Title:Inhibition of hematopoietic prostaglandin D2 Synthase (H-PGDS) by alkaloids from Combretum molle

Size: px
Start display at page:

Download "Title:Inhibition of hematopoietic prostaglandin D2 Synthase (H-PGDS) by alkaloids from Combretum molle"

Transcription

1 Author's response to reviews Title:Inhibition of hematopoietic prostaglandin D2 Synthase (H-PGDS) by Authors: Rejoice Moyo Theresa Chimponda Stanley Mukanganyama Version:4Date:4 June 2014 Author's response to reviews: see over

2 Reviewer's report Title: Inhibition of hematopoietic prostaglandin D2 Synthase (H-PGDS) by Version:1Date:15 May 2014 Reviewer: Fu-Ming Tsai Reviewer's report: The manuscript by Moyo et al. report that the alkaloid from Combretum molle has potent to inhibit the H-PGDS activity. These results based on an enzyme's kinetics assay. Alkaloids are a group of naturally chemical compounds. Since the crude extract is the source for studying the kinetics of enzyme activity, it is difficult to reproduce the same results all over the world due to the different place of the product for plant or the various components within alkaloids. Therefore, similar result will be more convinced when used the pure components in this study. Major Compulsory Revisions 1. The authors should state the components in crude extract. Is the alkaloid from Combretum molle a pure compound? What is the structure or the composition? If the extract is a mixture, the use of major compound in purified alkaloid to validate the inhibition effect on H-PTGDS will be very helpful. The alkaloids isolated from C. molle are not pure. These were actually a mixture. The method we used was selective for isolation of any nitrogen-containing cyclic phytochemicals. Although working with a pure compound may be more useful, however, the pure compound may not possess activity as compared to the crude alkaloid extract. We isolated alkaloids as we wanted to determine if the alkaloid extract possessed anti- H-PGDS activity. 2. In the result section, the H-PGDS expression should be presented (Coomassie blue staining and Western blot for poly-his tag). Data not shown is not appropriated to mention the expression of H-PGDS. The expression has been changed to Coomassie blue staining and Western blot for poly-his tag as stated and Data not shown has been deleted. 3. The discussion is limited and too descriptive of the data. A more in depth discussion of the possible results of the demonstrated changes to H-PTGDS function on cells or immune system, or comparison of each compound (drug) on inflammatory response would be beneficial. We have tried to give a possible response to the immune system. However, as indicated there are not as many studies that have been done. Since a crude alkaloid extract was used, we cannot discuss the effects of each drug on inflammatory response. 4. In table I legend, does alkaloids have a significant effect in blocking the kinetic of GST? Please perform the statistical analysis. One-way analysis of variance test

3 (ANOVA) with Dunnett s Multiple Comparison Test was used to analyse the results. Values represent the mean + SD for N= 2. The values with a p-value < 0.05 or less were considered statistically significant. * P < 0.05, ** P < 0.01, *** P< Graphical and Statistical analyses were carried out using Graphpad Prism 5 Software (Version 5.0, Graph pad Software Inc, San Diego, USA). The results indicate that increasing the concentration of the extracts especially at 10 and 20 µg/ml significtanly reduced the Km for GSH and CDNB as well as the K cat for both CDNB and GSH at 20 µg/ml. 5. The figure legends should be rewritten. Where appropriate, these legends have been re written. 6. Whether alkaloids may affect the PGD2 production? The authors evaluated the H-PGDS activity using the substrates CDNB and GSH. Can these results represent inhibiting effects of alkaloid in PGD2 production in physiology? The authors should mention the possibility. The results may represent the results in vivo. The studies with CDNB allows for selection of potential inhibitors even when PGH2 is used. However, further experiments with PGH 2 need to be carried out. Minor essential revisions 1. The abbreviation should only be used when a word appears at least three times in abstract or main article (from introduction to discuss). The full name of a word only appears the first time, followed by typing its abbreviated name. The GSH in abstract need to type full name, whereas the full name glutathione in methods and discuss need to be changed to abbreviation. Also, authors need to check the CDNB typing throughout all manuscript. The abbreviations have been used as advised. 2. There are many errors in describing the city of the manufactures of chemicals and equipment. (page 7, line 2, 14, 15; page 8, line 2, 19, city need to be stated), page 7 line 16, German? CA or California? USA or U.S.A? New York or NY? The cities have been written in full. 3. The H-PGDS plasmid is obtained from someone else. What is the tag carried when H-PGDS is expressed. In other hand, when the protein is expressed, what is the predict M.W. of the tagged protein. The construct detail needs to be stated in detail in the method section. The H-PGDS is 6-Histidine tagged. The pjexpress 401 expression vector was used. The estimated M.W of the protein is 23.4 kda. This has now been stated in the method section.

4 4. In method section, the authors mentioned that cells were then incubated at 160 rpm at 37 oc overnight in a SI 300 Lab companion, (Jeio Tech, Korea). Is this sentence exactly? The H-PGDS protein expression needs overnight induction by IPTG? We followed the procedure for the purification of other GSTs as outlined in the papers below. Kolm RK, Danielson UH, Zhang Y, Talalay P. and Mannervik B. Isothiocyanates as substrates for human glutathione transferases: structureactivity studies. Biochem. J. (1995) 311, Y.S. Zhang, R.H. Kolm, B. Mannervik, P. Talalay. Reversible Conjugation of Isothiocyanates with Glutathione Catalyzed by Human Glutathione Transferases. Biochemical and Biophysical Research Communications (1995) 206: Mukanganyama S, Bezabih M, Robert M, Ngadjui BT, Kapche GFW, Ngandeu F and Abegaz B. The evaluation of novel natural products as inhibitors of human glutathione transferase P1-1. Journal of Enzyme Inhibition and Medicinal Chemistry DOI: / After addition of IPTG, E. coli cells were grown for a further hours before harvesting them by centrifugation. This has been done for other GSTS such as GST A1-1, P1-1, M2-2, M4-4. Level of interest: An article of importance in its field Quality of written English: Needs some language corrections before being published Statistical review: No, the manuscript does not need to be seen by a statistician. Declaration of competing interests: I declare that I have no competing interest. Reviewer's report Title: Inhibition of hematopoietic prostaglandin D2 Synthase (H-PGDS) by Version: 1Date:31 March 2014 Reviewer: Sabariah Ismail Reviewer's report: Major Compulsory Revisions Since no specific alkaloid compounds of the plant extract were isolated and identified, it is recommended that the authors refer to their plant extract as the alkaloid extract of Combretum molle throughout the manuscript. The plant extract has been referred to the alkaloid extract of Combretum molle. Under the Discussion section, second paragraph, last line, "The investigation therefore, narrowed down to specific compounds.' That sentence can be taken out. This sentence has been deleted.

5 Minor Essential Revisions 1. Methods (i) Screening for inhibition of H-PGDS by alkaloids from C. molle The second sentence may be rewritten as "enzyme activity was determined through the measurement...and was done in quadruplicate". The sentence has been corrected and has been rewritten as advised. (ii) Determination of time-dependent effects The incubation mixtures contained H-PGDS (final concentration ? unit missing) "was investigated" at the end of the first sentence is to be deleted. The units have been inserted and the statement "was investigated" has been deleted. Results (i) Effect of the alkaloids on H-PGDS kinetics Spelling of "uncompetitive" and some minor grammatical errors to be corrected. The spelling has been corrected. Level of interest: An article of importance in its field Quality of written English: Needs some language corrections before being published Statistical review: No, the manuscript does not need to be seen by a statistician. Declaration of competing interests: I declare that I have no competing interests.

NOTE ACRYLAMIDE IS NEUROTOXIN YOU MUST WEAR GLOVES.

NOTE ACRYLAMIDE IS NEUROTOXIN YOU MUST WEAR GLOVES. GST Purfication and Pulldown Part I Instructor: David Deitcher TA: Kristy Lawton In order to study the function of a protein it is often useful to have that protein purified away from others in the cell.

More information

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and

More information

Rapid GST Inclusion Body Solubilization and Renaturation Kit

Rapid GST Inclusion Body Solubilization and Renaturation Kit Product Manual Rapid GST Inclusion Body Solubilization and Renaturation Kit Catalog Number AKR-110 FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Bacteria are widely used for His

More information

His- Tag Protein ELISA Kit

His- Tag Protein ELISA Kit Revised Protocol Product Manual His- Tag Protein ELISA Kit Catalog Numbers AKR- 130 96 wells FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction A polyhistidine-tag, or His-tag, is

More information

GST Fusion Protein Purification Kit

GST Fusion Protein Purification Kit Glutathione Resin GST Fusion Protein Purification Kit Cat. No. L00206 Cat. No. L00207 Technical Manual No. TM0185 Version 01042012 Index 1. Product Description 2. Related Products 3. Purification Procedure

More information

Purification of Lactate Dehydrogenase

Purification of Lactate Dehydrogenase Dominican University of California Dominican Scholar Scholarly & Creative Works Conference 2018 Scholarly and Creative Works Conference 2016 Apr 15th, 1:30 PM - 2:00 PM Purification of Lactate Dehydrogenase

More information

Title: Effects of thyroid hormone analogue and leukotrienes pathway blocker on renal ischemia/reperfusion injury in a mouse model.

Title: Effects of thyroid hormone analogue and leukotrienes pathway blocker on renal ischemia/reperfusion injury in a mouse model. Author's response to reviews Title: Effects of thyroid hormone analogue and leukotrienes pathway blocker on renal ischemia/reperfusion injury in a mouse model. Authors: Najah R hadi (drnajahhadi@yahoo.com)

More information

Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines

Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines Further information can be found at: http://stke.sciencemag.org/sites/default/files/researcharticlerevmsinstructions_0.pdf.

More information

Rapid GST Inclusion Body Solubilization and Renaturation Kit

Rapid GST Inclusion Body Solubilization and Renaturation Kit Product Manual Rapid GST Inclusion Body Solubilization and Renaturation Kit Catalog Number AKR-110 FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Bacteria are widely used for His

More information

electrophoresis tech Methods Materials

electrophoresis tech Methods Materials electrophoresis tech note 3176 Monitoring the Expression, Purification, and Processing of -Tagged Proteins Using the Experion Automated Electrophoresis System Xuemei He and William Strong, Bio-Rad Laboratories,

More information

Technical tips Session 5

Technical tips Session 5 Technical tips Session 5 Chromatine Immunoprecipitation (ChIP): This is a powerful in vivo method to quantitate interaction of proteins associated with specific regions of the genome. It involves the immunoprecipitation

More information

Strep-Spin Protein Miniprep Kit Catalog No. P2004, P2005

Strep-Spin Protein Miniprep Kit Catalog No. P2004, P2005 INSTRUCTION MANUAL Strep-Spin Protein Miniprep Kit Catalog No. P2004, P2005 Highlights Fast protocol to purify Strep-tagged proteins from cell-free extracts Screen your recombinant colonies directly for

More information

Aims: -Purification of a specific protein. -Study of protein-protein interactions

Aims: -Purification of a specific protein. -Study of protein-protein interactions Aims: -Purification of a specific protein -Study of protein-protein interactions This is a reliable method for purifying total IgG from crude protein mixtures such as serum. Protein A (linked to resin

More information

Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions

Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions Supporting Information Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions Lise Schoonen, b Sjors Maassen, b Roeland J. M. Nolte b and Jan C. M. van

More information

SUMOstar Gene Fusion Technology

SUMOstar Gene Fusion Technology Gene Fusion Technology NEW METHODS FOR ENHANCING FUNCTIONAL PROTEIN EXPRESSION AND PURIFICATION IN INSECT CELLS White Paper June 2007 LifeSensors Inc. 271 Great Valley Parkway Malvern, PA 19355 www.lifesensors.com

More information

Lecture 8: Affinity Chromatography-III

Lecture 8: Affinity Chromatography-III Lecture 8: Affinity Chromatography-III Key words: Chromatography; Affinity chromatography; Protein Purification During this lecture, we shall be studying few more examples of affinity chromatography. The

More information

Genlantis A division of Gene Therapy Systems, Inc Telesis Court San Diego, CA USA Telephone: or (US toll free)

Genlantis A division of Gene Therapy Systems, Inc Telesis Court San Diego, CA USA Telephone: or (US toll free) TurboCells BL21(DE3) TurboCells BL21(DE3)pLysS Chemically Competent E. coli Instruction Manual Catalog Numbers C302020 C303020 A division of Gene Therapy Systems, Inc. 10190 Telesis Court San Diego, CA

More information

BIOCHEMISTRY 551: BIOCHEMICAL METHODS SYLLABUS

BIOCHEMISTRY 551: BIOCHEMICAL METHODS SYLLABUS BIOCHEMISTRY 551: BIOCHEMICAL METHODS SYLLABUS Course Description: Biochemistry 551 is an integrated lecture, lab and seminar course that covers biochemistry-centered theory and techniques. The course

More information

ab GST tag ELISA Kit

ab GST tag ELISA Kit ab126581 GST tag ELISA Kit Instructions for Use For the quantitative measurement of the GST tag protein expression. This product is for research use only and is not intended for diagnostic use. Version

More information

Lecture 25 (11/15/17)

Lecture 25 (11/15/17) Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);

More information

Supplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17

Supplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17 Molecular Cell, Volume 65 Supplemental Information Pacer Mediates the Function of Class III PI3K and HOPS Complexes in Autophagosome Maturation by Engaging Stx17 Xiawei Cheng, Xiuling Ma, Xianming Ding,

More information

Strep-tag detection in Western blots

Strep-tag detection in Western blots Strep-tag detection in Western blots General protocol for the detection of Strep-tag fusion proteins Last date of revision April 2012 Version PR07-0010 www.strep-tag.com For research use only Important

More information

Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with

Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with concentration of 800nM) were incubated with 1mM dgtp for the indicated

More information

The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity

The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega

More information

1 ml gel corresponds to ml of 75% (v/v) Glutathione Agarose suspension.

1 ml gel corresponds to ml of 75% (v/v) Glutathione Agarose suspension. 1 AFFINITY GST PURIFICATION Procedure for Use Glutathione Agarose 4 Resin DESCRIPTION Glutathione Agarose Resin is used to purify recombinant derivatives of glutathione S-transferases or glutathione binding

More information

PRODUCT INFORMATION. Composition of SOC medium supplied :

PRODUCT INFORMATION. Composition of SOC medium supplied : Product Name : Competent Cell BL21(DE3)pLysS Code No. : DS260 Size : 100 μl 10 Competency : > 5 10 7 cfu/μg (puc19) Supplied product : SOC medium, 1 ml 10 This product is for research use only Description

More information

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807 INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended

More information

Rotation Report Sample Version 2. Due Date: August 9, Analysis of the Guanine Nucleotide Exchange Activity of the S. cerevisiae Ats1 Protein

Rotation Report Sample Version 2. Due Date: August 9, Analysis of the Guanine Nucleotide Exchange Activity of the S. cerevisiae Ats1 Protein Rotation Report Sample Version 2 Due Date: August 9, 1998 Analysis of the Guanine Nucleotide Exchange Activity of the S. cerevisiae Ats1 Protein Anita H. Corbett Advisor: Amy Jones Rotation 1 Abstract:

More information

Molecular Cloning. Joseph Sambrook. David W. Russell A LABORATORY MANUAL COLD SPRING HARBOR LABORATORY PRESS VOLUME.

Molecular Cloning. Joseph Sambrook. David W. Russell A LABORATORY MANUAL COLD SPRING HARBOR LABORATORY PRESS VOLUME. VOLUME Molecular Cloning A LABORATORY MANUAL THIRD EDITION www.molecularcloning.com Joseph Sambrook PETER MACCALLUM CANCER INSTITUTE AND THE UNIVERSITY OF MELBOURNE, AUSTRALIA David W. Russell UNIVERSITY

More information

Supplemental Information. Lithocholic Acid Hydroxyamide Destabilizes. Cyclin D1 and Induces G 0 /G 1 Arrest by Inhibiting. Deubiquitinase USP2a

Supplemental Information. Lithocholic Acid Hydroxyamide Destabilizes. Cyclin D1 and Induces G 0 /G 1 Arrest by Inhibiting. Deubiquitinase USP2a Cell Chemical Biology, Volume 24 Supplemental Information Lithocholic Acid Hydroxyamide Destabilizes Cyclin D1 and Induces G 0 /G 1 Arrest by Inhibiting Deubiquitinase USP2a Katarzyna Magiera, Marcin Tomala,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary Figure 1 Effect of ROCK inhibition on lumen abnormality in MDCK cysts. (A) MDCK cells as indicated cultured in Matrigel were treated with and without Y27632 (10

More information

Hossain_Supplemental Figure 1

Hossain_Supplemental Figure 1 Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT

More information

Sensitive protein:ligand biochemical assays using Corning Epic label-free technology on the EnSpire Multimode Plate Reader

Sensitive protein:ligand biochemical assays using Corning Epic label-free technology on the EnSpire Multimode Plate Reader APPLICATION NOTE Label-free Technology Authors Heidi Morgan, M.S. Sarah Burroughs, Ph.D. Paul Butler Janet Park-Bewsher, MBA Tim Cloutier, Ph.D. PerkinElmer, Inc. Waltham, MA 241 USA Sensitive protein:ligand

More information

pgbkt7 Anti- Myc AH109 strain (KDa) 50

pgbkt7 Anti- Myc AH109 strain (KDa) 50 pgbkt7 (KDa) 50 37 Anti- Myc AH109 strain Supplementary Figure 1. Protein expression of CRN and TDR in yeast. To analyse the protein expression of CRNKD and TDRKD, total proteins extracted from yeast culture

More information

Part-I. Purification and characterization of GSTs from sheep uterus

Part-I. Purification and characterization of GSTs from sheep uterus Part-I Purification and characterization of GSTs from sheep uterus 3.1.0.0. Introduction Glutathione S-transferases (GSTs, EC 2.5.1.18) are important family of proteins classified under class II detoxifying

More information

AFFINITY GST PURIFICATION

AFFINITY GST PURIFICATION DESCRIPTION Glutathione Agarose Resin is used to purify recombinant derivatives of glutathione S-transferases or glutathione binding proteins. are products that allow batch or column purifications. Purification

More information

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective

More information

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

More information

Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous

Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous Preparation and purification of polyclonal antibodies Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous injections of glutathione S-transferase-ARHGAP25-(509-619) (GST-coiled

More information

Tracking Cellular Protein Localization and Movement in Cells with a Flexible Fluorescent Labeling Technology. Chad Zimprich January 2015

Tracking Cellular Protein Localization and Movement in Cells with a Flexible Fluorescent Labeling Technology. Chad Zimprich January 2015 Tracking Cellular Protein Localization and Movement in Cells with a Flexible Fluorescent Labeling Technology Chad Zimprich January 2015 Presentation verview HaloTag Fusion Technology Design Functionality

More information

A General Protocol for GST Pull-down Lili Jing *

A General Protocol for GST Pull-down Lili Jing * A General Protocol for GST Pull-down Lili Jing * Department of Cell and Molecular Biology, University of Pennsylvania, Philadelphia, USA *For correspondence: lilijingcn@gmail.com [Abstract] GST pull-down

More information

EGFR (Phospho-Ser695)

EGFR (Phospho-Ser695) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely

More information

Proteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125

Proteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125 Proteomics Manickam Sugumaran Department of Biology University of Massachusetts Boston, MA 02125 Genomic studies produced more than 75,000 potential gene sequence targets. (The number may be even higher

More information

Note: for laboratory research use only. RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Signalway Biotechnology

Note: for laboratory research use only. RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Signalway Biotechnology Note: for laboratory research use only RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Cat. #: RP1202 (50preps) Signalway Biotechnology I. Kit Content, Storage Condition and Stability Content

More information

Why adapter ligation? Ligases. Oligonucleotide ligases. Definition of ligase

Why adapter ligation? Ligases. Oligonucleotide ligases. Definition of ligase Why adapter ligation? Ligases Introduction to s in general, and RA 1 / RA 2, truncated in particular mira bacterial mra -P unknown sequence 3 -H -PPP unknown sequence 3 -H 3 adapter LIGASE catalyzed known

More information

Overview of Solulink Products. June 2011

Overview of Solulink Products. June 2011 Overview of Solulink Products June 2011 1 Who we are Established in 2003, Solulink develops, patents, manufactures, and sells consumables to over 1,000 customers in life science, diagnostic, and pharmaceutical

More information

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits Catalog Numbers APPA001 In Vitro Bacterial Split GFP "Fold 'n' Glow" Solubility Assay Kit (Green) APPA008 In Vitro Bacterial

More information

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications Protein Purification Products Complete Solutions for All of Your Protein Purification Applications FLAG-Tagged Protein Products EXPRESS with the pcmv-dykddddk Vector Set Fuse your protein of interest to

More information

Cloning and Expression of a Haloacid Dehalogenase Enzyme. By: Skyler Van Senior Research Advisor: Dr. Anne Roberts

Cloning and Expression of a Haloacid Dehalogenase Enzyme. By: Skyler Van Senior Research Advisor: Dr. Anne Roberts Cloning and Expression of a Haloacid Dehalogenase Enzyme By: Skyler Van Senior Research Advisor: Dr. Anne Roberts utline The gene being cloned is JHP1130 from Helicobacter pylori (H. pylori) JHP1130 is

More information

Automated Protocol for High-throughput Recombinant Protein Purification Using the Biomek FX (Beckman Coulter)

Automated Protocol for High-throughput Recombinant Protein Purification Using the Biomek FX (Beckman Coulter) Automated Protocol for High-throughput Recombinant Protein Purification Using the Biomek FX (Beckman Coulter) HIS-Select HF Nickel Affinity Gel Catalog Number H0537 Automation Guide 2 I. Description 2

More information

Optimization of 2D Gel Transblotting for Host Cell Protein Analysis

Optimization of 2D Gel Transblotting for Host Cell Protein Analysis Optimization of 2D Gel Transblotting for Host Cell Protein Analysis Jon Johansen, Matt Hoelter & Nancy Kendrick* Kendrick Labs Inc, Madison, WI www.kendricklabs.com Talk Outline Biologic drugs, recombinant

More information

GGNB Method Course. PCR: self- made enzymes, helpful additives and insights into the reactions PRACTICAL PART

GGNB Method Course. PCR: self- made enzymes, helpful additives and insights into the reactions PRACTICAL PART GGNB Method Course PCR: self- made enzymes, helpful additives and insights into the reactions PRACTICAL PART 16.10.2012 Koray Kirli and Steffen Frey Cellular Logistics Prof. Dirk Görlich MPI for Biophysical

More information

Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA).

Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA). 175 Appendix III Chapter 4 Methods General. Unless otherwise noted, reagents were purchased from the commercial suppliers Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2016 Supporting Information An Ion Signal Responsive Dynamic Protein Nano-spring Constructed by High

More information

Figure 1. Schematic of Ats1p expression plasmid.

Figure 1. Schematic of Ats1p expression plasmid. Abstract: Anita Corbett page 2 The goal of my rotation project was to express, purify, and examine the exchange activity of a putative guanine nucleotide exchange factor, Ats1p. The S. cerevisiae ATS1

More information

96-well Checkpoint Kinase Activity Assay Kit

96-well Checkpoint Kinase Activity Assay Kit Product Manual 96-well Checkpoint Kinase Activity Assay Kit Catalog Number STA-414 STA-414-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cdc25C is a

More information

Immunoprecipitation Protocol

Immunoprecipitation Protocol Immunoprecipitation Protocol Immunoprecipitation is a general method to obtain the enrichment of a specific protein from tissue lysate and cell lysate. It can be used to purify a specific protein, to identify

More information

Optimizing Soluble Expression of Organophosphorus Acid Anhyrdolase (OPAA) Zingeber Udani BIOL 493

Optimizing Soluble Expression of Organophosphorus Acid Anhyrdolase (OPAA) Zingeber Udani BIOL 493 Optimizing Soluble Expression of Organophosphorus Acid Anhyrdolase (OPAA) Zingeber Udani BIOL 493 Fall 2007 1 Abstract Organophosphorus acid anhydrolase (OPAA) is a proteolytic enzyme expressed by many

More information

Presto Mini Plasmid Kit

Presto Mini Plasmid Kit Instruction Manual Ver. 03.06.17 For Research Use Only Presto Mini Plasmid Kit PDH004 (4 Preparation Sample Kit) PDH100 (100 Preparation Kit) PDH300 (300 Preparation Kit) Advantages Sample: 1-7 ml of cultured

More information

ARBRE-P4EU Consensus Protein Quality Guidelines for Biophysical and Biochemical Studies Minimal information to provide

ARBRE-P4EU Consensus Protein Quality Guidelines for Biophysical and Biochemical Studies Minimal information to provide ARBRE-P4EU Consensus Protein Quality Guidelines for Biophysical and Biochemical Studies Minimal information to provide Protein name and full primary structure, by providing a NCBI (or UniProt) accession

More information

Human TGF-beta1 ELISA

Human TGF-beta1 ELISA K-ASSAY Human TGF-beta1 ELISA For the quantitative determination of TGF-beta1 in human cell culture supernates, serum, plasma (EDTA) and urine Cat. No. KT-1471 For Research Use Only. Not for diagnostic

More information

BCH 462. Western Blot

BCH 462. Western Blot BCH 462 Western Blot Blotting Immunoassay: A test that uses antibody and antigen complexes [immuno-complexes] as a means of generating measurable results. Antigens [Ag]: A substance that when introduced

More information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2)

42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2) SUPPLEMENTAL DATA Supplementary Experimental Procedures Fluorescence Microscopy - A Zeiss Axiovert 200M microscope equipped with a Zeiss 100x Plan- Apochromat (1.40 NA) DIC objective and Hamamatsu Orca

More information

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) Quiz 1 Kinetics Review Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) I will post the problems with solutions on Toolkit for those that can t make

More information

Specific comments - Please add a citation at the end of the first paragraph of the introduction. Added as suggested.

Specific comments - Please add a citation at the end of the first paragraph of the introduction. Added as suggested. We thank the reviewers for the time and effort that they invested into the review of our manuscript, and for their helpful comments and suggestions. We were pleased by the positive evaluation of our study.

More information

Electrophoresis and transfer

Electrophoresis and transfer Electrophoresis and transfer Electrophoresis Cation = positively charged ion, it moves toward the cathode (-) Anion = negatively charged ion, it moves toward the anode (+) Amphoteric substance = can have

More information

A) B) Ladder. Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical

A) B) Ladder. Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical A) B) Ladder C) r4 r4 Nt- -Ct 78 kda Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical calpains is shown. The protease core consists of

More information

Purification of (recombinant) proteins. Pekka Lappalainen, Institute of Biotechnology, University of Helsinki

Purification of (recombinant) proteins. Pekka Lappalainen, Institute of Biotechnology, University of Helsinki Purification of (recombinant) proteins Pekka Lappalainen, Institute of Biotechnology, University of Helsinki Physical properties of proteins that can be applied for purification -size -charge (isoelectric

More information

ViraBind Lentivirus Concentration and Purification Kit

ViraBind Lentivirus Concentration and Purification Kit Product Manual ViraBind Lentivirus Concentration and Purification Kit Catalog Number VPK-090 2 preps FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lentivirus vectors based on

More information

OxiSelect Nitrosative DNA/RNA Damage ELISA Kit (8- Nitroguanine Quantitation)

OxiSelect Nitrosative DNA/RNA Damage ELISA Kit (8- Nitroguanine Quantitation) Product Manual OxiSelect Nitrosative DNA/RNA Damage ELISA Kit (8- Nitroguanine Quantitation) Catalog Number STA- 825 STA- 825-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures

More information

ab Mouse COX2 SimpleStep ELISA Kit

ab Mouse COX2 SimpleStep ELISA Kit ab210574 Mouse COX2 SimpleStep ELISA Kit Instructions for use: For the quantitative measurement of mouse COX2 in mouse cell extracts. This product is for research use only and is not intended for diagnostic

More information

PURIFICATION, SUBUNIT DETERMINATION,

PURIFICATION, SUBUNIT DETERMINATION, 7/25/2008 UCLA CHEM 153L BIOCHEMICAL METHODS I SUMMER 2008 PROFESSOR STEVEN J. KIM TA MAURICE SECTION 1C GROUP MOO0OO PURIFICATION, SUBUNIT DETERMINATION, AND KINETICS OF LACTATE DEHYDROGENASE REPORT BY

More information

BCH 462 Competent Cells Formation and Transformation of Competent Cells with plasmid DNA.

BCH 462 Competent Cells Formation and Transformation of Competent Cells with plasmid DNA. Lab#2 BCH 462 Competent Cells Formation and Transformation of Competent Cells with plasmid DNA. Outlines: 1-Insertion of foreign gene to the plasmid. 2-Competent cell. 3-Transformation of bacterial cell.

More information

OPPF-UK Standard Protocols: Mammalian Expression

OPPF-UK Standard Protocols: Mammalian Expression OPPF-UK Standard Protocols: Mammalian Expression Joanne Nettleship joanne@strubi.ox.ac.uk Table of Contents 1. Materials... 3 2. Cell Maintenance... 4 3. 24-Well Transient Expression Screen... 5 4. DNA

More information

Index 1. Product Description 2. Purification Procedure 3. Troubleshooting 4. Ordering Information

Index 1. Product Description 2. Purification Procedure 3. Troubleshooting 4. Ordering Information High Affinity Ni-Charged Resin Cat. No. L00223 Technical Manual No. TM0217 Version 07132010 Index 1. Product Description 2. Purification Procedure 3. Troubleshooting 4. Ordering Information 1. Product

More information

BIOC 463A Expt. 4: Column Chromatographic Methods Column Chromatography

BIOC 463A Expt. 4: Column Chromatographic Methods Column Chromatography Column Chromatography Chromatography is the process use to separate molecules based on SOME physical property of the molecule: Mass (i.e. size) Charge Affinity for ligands or substrates Hydrophobic interactions

More information

EnterokinaseMax (EKMax )

EnterokinaseMax (EKMax ) EnterokinaseMax (EKMax ) Catalog nos. E180-01, E180-02 Version H 16 June 2006 25-0110 User Manual ii Table of Contents Table of Contents... iii Important Information... iv Methods...1 Overview...1 EKMax

More information

ISOLATION AND PURIFICATION OF GLUTATHIONE S-TRANSFERASE FROM RAT LIVER

ISOLATION AND PURIFICATION OF GLUTATHIONE S-TRANSFERASE FROM RAT LIVER Journal of Al-Nahrain University Vol.12 (4), December, 29, pp.137-144 Science ISOLATION AND PURIFICATION OF GLUTATHIONE S-TRANSFERASE FROM RAT LIVER Essam F. A. Al-Jumaily, Zahraa F. Ameen and Ayad H.

More information

2015 Detroit R & D Product Catalog

2015 Detroit R & D Product Catalog 2727 Second Ave. Suite 4113 Detroit, MI 48201 Phone: (313) 961-1606; Fax: (313)963-7130 Email: info@detroitrandd.com Web: www.detroitrandd.com ELISA Kits 2015 Detroit R & D Product Catalog www.detroitrandd.com

More information

CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved.

CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved. CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? 35 INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment,

More information

Inhibition of the prostaglandin-degrading enzyme 15-PGDH potentiates tissue regeneration. JournalClub Emilie Hrdliczka

Inhibition of the prostaglandin-degrading enzyme 15-PGDH potentiates tissue regeneration. JournalClub Emilie Hrdliczka Inhibition of the prostaglandin-degrading enzyme 15-PGDH potentiates tissue regeneration JournalClub 14.12.2015 Emilie Hrdliczka Facts Author: Yongyou Zhang Department of Medicine, Case Western Reserve

More information

CHOgro Expression System

CHOgro Expression System SDS and Certificate of Analysis available at mirusbio.com/6260 INTRODUCTION The CHOgro Expression System is an optimized platform for transient, high titer protein production in suspension CHO derived

More information

Supplementary Material - Methods

Supplementary Material - Methods Novel Protein-Protein Interactions in the Schizophrenia interactome Supplementary Material - Methods Experimental validations of predicted interactions Table S1-1: Protein pairs that were validated by

More information

CytoGLOW. IKK-α/β. Colorimetric Cell-Based ELISA Kit. Catalog #: CB5358

CytoGLOW. IKK-α/β. Colorimetric Cell-Based ELISA Kit. Catalog #: CB5358 CytoGLOW IKK-α/β Colorimetric Cell-Based ELISA Kit Catalog #: CB5358 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only.

More information

Introduction to Assay Development

Introduction to Assay Development Introduction to Assay Development A poorly designed assay can derail a drug discovery program before it gets off the ground. While traditional bench-top assays are suitable for basic research and target

More information

Product Guide SPL Red Kit for 40 Western Blots

Product Guide SPL Red Kit for 40 Western Blots Additional materials required: Smart Protein Layers Product Guide SPL Red Kit for 40 Western Blots Product No.: PR911-M, PR911-R, PR911-G; PR912-M, PR912-R, PR912-G Recommended combination product for

More information

SUPPLEMENTARY MATERIALS AND METHODS

SUPPLEMENTARY MATERIALS AND METHODS SUPPLEMENTARY MATERIALS AND METHODS Chemicals. All chemicals used in supplementary experiments were the same as in the manuscript except the following. Methyl-methanesulfonate (MMS) was from Fluka. NU1025

More information

AmpliScribe T7-Flash Transcription Kit

AmpliScribe T7-Flash Transcription Kit AmpliScribe T7-Flash Transcription Kit Cat. Nos. ASF3257 and ASF3507 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA191E AmpliScribe T7-Flash Transcription Kit 12/2016 1 1. Introduction

More information

bfgf Supports Human ES Cell Self- Renewal

bfgf Supports Human ES Cell Self- Renewal APPLICATION NOTE Page 1 bfgf Supports Human ES Cell Self- Renewal Authors: Dongmei Wu, Wen Xiong, Yan Gao, Kristine Guerrero, Yi Chen, Liming Yang, Yang Liu, and Shuyuan Yao 1 Stemgent, Inc., 10575 Roselle

More information

The World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc.

The World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc. The World Leader in SPR Technology Jimmy Page, PhD, Biacore, Inc. Objectives of Biacore Experiments Yes/No Data» Is there binding?» Ligand Fishing Concentration Analysis: How MUCH? Active Concentration

More information

In Vitro Monitoring of the Formation of Pentamers from the Monomer of GST Fused HPV 16 L1

In Vitro Monitoring of the Formation of Pentamers from the Monomer of GST Fused HPV 16 L1 This journal is The Royal Society of Chemistry 213 In Vitro Monitoring of the Formation of Pentamers from the Monomer of GST Fused HPV 16 L1 Dong-Dong Zheng, a Dong Pan, a Xiao Zha, ac Yuqing Wu,* a Chunlai

More information

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual Fusion Cloning technology Cold Fusion Cloning Kit Store the master mixture and positive controls at -20 C Store the competent cells at -80 C. (ver. 120909) A limited-use label license covers this product.

More information

Product Manual. Human ApoE ELISA Kit. Catalog Number. FOR RESEARCH USE ONLY Not for use in diagnostic procedures

Product Manual. Human ApoE ELISA Kit. Catalog Number. FOR RESEARCH USE ONLY Not for use in diagnostic procedures Product Manual Human ApoE ELISA Kit Catalog Number STA-367 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lipoproteins are submicroscopic particles composed of lipid

More information

TransIT-TKO Transfection Reagent

TransIT-TKO Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2150 INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery

More information

PROTOCOL. Monoamine Oxidase B Enzyme Specific Activity Assay Kit (human) MS747 Rev.0 DESCRIPTION ADDITIONAL MATERIALS REQUIRED

PROTOCOL. Monoamine Oxidase B Enzyme Specific Activity Assay Kit (human) MS747 Rev.0 DESCRIPTION ADDITIONAL MATERIALS REQUIRED PROTOCOL Monoamine Oxidase B Enzyme Specific Activity Assay Kit (human) 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 MS747 Rev.0 DESCRIPTION MAOB Enzyme Specific Activity Assay Kit Sufficient materials

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

Grover L. Waldrop From the Division of Biochemistry and Molecular Biology, Louisiana State University, Baton Rouge, Louisiana 70803

Grover L. Waldrop From the Division of Biochemistry and Molecular Biology, Louisiana State University, Baton Rouge, Louisiana 70803 Q 2009 by The International Union of Biochemistry and Molecular Biology BIOCHEMISTRY AND MOLECULAR BIOLOGY EDUCATION Vol. 37, No. 1, pp. 11 15, 2009 Articles A Qualitative Approach to Enzyme Inhibition

More information

of Medicine, Zhejiang University, Hangzhou, Zhejiang , China Michigan, 4424B MS-1, 1301 Catherine Street, Ann Arbor, MI 48109, USA.

of Medicine, Zhejiang University, Hangzhou, Zhejiang , China Michigan, 4424B MS-1, 1301 Catherine Street, Ann Arbor, MI 48109, USA. Supplemental figure legends: Neddylation inhibitor MLN4924 suppresses growth and migration of human gastric cancer cells Huiyin Lan 1,2#, Zaiming Tang 1#, Hongchuan Jin 2, and Yi Sun 1,3,4* 1 Institute

More information

MICROBIOLOGICAL DETECTION OF E. COLI WITH UNPARALLELED SENSITIVITY. RUG A novel beta-glucuronidase substrate

MICROBIOLOGICAL DETECTION OF E. COLI WITH UNPARALLELED SENSITIVITY. RUG A novel beta-glucuronidase substrate MICROBIOLOGICAL DETECTION OF E. COLI WITH UNPARALLELED SENSITIVITY RUG A novel beta-glucuronidase substrate E. coli detection Escherichia coli (E. coli) is a Gram negative bacterium that inhabits the intestines

More information