Joe Kepiro Eric Christensen Fran Pontasch Mickey Frank Genetics Shannon Pinson Faye Seaberg Pathology Toni Marchetti Robert Shank Variety Improvement Anna McClung Jodie Cammack Rick Boyd Pat Carre Cereal Chemistry Ming-Hsuan Chen Christine Bergman Janis Delgado Naomi Gipson 23

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,

More information

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David

More information

Authors: Vivek Sharma and Ram Kunwar

Authors: Vivek Sharma and Ram Kunwar Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be

More information

I.1 The Principle: Identification and Application of Molecular Markers

I.1 The Principle: Identification and Application of Molecular Markers I.1 The Principle: Identification and Application of Molecular Markers P. Langridge and K. Chalmers 1 1 Introduction Plant breeding is based around the identification and utilisation of genetic variation.

More information

Course Syllabus for FISH/CMBL 7660 Fall 2008

Course Syllabus for FISH/CMBL 7660 Fall 2008 Course Syllabus for FISH/CMBL 7660 Fall 2008 Course title: Molecular Genetics and Biotechnology Course number: FISH 7660/CMBL7660 Instructor: Dr. John Liu Room: 303 Swingle Hall Lecture: 8:00-9:15 a.m.

More information

PCB Fa Falll l2012

PCB Fa Falll l2012 PCB 5065 Fall 2012 Molecular Markers Bassi and Monet (2008) Morphological Markers Cai et al. (2010) JoVE Cytogenetic Markers Boskovic and Tobutt, 1998 Isozyme Markers What Makes a Good DNA Marker? High

More information

Using molecular marker technology in studies on plant genetic diversity Final considerations

Using molecular marker technology in studies on plant genetic diversity Final considerations Using molecular marker technology in studies on plant genetic diversity Final considerations Copyright: IPGRI and Cornell University, 2003 Final considerations 1 Contents! When choosing a technique...!

More information

Lecture 12. Genomics. Mapping. Definition Species sequencing ESTs. Why? Types of mapping Markers p & Types

Lecture 12. Genomics. Mapping. Definition Species sequencing ESTs. Why? Types of mapping Markers p & Types Lecture 12 Reading Lecture 12: p. 335-338, 346-353 Lecture 13: p. 358-371 Genomics Definition Species sequencing ESTs Mapping Why? Types of mapping Markers p.335-338 & 346-353 Types 222 omics Interpreting

More information

MICROSATELLITE MARKER AND ITS UTILITY

MICROSATELLITE MARKER AND ITS UTILITY Your full article ( between 500 to 5000 words) - - Do check for grammatical errors or spelling mistakes MICROSATELLITE MARKER AND ITS UTILITY 1 Prasenjit, D., 2 Anirudha, S. K. and 3 Mallar, N.K. 1,2 M.Sc.(Agri.),

More information

Introduction to some aspects of molecular genetics

Introduction to some aspects of molecular genetics Introduction to some aspects of molecular genetics Julius van der Werf (partly based on notes from Margaret Katz) University of New England, Armidale, Australia Genetic and Physical maps of the genome...

More information

Midterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score

Midterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the

More information

Using mutants to clone genes

Using mutants to clone genes Using mutants to clone genes Objectives 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype

More information

Existing potato markers and marker conversions. Walter De Jong PAA Workshop August 2009

Existing potato markers and marker conversions. Walter De Jong PAA Workshop August 2009 Existing potato markers and marker conversions Walter De Jong PAA Workshop August 2009 1 What makes for a good marker? diagnostic for trait of interest robust works even with DNA of poor quality or low

More information

Mapping and Mapping Populations

Mapping and Mapping Populations Mapping and Mapping Populations Types of mapping populations F 2 o Two F 1 individuals are intermated Backcross o Cross of a recurrent parent to a F 1 Recombinant Inbred Lines (RILs; F 2 -derived lines)

More information

Module 1 Principles of plant breeding

Module 1 Principles of plant breeding Covered topics, Distance Learning course Plant Breeding M1-M5 V2.0 Dr. Jan-Kees Goud, Wageningen University & Research The five main modules consist of the following content: Module 1 Principles of plant

More information

BENG 183 Trey Ideker. Genotyping. To be covered in one 1.5 hr lecture

BENG 183 Trey Ideker. Genotyping. To be covered in one 1.5 hr lecture BENG 183 Trey Ideker Genotyping To be covered in one 1.5 hr lecture Genetic variation: Some basic definitions Allele Alternative form of a genetic locus inherited separately from each parent Polymorphism

More information

Map-Based Cloning of Qualitative Plant Genes

Map-Based Cloning of Qualitative Plant Genes Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward

More information

Gene Tagging with Random Amplified Polymorphic DNA (RAPD) Markers for Molecular Breeding in Plants

Gene Tagging with Random Amplified Polymorphic DNA (RAPD) Markers for Molecular Breeding in Plants Critical Reviews in Plant Sciences, 20(3):251 275 (2001) Gene Tagging with Random Amplified Polymorphic DNA (RAPD) Markers for Molecular Breeding in Plants S. A. Ranade, * Nuzhat Farooqui, Esha Bhattacharya,

More information

Comparative study of EST-SSR, SSR, RAPD, and ISSR and their transferability analysis in pea, chickpea and mungbean

Comparative study of EST-SSR, SSR, RAPD, and ISSR and their transferability analysis in pea, chickpea and mungbean EUROPEAN ACADEMIC RESEARCH Vol. IV, Issue 2/ May 2016 ISSN 2286-4822 www.euacademic.org Impact Factor: 3.4546 (UIF) DRJI Value: 5.9 (B+) Comparative study of EST-SSR, SSR, RAPD, and ISSR and their transferability

More information

GDMS Templates Documentation GDMS Templates Release 1.0

GDMS Templates Documentation GDMS Templates Release 1.0 GDMS Templates Documentation GDMS Templates Release 1.0 1 Table of Contents 1. SSR Genotyping Template 03 2. DArT Genotyping Template... 05 3. SNP Genotyping Template.. 08 4. QTL Template.. 09 5. Map Template..

More information

5 Results. 5.1 AB-QTL analysis. Results Phenotypic traits

5 Results. 5.1 AB-QTL analysis. Results Phenotypic traits 5 esults 5.1 AB-QTL analysis 5.1.1 Phenotypic traits The correlation coefficients for each trait between different environments were mostly positive and significant (Table 5.1), except for the traits of

More information

Using mutants to clone genes

Using mutants to clone genes Using mutants to clone genes Objectives: 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype

More information

Sept 2. Structure and Organization of Genomes. Today: Genetic and Physical Mapping. Sept 9. Forward and Reverse Genetics. Genetic and Physical Mapping

Sept 2. Structure and Organization of Genomes. Today: Genetic and Physical Mapping. Sept 9. Forward and Reverse Genetics. Genetic and Physical Mapping Sept 2. Structure and Organization of Genomes Today: Genetic and Physical Mapping Assignments: Gibson & Muse, pp.4-10 Brown, pp. 126-160 Olson et al., Science 245: 1434 New homework:due, before class,

More information

Current Applications and Future Potential of High Resolution Melting at the National Clonal Germplasm Repository in Corvallis, Oregon

Current Applications and Future Potential of High Resolution Melting at the National Clonal Germplasm Repository in Corvallis, Oregon Current Applications and Future Potential of High Resolution Melting at the National Clonal Germplasm Repository in Corvallis, Oregon Nahla Bassil 1, Michael Dossett 2, Vidyasagar Sathuvalli 2, Chad Finn

More information

Gene Mapping in Natural Plant Populations Guilt by Association

Gene Mapping in Natural Plant Populations Guilt by Association Gene Mapping in Natural Plant Populations Guilt by Association Leif Skøt What is linkage disequilibrium? 12 Natural populations as a tool for gene mapping 13 Conclusion 15 POPULATIONS GUILT BY ASSOCIATION

More information

INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS

INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS ORIGINAL: English DATE: October 21, 2010 INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA E GUIDELINES FOR DNA-PROFILING: MOLECULAR MARKER SELECTION AND DATABASE CONSTRUCTION (

More information

A brief introduction to Marker-Assisted Breeding. a BASF Plant Science Company

A brief introduction to Marker-Assisted Breeding. a BASF Plant Science Company A brief introduction to Marker-Assisted Breeding a BASF Plant Science Company Gene Expression DNA is stored in chromosomes within the nucleus of each cell RNA Cell Chromosome Gene Isoleucin Proline Valine

More information

Genetic and Molecular Characterization of Host-Plant Resistance to Root-knot Nematodes and Fusarium Wilt in Cotton

Genetic and Molecular Characterization of Host-Plant Resistance to Root-knot Nematodes and Fusarium Wilt in Cotton Genetic and Molecular Characterization of Host-Plant Resistance to Root-knot Nematodes and Fusarium Wilt in Cotton Phil Roberts & Congli Wang, Department of Nematology Univ. of California, Riverside Project

More information

Concepts: What are RFLPs and how do they act like genetic marker loci?

Concepts: What are RFLPs and how do they act like genetic marker loci? Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th

More information

Genetics Effective Use of New and Existing Methods

Genetics Effective Use of New and Existing Methods Genetics Effective Use of New and Existing Methods Making Genetic Improvement Phenotype = Genetics + Environment = + To make genetic improvement, we want to know the Genetic value or Breeding value for

More information

Genomic resources and gene/qtl discovery in cereals

Genomic resources and gene/qtl discovery in cereals Genomic resources and gene/qtl discovery in cereals Roberto Tuberosa Dept. of Agroenvironmental Sciences & Technology University of Bologna, Italy The ABDC Congress 1-4 March 2010 Gudalajara, Mexico Outline

More information

Development of Rice Cultivars for the Southern US. TRRF Report on 2004 Research. Funding: March 1, 2004 Feb. 28, 2005.

Development of Rice Cultivars for the Southern US. TRRF Report on 2004 Research. Funding: March 1, 2004 Feb. 28, 2005. Development of Rice Cultivars for the Southern US TRRF Report on 2004 Research Funding: March 1, 2004 Feb. 28, 2005 Amount: $46,906 Final Report Jan. 5, 2005 Anna McClung USDA-ARS Rodante Tabien Texas

More information

The Human Genome Project has always been something of a misnomer, implying the existence of a single human genome

The Human Genome Project has always been something of a misnomer, implying the existence of a single human genome The Human Genome Project has always been something of a misnomer, implying the existence of a single human genome Of course, every person on the planet with the exception of identical twins has a unique

More information

MAS refers to the use of DNA markers that are tightly-linked to target loci as a substitute for or to assist phenotypic screening.

MAS refers to the use of DNA markers that are tightly-linked to target loci as a substitute for or to assist phenotypic screening. Marker assisted selection in rice Introduction The development of DNA (or molecular) markers has irreversibly changed the disciplines of plant genetics and plant breeding. While there are several applications

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

B) You can conclude that A 1 is identical by descent. Notice that A2 had to come from the father (and therefore, A1 is maternal in both cases).

B) You can conclude that A 1 is identical by descent. Notice that A2 had to come from the father (and therefore, A1 is maternal in both cases). Homework questions. Please provide your answers on a separate sheet. Examine the following pedigree. A 1,2 B 1,2 A 1,3 B 1,3 A 1,2 B 1,2 A 1,2 B 1,3 1. (1 point) The A 1 alleles in the two brothers are

More information

SCSC, GENE, MEPS and BIOT 654: Analysis of Complex Genomes (Lec) Spring 2018

SCSC, GENE, MEPS and BIOT 654: Analysis of Complex Genomes (Lec) Spring 2018 SCSC, GENE, MEPS and BIOT 654: Analysis of Complex Genomes (Lec) 1. Instructor: Spring 2018 Name: Professor Dr. Hongbin Zhang E-mail: hbz7049@tamu.edu Office: 427A Heep Center Office Phone: 862-2244 Office

More information

Association Mapping. Mendelian versus Complex Phenotypes. How to Perform an Association Study. Why Association Studies (Can) Work

Association Mapping. Mendelian versus Complex Phenotypes. How to Perform an Association Study. Why Association Studies (Can) Work Genome 371, 1 March 2010, Lecture 13 Association Mapping Mendelian versus Complex Phenotypes How to Perform an Association Study Why Association Studies (Can) Work Introduction to LOD score analysis Common

More information

3I03 - Eukaryotic Genetics Repetitive DNA

3I03 - Eukaryotic Genetics Repetitive DNA Repetitive DNA Satellite DNA Minisatellite DNA Microsatellite DNA Transposable elements LINES, SINES and other retrosequences High copy number genes (e.g. ribosomal genes, histone genes) Multifamily member

More information

Exam 2 CSS/Hort 430/

Exam 2 CSS/Hort 430/ 1 Exam 2 CSS/Hort 430/530 2012 1. In a deoxyribonucleotide, 5 and 3 refer to the a. start site for transcription. b. start site for translation. c. carbons where (respectively) the pyrimidine and purine

More information

Introduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph

Introduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph Introduction to Plant Genomics and Online Resources Manish Raizada University of Guelph Genomics Glossary http://www.genomenewsnetwork.org/articles/06_00/sequence_primer.shtml Annotation Adding pertinent

More information

Development of Molecular Markers for Purity Testing in Thai Jasmine Rice

Development of Molecular Markers for Purity Testing in Thai Jasmine Rice "Science Stays True Here" Advances in Ecological and Environmental Research, 35-44 Science Signpost Publishing Development of Molecular Markers for Purity Testing in Thai Jasmine Rice Varapong Chamarerk

More information

Verification and evaluation of grain QTLs using RILs from TD70 x Kasalath in rice

Verification and evaluation of grain QTLs using RILs from TD70 x Kasalath in rice Verification and evaluation of grain QTLs using RILs from TD70 x Kasalath in rice Y.D. Zhang 1,2, J. Zheng 2, Z.K. Liang 3, Y.L. Liang 1, Z.H. Peng 3 and C.L. Wang 1, 2 1 College of Agriculture, Nanjing

More information

POPULATION GENETICS studies the genetic. It includes the study of forces that induce evolution (the

POPULATION GENETICS studies the genetic. It includes the study of forces that induce evolution (the POPULATION GENETICS POPULATION GENETICS studies the genetic composition of populations and how it changes with time. It includes the study of forces that induce evolution (the change of the genetic constitution)

More information

PCR-based technologies Latest strategies

PCR-based technologies Latest strategies Using molecular marker technology in studies on plant genetic diversity DNA-based technologies PCR-based technologies Latest strategies (DNA sequencing, ESTs, microarrays, DArT, SNPs) Copyright: IPGRI

More information

STANDER, l.r., Betaseed, Inc. P.O. Box 859, Kimberly, ID The relationship between biotechnology and classical plant breeding.

STANDER, l.r., Betaseed, Inc. P.O. Box 859, Kimberly, ID The relationship between biotechnology and classical plant breeding. STANDER, l.r., Betaseed, Inc. P.O. Box 859, Kimberly, ID 83341. The relationship between biotechnology and classical plant breeding. Plant breeders have been relatively successful over the years. Duvick

More information

Traditional Genetic Improvement. Genetic variation is due to differences in DNA sequence. Adding DNA sequence data to traditional breeding.

Traditional Genetic Improvement. Genetic variation is due to differences in DNA sequence. Adding DNA sequence data to traditional breeding. 1 Introduction What is Genomic selection and how does it work? How can we best use DNA data in the selection of cattle? Mike Goddard 5/1/9 University of Melbourne and Victorian DPI of genomic selection

More information

Biotechnology Chapter 20

Biotechnology Chapter 20 Biotechnology Chapter 20 DNA Cloning DNA Cloning AKA Plasmid-based transformation or molecular cloning First off-let s sum up what happens. A plasmid is taken from a bacteria A gene is inserted into the

More information

Development of Genomic Tools for RKN Resistance Breeding in Cotton

Development of Genomic Tools for RKN Resistance Breeding in Cotton Development of Genomic Tools for RKN Resistance Breeding in Cotton Dr. Hongbin Zhang Department of Soil & Crop Sciences and Institute for Plant Genomics & Biotechnology Texas A&M University, College Station,

More information

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene

More information

Genetic Polymorphism of Wx Gene and Its Correlation with Main Grain Quality Characteristics in Rice

Genetic Polymorphism of Wx Gene and Its Correlation with Main Grain Quality Characteristics in Rice Rice Science, 2007, 14(2): 85-93 Copyright 2007, China National Rice Research Institute. Published by Elsevier BV. All rights reserved Genetic Polymorphism of Wx Gene and Its Correlation with Main Grain

More information

Applied Bioinformatics

Applied Bioinformatics Applied Bioinformatics In silico and In clinico characterization of genetic variations Assistant Professor Department of Biomedical Informatics Center for Human Genetics Research ATCAAAATTATGGAAGAA ATCAAAATCATGGAAGAA

More information

INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA

INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA E BMT Guidelines (proj.4) ORIGINAL: English DATE: December 21, 2005 INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA GUIDELINES FOR DNA-PROFILING: MOLECULAR MARKER SELECTION AND

More information

SNPs - GWAS - eqtls. Sebastian Schmeier

SNPs - GWAS - eqtls. Sebastian Schmeier SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association

More information

Association studies (Linkage disequilibrium)

Association studies (Linkage disequilibrium) Positional cloning: statistical approaches to gene mapping, i.e. locating genes on the genome Linkage analysis Association studies (Linkage disequilibrium) Linkage analysis Uses a genetic marker map (a

More information

Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection

Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Awais Khan Adaptation and Abiotic Stress Genetics, Potato and sweetpotato International Potato

More information

Molecular markers in plant breeding

Molecular markers in plant breeding Molecular markers in plant breeding Jumbo MacDonald et al., MAIZE BREEDERS COURSE Palace Hotel Arusha, Tanzania 4 Sep to 16 Sep 2016 Molecular Markers QTL Mapping Association mapping GWAS Genomic Selection

More information

Application of Genotyping-By-Sequencing and Genome-Wide Association Analysis in Tetraploid Potato

Application of Genotyping-By-Sequencing and Genome-Wide Association Analysis in Tetraploid Potato Application of Genotyping-By-Sequencing and Genome-Wide Association Analysis in Tetraploid Potato Sanjeev K Sharma Cell and Molecular Sciences The 3 rd Plant Genomics Congress, London 12 th May 2015 Potato

More information

Let s call the recessive allele r and the dominant allele R. The allele and genotype frequencies in the next generation are:

Let s call the recessive allele r and the dominant allele R. The allele and genotype frequencies in the next generation are: Problem Set 8 Genetics 371 Winter 2010 1. In a population exhibiting Hardy-Weinberg equilibrium, 23% of the individuals are homozygous for a recessive character. What will the genotypic, phenotypic and

More information

Identifying Genes Underlying QTLs

Identifying Genes Underlying QTLs Identifying Genes Underlying QTLs Reading: Frary, A. et al. 2000. fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289:85-87. Paran, I. and D. Zamir. 2003. Quantitative

More information

Plant breeding QTL (Quantitative Trait Loci)

Plant breeding QTL (Quantitative Trait Loci) Plant breeding Methods and use of classical plant breeding. Molecular marker technology, Marker assisted selection in plant breeding. QTL (Quantitative Trait Loci), Genetic analysis and characterization

More information

Applicazioni biotecnologiche

Applicazioni biotecnologiche Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence

More information

Chapter 5. Structural Genomics

Chapter 5. Structural Genomics Chapter 5. Structural Genomics Contents 5. Structural Genomics 5.1. DNA Sequencing Strategies 5.1.1. Map-based Strategies 5.1.2. Whole Genome Shotgun Sequencing 5.2. Genome Annotation 5.2.1. Using Bioinformatic

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

ABSTRACT : 162 IQUIRA E & BELZILE F*

ABSTRACT : 162 IQUIRA E & BELZILE F* ABSTRACT : 162 CHARACTERIZATION OF SOYBEAN ACCESSIONS FOR SCLEROTINIA STEM ROT RESISTANCE AND ASSOCIATION MAPPING OF QTLS USING A GENOTYPING BY SEQUENCING (GBS) APPROACH IQUIRA E & BELZILE F* Département

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

Genetic characterization and polymorphism detection of casein genes in Egyptian sheep breeds

Genetic characterization and polymorphism detection of casein genes in Egyptian sheep breeds Genetic characterization and polymorphism detection of casein genes in Egyptian sheep breeds Othman E. Othman and Samia A. El-Fiky Cell Biology Department - National Research Center - Dokki - Egypt Corresponding

More information

Restriction Enzymes (endonucleases)

Restriction Enzymes (endonucleases) In order to understand and eventually manipulate DNA (human or otherwise) an array of DNA technologies have been developed. Here are some of the tools: Restriction Enzymes (endonucleases) In order to manipulate

More information

Department of Biotechnology. Molecular Markers. In plant breeding. Nitin Swamy

Department of Biotechnology. Molecular Markers. In plant breeding. Nitin Swamy Department of Biotechnology Molecular Markers Nitin Swamy In plant breeding 17 1. Introduction Molecular breeding (MB) may be defined in a broad-sense as the use of genetic manipulation performed at DNA

More information

Genetic Study of Ascochyta Blight Resistance in Chickpea and Lentil

Genetic Study of Ascochyta Blight Resistance in Chickpea and Lentil Genetic Study of Ascochyta Blight Resistance in Chickpea and Lentil B. Tar an 1, L. Buchwaldt 2, C. Breitkreutz 1, A. Tullu 1, T. Warkentin 1, S. Banniza 1 and A. Vandenberg 1 1 Crop Development Centre,

More information

Lecture 23: Causes and Consequences of Linkage Disequilibrium. November 16, 2012

Lecture 23: Causes and Consequences of Linkage Disequilibrium. November 16, 2012 Lecture 23: Causes and Consequences of Linkage Disequilibrium November 16, 2012 Last Time Signatures of selection based on synonymous and nonsynonymous substitutions Multiple loci and independent segregation

More information

Molecular studies (SSR) for screening of genetic variability among direct regenerants of sugarcane clone NIA-98

Molecular studies (SSR) for screening of genetic variability among direct regenerants of sugarcane clone NIA-98 Molecular studies (R) for screening of genetic variability among direct regenerants of sugarcane clone NIA-98 Dr. Imtiaz A. Khan Pr. cientist / PI sugarcane and molecular marker group NIA-2012 NIA-2010

More information

Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010

Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of

More information

Digital genotyping of sorghum a diverse plant species with a large repeat-rich genome

Digital genotyping of sorghum a diverse plant species with a large repeat-rich genome Morishige et al. BMC Genomics 2013, 14:448 METHODOLOGY ARTICLE Open Access Digital genotyping of sorghum a diverse plant species with a large repeat-rich genome Daryl T Morishige 1, Patricia E Klein 2,

More information

BICD100 Midterm (10/27/10) KEY

BICD100 Midterm (10/27/10) KEY BICD100 Midterm (10/27/10) KEY 1. Variation in tail length is characteristic of some dog breeds, such as Pembroke Welsh Corgis, which sometimes show a bob tail (short tail) phenotype (see illustration

More information

MOLECULAR TYPING TECHNIQUES

MOLECULAR TYPING TECHNIQUES MOLECULAR TYPING TECHNIQUES RATIONALE Used for: Identify the origin of a nosocomial infection Identify transmission of disease between individuals Recognise emergence of a hypervirulent strain Recognise

More information

Major Genes Conditioning Resistance to Rust in Common Bean. and a Protocol for Monitoring Local races of the Bean Rust Pathogne

Major Genes Conditioning Resistance to Rust in Common Bean. and a Protocol for Monitoring Local races of the Bean Rust Pathogne Major Genes Conditioning Resistance to Rust in Common Bean and a Protocol for Monitoring Local races of the Bean Rust Pathogne M.A. Pastor-Corrales Soybean Genomics and Improvement Laboratory, ARS-USDA,

More information

GENE MAPPING. Genetica per Scienze Naturali a.a prof S. Presciuttini

GENE MAPPING. Genetica per Scienze Naturali a.a prof S. Presciuttini GENE MAPPING Questo documento è pubblicato sotto licenza Creative Commons Attribuzione Non commerciale Condividi allo stesso modo http://creativecommons.org/licenses/by-nc-sa/2.5/deed.it Genetic mapping

More information

3 -end. Sau3A. 3 -end TAA TAA. ~9.1kb SalI TAA. ~12.6kb. HindШ ATG 5,860bp TAA. ~12.7kb

3 -end. Sau3A. 3 -end TAA TAA. ~9.1kb SalI TAA. ~12.6kb. HindШ ATG 5,860bp TAA. ~12.7kb Supplemental Data. Chen et al. (2008). Badh2, encoding betaine aldehyde dehydrogenase, inhibits the biosynthesis of 2-acetyl-1-pyrroline, a major component in rice fragrance. A pcam-cah/cah Sau3A Promoter

More information

ANNUAL REPORT COMPREHENSIVE RESEARCH ON RICE January 1, 2015 December 31, Application of Forward and Reverse Genetics to Rice Improvement

ANNUAL REPORT COMPREHENSIVE RESEARCH ON RICE January 1, 2015 December 31, Application of Forward and Reverse Genetics to Rice Improvement ANNUAL REPORT COMPREHENSIVE RESEARCH ON RICE January 1, 2015 December 31, 2015 PROJECT TITLE: PROJECT LEADER: Application of Forward and Reverse Genetics to Rice Improvement Thomas H. Tai, Research Geneticist,

More information

Supplementary Data 1.

Supplementary Data 1. Supplementary Data 1. Evaluation of the effects of number of F2 progeny to be bulked (n) and average sequencing coverage (depth) of the genome (G) on the levels of false positive SNPs (SNP index = 1).

More information

Rice Research Focused on Production Challenges and Market Opportunities. An Overview of the USDA-ARS Dale Bumpers National Rice Research Center

Rice Research Focused on Production Challenges and Market Opportunities. An Overview of the USDA-ARS Dale Bumpers National Rice Research Center Rice Research Focused on Production Challenges and Market Opportunities An Overview of the USDA-ARS Dale Bumpers National Rice Research Center Anna McClung Center Director/Research Leader USDA ARS Annual

More information

Carcass Traits Association with GH/AluI Gene Polymorphism in Indonesian Aceh Cattle

Carcass Traits Association with GH/AluI Gene Polymorphism in Indonesian Aceh Cattle Carcass Traits Association with GH/AluI Gene Polymorphism in Indonesian Aceh Cattle Eka Meutia Sari¹,*, Ronny Rachman Noor 2, Cece Sumantri 2 & Endang Tri Margawati 3 ¹ Department of Animal Production,

More information

Human Genetic Variation. Ricardo Lebrón Dpto. Genética UGR

Human Genetic Variation. Ricardo Lebrón Dpto. Genética UGR Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.

More information

International Training Course on Maize Molecular Breeding April 5 16, 2010, CIMMYT, El Batan, México. ccmaize

International Training Course on Maize Molecular Breeding April 5 16, 2010, CIMMYT, El Batan, México. ccmaize International Training Course on Maize Molecular Breeding April 5 16, 2010, CIMMYT, El Batan, México Choice of Marker Systems and Genotyping Platforms Yunbi Xu International Maize and Wheat Improvement

More information

Pharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001

Pharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 Pharmacogenetics: A SNPshot of the Future Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 1 I. What is pharmacogenetics? It is the study of how genetic variation affects drug response

More information

Your name: BSCI410-LIU/Spring 2007 Homework #2 Due March 27 (Tu), 07

Your name: BSCI410-LIU/Spring 2007 Homework #2 Due March 27 (Tu), 07 BSCI410-LIU/Spring 2007 Homework #2 Due March 27 (Tu), 07 KEY 1. What are each of the following molecular markers? (Indicate (a) what they stand for; (b) the nature of the molecular polymorphism and (c)

More information

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical

More information

Who, When, and Where. Section Days & Times

Who, When, and Where. Section Days & Times 1 GENERAL INFORMATION Who, When, and Where Section 01 02 Days & Times Professors Teaching Assistants Laboratory Coordinator M 12:20 4:25 pm W 1:25 4:25 pm Sam Hazen Assistant Professor, Biology 409A Morrill

More information

COMPARATIVE GENOME ANALYSIS AND RESISTANCE GENE MAPPING IN GRAIN LEGUMES

COMPARATIVE GENOME ANALYSIS AND RESISTANCE GENE MAPPING IN GRAIN LEGUMES COMPARATIVE GENOME ANALYSIS AND RESISTANCE 847004 GENE MAPPING IN GRAIN LEGUMES N.D. YOUNG Department of Plant Pathology, University of Minnesota, St. Paul, Minnesota, United States of America Abstract

More information

Molecular Marker Techniques: A Review

Molecular Marker Techniques: A Review International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Special Issue-6 pp. 816-825 Journal homepage: http://www.ijcmas.com Review Article Molecular Marker Techniques: A Review

More information

PBG 430/530 Exam

PBG 430/530 Exam 1 PBG 430/530 Exam 2 2013 1. In a deoxyribonucleotide, 5 and 3 refer to the a. start site for transcription. b. start site for translation. c. carbons where (respectively) the phosphate and hydroxyl groups

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

Basics of AFLP and. microsatellite analysis

Basics of AFLP and. microsatellite analysis Basics of AFLP and microsatellite analysis Amplified Fragment Length Polymorphism Pros: Large number of markers with relatively little lab effort No prior information about genome needed Genome wide overage

More information

Mutations during meiosis and germ line division lead to genetic variation between individuals

Mutations during meiosis and germ line division lead to genetic variation between individuals Mutations during meiosis and germ line division lead to genetic variation between individuals Types of mutations: point mutations indels (insertion/deletion) copy number variation structural rearrangements

More information

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology. G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic

More information

Molecular Markers CRITFC Genetics Workshop December 9, 2014

Molecular Markers CRITFC Genetics Workshop December 9, 2014 Molecular Markers CRITFC Genetics Workshop December 9, 2014 Molecular Markers Tools that allow us to collect information about an individual, a population, or a species Application in fisheries mating

More information

Molecular and Applied Genetics

Molecular and Applied Genetics Molecular and Applied Genetics Ian King, Iain Donnison, Helen Ougham, Julie King and Sid Thomas Developing links between rice and the grasses 6 Gene isolation 7 Informatics 8 Statistics and multivariate

More information

Enzyme that uses RNA as a template to synthesize a complementary DNA

Enzyme that uses RNA as a template to synthesize a complementary DNA Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have

More information

Chapter 1 Molecular Genetic Approaches to Maize Improvement an Introduction

Chapter 1 Molecular Genetic Approaches to Maize Improvement an Introduction Chapter 1 Molecular Genetic Approaches to Maize Improvement an Introduction Robert T. Fraley In the following chapters prominent scientists will discuss the recent genetic improvements in maize that have

More information