Supplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17
|
|
- Loren Mason
- 6 years ago
- Views:
Transcription
1 Molecular Cell, Volume 65 Supplemental Information Pacer Mediates the Function of Class III PI3K and HOPS Complexes in Autophagosome Maturation by Engaging Stx17 Xiawei Cheng, Xiuling Ma, Xianming Ding, Lin Li, Xiao Jiang, Zhirong Shen, She Chen, Wei Liu, Weihua Gong, and Qiming Sun
2 Supplemental figures and legends Figure S1. Related to Figure 1.
3 Figure S1. Sequence alignment of Pacer from different species. Amino acids in high similarity were highlighted in blue and grey.
4 Figure S2. Related to Figure 1 and 2
5 Figure S2. Pacer subcellular localization analysis. (A) U2OS cells transfected with Pacer-GFP were fixed and stained with anti-eea1 (label early endosome) antibody. For colocalization analysis with DFCP1, U2OS cells were cotransfected with Pacer-GFP and mcherry-dfcp1. Scale bars, 10 µm. (B) Recombinant protein GST-Pacer (1-200aa) purified from E. Coli was used as the immunogen for making polyclonal antibody in Rabbit. Anti-Serum was affinity-purified using GST-Pacer (1-200aa)-conjugated agarose beads. (C) Detection of endogenous Pacer. 293T cells with Pacer knockdown (KD) or knockout (KO) were analyzed for Pacer levels using Western blot. (D) Detection of exogenous Pacer, Pacer-GFP (wt), Pacer-GFP (1-600aa) and Pacer-GFP (1-560) were expressed in 293T cells and analyzed by Western blot. (E) Detection of p62 level in Pacer WT, OE and KO 293T cells. 293T cells were treated with BafilomycinA (BafA1), and the whole cell lysates were prepared and analyzed for p62 level by Western blot. (F) Autophagosome maturation assay in Hela cells. mcherry-gfp-lc3 was expressed in Hela (vector) or Hela (Pacer OE) cells, and analyzed by confocal microscopy analysis. (G) The colocalization of LAMP1 and LC3 was analyzed in Pacer WT or KD U2OS cells by staining endogenous LAMP1 and LC3, and subsequently quantified. Data are shown as mean ± SD, **p < 0.01.
6 Figure S3. Related to Figure 3.
7 Figure S3. Pacer is a component of PI3KC3 complex through direct interaction with UVRAG. (A) Pacer interaction with UVRAG-PI3KC3 subcomponents. Flag-tagged Vps34, UVRAG, Beclin1, Beclin2, hnrbf2, Atg14 or Rubicon were co-expressed with HA-Pacer individually, and analyzed by anti-flag IP, followed by anti-ha Western blot. (B, C) Dissect the Pacer-interacting domain of Beclin1. HA-Pacer was coexpressed with Flag-tagged full-length Beclin1 or mutants. IP was performed using anti-flag antibody-conjugated beads. IP samples were analyzed by Western blot. (D, E) Dissect the Pacer-interaction domain of UVRAG. HA-Pacer was coexpressed with Flag-tagged full-length UVRAG or mutants in 293T cells. IP was performed using anti-flag antibody-conjugated beads. IP samples were analyzed by Western blot. (F) Structural prediction of aa of Pacer. (G) Analysis of recombinant proteins for GST-UVRAG-His6, Flag-Rubicon, Flag-Pacer or Flag-PacerΔ40 purified from insect cells by SDS-PAGE and Coomassie Blue staining. (H) In vitro GST pulldown assay. GST or GST-UVRAG-His6 was allowed to bind to beads first, incubated with Flag-Rubicon, Flag-Pacer or Flag-PacerΔ40, washed for three times, analyzed by anti-flag Western blot. (I, J) In vitro competition assay. GST-UVRAG-His6 was allowed to bind to beads first, which was followed by three washes and incubation with Flag-Rubicon, after another three washes, varying concentration of Flag-Pacer or Flag-PacerΔ40 were added into the reaction. After final three washes, proteins bound to the beads were analyzed by anti-flag Western blot. (K) Pacer destabilizes Rubicon. Rubicon levels were analyzed in 293T cells overexpressing Pacer-WT or Pacer-5A in the presence of Mg132 or Bafilomycin A1.
8 Figure S4. Related to Figure 4.
9 Figure S4. Pacer regulates PI3P biogenesis and targets UVRAG to autophagosomes. (A) Pacer knockdown decreases the activity of PI3KC3 in vivo. GFP-FYVE2 was expressed at a low level in Pacer KD, OE and WT U2OS cells. Control cells were treated with 5mM 3-MA. GFP-FYVE2 puncta number indicating relative in vivo level of PtdIns(3)P were quantified. Scale bars, 10 µm. Data are shown as mean ± SD from 90 micrographs of three independent experiments, **p < (B) Pacer and LC3 colocalization analysis in UVRAG knockdown cells. Pacer-GFP was transfected into UVRAG knockdown or control U2OS cells, and then analyzed for colocalization with LC3 by confocal microscopy. Scale bars, 10 µm. Data are shown as mean ± SD from 40 micrographs of three independent experiments. (C) Measure the effect of PATS on UVRAG localization. U2OS cells were transfected with plasmids expressing either WT UVRAG or a chimeric protein with PATS fusion to UVRAG, stained with anti-lc3 antibody, analyzed by confocal microscopy; colocalization with LC3 was quantified in (D). Scale bars, 10 µm. Data are shown as mean ± SD from 60 micrographs of three independent experiments, **p < (E) Pacer targets UVRAG to autophagosomes. GFP, Pacer-GFP or PATS-GFP was coexpressed with HA-UVRAG in U2OS cells, stained with anti-lc3 and HA antibodies. Colocalization with LC3 was quantified in (F), data are shown as mean ± SD from 60 micrographs of three independent experiments, ***p < 0.001; the effect on LC3 puncta formation by Pacer and UVRAG coexpression was quantified in (G), Scale bars, 10 µm. Data are shown as mean ± SD from 60 micrographs of three independent experiments, *p < 0.05.
10 Figure S5. Related to Figure 5.
11 Figure S5. Pacer recruits PI3KC3 complex to autophagosomes. (A) PacerΔ40 and Pacer-5A failed to recruit Beclin1, UVRAG and Vps34 to autophagosomes. U2OS cells coexpressed with PacerΔ40-GFP or Pacer-5A-GFP and Beclin1-HA, UVRAG-HA or Vps34-HA were fixed and stained with anti-ha and LC3 antibodies, analyzed by confocal microscopy, scale bars, 10 µm. (B) Analysis of colocalization of GFP-FYVE2 and LC cell lines were transfected with GFP-FYVE2 at a low level. Cells were then fixed, stained for LC3, analyzed by confocal microscopy, and quantified for the colocalization of LC3 and GFP-FYVE2. Scale bars, 10 µm. Data are shown as mean ± SD from 60 micrographs of three independent experiments, **p < (C) PI3P biogenesis rescue assay. GFP-FYVE2 was expressed at a low level in Pacer WT, Pacer KO, and the rescued U2OS cells. GFP-FYVE2 puncta number indicating relative in vivo level of PtdIns(3)P was quantified. (D) Detection of LC3-II level in Pacer WT and Pacer KO cells rescued by Pacer WT or PacerΔ( ). (E) PI3P biogenesis assay. GFP-FYVE2 was expressed at a low level in U2OS cells stably overexpressing Pacer WT, Pacer-5A or Pacer ( ). GFP-FYVE2 puncta number indicating relative in vivo level of PtdIns(3)P was quantified. Scale bars, 10 µm. Data are shown as mean ± SD from 60 micrographs of three independent experiments, **p < 0.01, *p < (F). (G) mcherry-gfp-lc3 was expressed in U2OS cells stably overexpressing Pacer-5A or Pacer WT, respectively. LC3 was monitored by fluorescence microscope. GFP-negative mcherry-positive (GFP-mCherry+) puncta, which indicates autolysosome, were quantified and summarized and quantified. Scale bars, 10 µm. Data are shown as mean ± SD from 35 micrographs of three independent experiments, *p < 0.05, **p < 0.01.
12 Figure S6. Related to Figure 5.
13 Figure S6. Pacer relocates HOPS complex to autophagosomes. (A) Analysis of Pacer interaction with HOPS complex. Flag-tagged Pacer WT or PacerΔ was coexpressed with Vps16-HA or Vps18-HA in 293T cells, and analyzed by anti-flag IP, followed by anti-ha Western blot. (B) Analysis of Pacer-5A interaction with HOPS complex. Flag-tagged Pacer-WT or Pacer-5A was coexpressed with Vps41-HA or Vps39-HA in 293T cells, and analyzed by anti-flag IP, followed by anti-ha Western blot. (C) Analysis of colocalization of HOPS with LC3 in Pacer WT or Pacer KD U2OS cells. U2OS cells were transfected with plasmid expressing each individual subunit of HOPS complex, cells were fixed and stained by anti-ha and anti-lc3 antibody, colocalization was quantified. Scale bars, 10 µm. (D) Analysis of Pacer-5A targeting HOPS to autophagosomes. Pacer WT-GFP or Pacer-5A-GFP was cotransfected with Vps39-HA or Vps41-HA, cells were fixed and stained by anti-lc3 and anti-ha antibodies, colocalization was analyzed and quantified in (E). Scale bars, 10 µm. (F) Analysis of Rab7-interaction with Pacer, Rubicon or PLEKHM1. GFP-tagged Rab7 was coexpressed with Pacer-Flag, Rubicon-Flag or PLEKHM1-Flag in 293T cells, and analyzed by anti-flag IP, followed by anti-gfp Western blot.
14 Figure S7. Related to Figure 6.
15 Figure S7. Pacer colocalizes and interacts with autophagosomal Stx17. (A, B) Analysis of Pacer colocalization with UVRAG or Atg14. U2OS cells were coexpressed with Pacer-GFP and mcherry-atg14, or Pacer-GFP and mcherry-uvrag, and analyzed by confocal microscopy. The colocalization was quantified in (C). Scale bars, 10 µm. Data are shown as mean ± SD from 150 micrographs of three independent experiments, *p<0.05. (D, E) Quantify relative intensity of each individual cololcalized puncta of Pacer-GFP and mcherry-uvrag or Pacer-GFP and mcherry-atg14 by a Phosphorimager and normalized by calculating as the percentage of the intensity of merged puncta. (F) Colocalization analysis of Stx17, Pacer (Δ ) and LC3. U2OS cells coexpressed with Stx17-HA, Pacer (Δ )-GFP were fixed and stained with anti-ha and LC3 antibodies, analyzed by confocal microscopy. Scale bars, 10 µm. (G) Analysis of the colocalization of Stx17 and Pacer with Vps34, Beclin 1 or Beclin 2. Stx17-Myc and Pacer-GFP were co-transfected with Vps34-HA, Beclin 1-HA or Beclin 2-HA in U2OS cells. Cells were then fixes and stained, followed by confocal microscopy analysis. Scale bars, 10 µm. (H) Analysis of Pacer s effect on SNARE complex formation. Flag-Stx17 and HA-VAMP8 or Flag-Stx17 and HA-SNAP29 cotransfected with Myc-Pacer or Vector alone, anti-flag IPs were performed, and analyzed by Western-blot. (I) Analysis of Pacer-5A interaction with Stx17. Flag-Pacer WT or Flag-Pacer-5A was expressed in 293T, and anti-flag IPs were performed and analyzed by Western-blot. (J) The working model. Pacer and Rubicon form a molecular switch to regulate autophagy by engaging Stx17, PI3KC3 and HOPS.
GFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
More informationSUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells
SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal
More informationColeman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
More informationPolyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous
Preparation and purification of polyclonal antibodies Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous injections of glutathione S-transferase-ARHGAP25-(509-619) (GST-coiled
More informationHossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
More informationFigure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
More informationJournal of Cell Science Supplementary Material
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice
More informationSupplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1.
Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Percent of original fluorescence was plotted as a function of time following photobleaching
More informationmcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Details
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationWestern-GUARANTEED Antibody Service FAQ
Western-GUARANTEED Antibody Service FAQ Content Q 1: When do I need a Western GUARANTEED Peptide Antibody Package?...2 Q 2: Can GenScript provide a Western blot guaranteed antibody?...2 Q 3: Does GenScript
More informationSupplemental Data Supplementary Figure Legends and Scheme Figure S1.
Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,
More informationSupplemental Data. Steiner et al. Plant Cell. (2012) /tpc
Supplemental Figure 1. SPY does not interact with free GST. Invitro pull-down assay using E. coli-expressed MBP-SPY and GST, GST-TCP14 and GST-TCP15. MBP-SPY was used as bait and incubated with equal amount
More informationSupporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
More informationSupplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
More informationmcherry Polyclonal Antibody Catalog Number PA Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Polyclonal Antibody Catalog Number PA5-34974 Product data sheet Details Size
More information* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm)
I: p-p9rsk I: p9rsk I: C I: p-p9rsk I: p9rsk 5 (ka) 5 5 (min) Ang II ( nm) p-p9rsk (Ser8) p9rsk p-p9rsk (Ser8) p9rsk (h) Mannitol 5 mm -Glucose 5 mm p9rsk (Ser8) (arbitrary units) p-p9rsk (Ser8) (arbitrary
More informationSupplemental Movie Legend.
Supplemental Movie Legend. Transfected T cells were dropped onto SEE superantigen-pulsed Raji B cells (approximate location indicated by circle). Maximum-intensity projections from Z-stacks (17 slices,
More information42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2)
SUPPLEMENTAL DATA Supplementary Experimental Procedures Fluorescence Microscopy - A Zeiss Axiovert 200M microscope equipped with a Zeiss 100x Plan- Apochromat (1.40 NA) DIC objective and Hamamatsu Orca
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
More informationSupplemental Information. Mitophagy Controls the Activities. of Tumor Suppressor p53. to Regulate Hepatic Cancer Stem Cells
Molecular Cell, Volume 68 Supplemental Information Mitophagy Controls the Activities of Tumor Suppressor to Regulate Hepatic Cancer Stem Cells Kai Liu, Jiyoung Lee, Ja Yeon Kim, Linya Wang, Yongjun Tian,
More informationPLEKHM1 Regulates Autophagosome-Lysosome Fusion through HOPS Complex and LC3/GABARAP Proteins
Molecular Cell Article PLEKHM1 Regulates Autophagosome-Lysosome Fusion through HOPS Complex and LC3/GABARAP Proteins David G. McEwan, 1 Doris Popovic, 1 Andrea Gubas, 1,11 Seigo Terawaki, 2,3,4 Hironori
More informationSupplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated
Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated reporter luciferase constructs, HEK293T cells were stimulated
More information3. Results. 3.1 Generation of HEK293 cell clones stably expressing ETA and ETB receptors
3. Results 3.1 Generation of HEK293 cell clones stably expressing ETA and ETB receptors To investigate the dimerisation of the endothelin receptor subtypes HEK293 cells were stably transfected with plasmids
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Kanaani et al., http://www.jcb.org/cgi/content/full/jcb.200912101/dc1 Figure S1. The K2 rabbit polyclonal antibody is specific for GAD67,
More information- NaCr. + NaCr. α H3K4me2 α H3K4me3 α H3K9me3 α H3K27me3 α H3K36me3 H3 H2A-2B H4 H3 H2A-2B H4 H3 H2A-2B H4. α Kcr. (rabbit) α Kac.
+ NaCr NaCr + NaCr NaCr Peptides 10ng 50ng 250ng K α Pan (mouse) Pan (mouse) 10ng 50ng 250ng α Pan (rabbit) C 10ng 50ng 250ng α Pan (mouse) 0 1.25 2.5 5 10 20 40 (mm) NaCr 24h α Pan (rabbit) α K4me2 α
More informationSupplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationSupplement Figure 1. Plin5 Plin2 Plin1. KDEL-DSRed. Plin-YFP. Merge
Supplement Figure 1 Plin5 Plin2 Plin1 KDEL-DSRed Plin-YFP Merge Supplement Figure 2 A. Plin5-Ab MitoTracker Merge AML12 B. Plin5-YFP Cytochrome c-cfp merge Supplement Figure 3 Ad.GFP Ad.Plin5 Supplement
More informationPHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF
YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract
More informationThe Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit
Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline
More informationSupplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat
Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat pups at P6, P14, P22, P30 and adult (A) rats were subjected
More informationSupplementary Information
Supplementary Information promotes cancer cell invasion and proliferation by receptor-mediated endocytosis-dependent and -independent mechanisms, respectively Kensaku Shojima, Akira Sato, Hideaki Hanaki,
More informationSupplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
More informationThermo Scientific GTPase Research Tools
Thermo Scientific Research Tools Active Pull-Down Assays We offer two different tools to study biology, one for active monitoring and one for global profiling. The Thermo Scientific Pierce Active Pull-Down
More informationThe microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and
SUPPLEMENTARY INFORMATION: The microtubule-associated tau protein has intrinsic acetyltransferase activity Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and Virginia M.Y. Lee Cohen
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationViral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover
Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and
More informationSupplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with
Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with concentration of 800nM) were incubated with 1mM dgtp for the indicated
More informationby Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL
Supplementary Materials and methods Neuronal cultures and transfection The hippocampus was dissected from E8 rat embryos, dissociated, and neurons plated onto glass coverslips coated with poly-ornithine
More informationFigure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationGTTCGGGTTCC TTTTGAGCAG
Supplementary Figures Splice variants of the SIP1 transcripts play a role in nodule organogenesis in Lotus japonicus. Wang C, Zhu H, Jin L, Chen T, Wang L, Kang H, Hong Z, Zhang Z. 5 UTR CDS 3 UTR TCTCAACCATCCTTTGTCTGCTTCCGCCGCATGGGTGAGGTCATTTTGTCTAGATGACGTGCAATTTACAATGA
More informationSUPPLEMENTARY INFORMATION FIGURE 1 - 1
SUPPLEMENTARY INFORMATION FIGURE 1-1 SUPPLEMENTARY INFORMATION FIGURE 2-2 SUPPLEMENTARY INFORMATION METHODS GST-Pull-Down. Cultures of E. Coli (BL21) were transformed with pgex (Clontech) and pgex recombinant
More informationParthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss
SUPPLEMENTARY INFORMATION Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss Yunjong Lee, Senthilkumar S. Karuppagounder, Joo-Ho Shin, Yun-Il Lee, Han Seok Ko, Debbie Swing,
More informationLecture 8: Affinity Chromatography-III
Lecture 8: Affinity Chromatography-III Key words: Chromatography; Affinity chromatography; Protein Purification During this lecture, we shall be studying few more examples of affinity chromatography. The
More informationBiochimie II. Assistants Ben Brankatschk Eleonora Torti
Biochimie II Purification de protéines exprimées dans des cellules humaines en culture Daniel Abegg Christophe Berthier Pauline Bonvin abegg6@etu.unige.ch berthie4@etu.unige.ch bonvinp0@etu.unige.ch Assistants
More informationToll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila
Cell Supplemental Information Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Bo Liu, Yonggang Zheng, Feng Yin, Jianzhong Yu, Neal Silverman, and Duojia Pan Supplemental Experimental
More informationSUPPLEMENTARY INFORMATION
doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8
More informationSupplemental Information for:
Supplemental Information for: Antibody-induced dimerization of FGFR1 promotes receptor endocytosis independently of its kinase activity Łukasz Opaliński*, Aleksandra Sokołowska-Wędzina, Martyna Szczepara,
More informationover time using live cell microscopy. The time post infection is indicated in the lower left corner.
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Movie 1 Description: Fusion of NBs. BSR cells were infected
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and
More informationProtein Purification Products. Complete Solutions for All of Your Protein Purification Applications
Protein Purification Products Complete Solutions for All of Your Protein Purification Applications FLAG-Tagged Protein Products EXPRESS with the pcmv-dykddddk Vector Set Fuse your protein of interest to
More informationSupplemental Information. Lysine-5 Acetylation Negatively Regulates. Lactate Dehydrogenase A and Is Decreased. in Pancreatic Cancer
Cancer Cell, Volume 23 Supplemental Information Lysine-5 Acetylation Negatively Regulates Lactate Dehydrogenase A and Is Decreased in Pancreatic Cancer Di Zhao, Shao-Wu Zou, Ying Liu, Xin Zhou, Yan Mo,
More informationSUMOstar Gene Fusion Technology
Gene Fusion Technology NEW METHODS FOR ENHANCING FUNCTIONAL PROTEIN EXPRESSION AND PURIFICATION IN INSECT CELLS White Paper June 2007 LifeSensors Inc. 271 Great Valley Parkway Malvern, PA 19355 www.lifesensors.com
More informationA) B) Ladder. Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical
A) B) Ladder C) r4 r4 Nt- -Ct 78 kda Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical calpains is shown. The protease core consists of
More informationA subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Journal of Plant Research A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana Linna Leng 1 Qianqian Liang
More informationFig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin
Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin (WGA-Alexa555) was injected into the extracellular perivitteline
More informationTechnical tips Session 5
Technical tips Session 5 Chromatine Immunoprecipitation (ChIP): This is a powerful in vivo method to quantitate interaction of proteins associated with specific regions of the genome. It involves the immunoprecipitation
More informationMolecular Cloning. Joseph Sambrook. David W. Russell A LABORATORY MANUAL COLD SPRING HARBOR LABORATORY PRESS VOLUME.
VOLUME Molecular Cloning A LABORATORY MANUAL THIRD EDITION www.molecularcloning.com Joseph Sambrook PETER MACCALLUM CANCER INSTITUTE AND THE UNIVERSITY OF MELBOURNE, AUSTRALIA David W. Russell UNIVERSITY
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1.
Supplementary Figure 1. Characterization and high expression of Lnc-β-Catm in liver CSCs. (a) Heatmap of differently expressed lncrnas in Liver CSCs (CD13 + CD133 + ) and non-cscs (CD13 - CD133 - ) according
More informationSupplementary Material. TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the. ERK1/2 signaling pathway
Supplementary Material TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the ERK1/2 signaling pathway Cui Zhang 1, Fan-Fan Hong 1, Cui-Cui Wang 1, Liang Li 1, Jian-Ling Chen
More informationpgbkt7 Anti- Myc AH109 strain (KDa) 50
pgbkt7 (KDa) 50 37 Anti- Myc AH109 strain Supplementary Figure 1. Protein expression of CRN and TDR in yeast. To analyse the protein expression of CRNKD and TDRKD, total proteins extracted from yeast culture
More informationGM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts
Current Biology, Volume 24 Supplemental Information GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Wei Zhou, Jin Chang, Xin Wang, Masha G. Savelieff, Yinyin Zhao, Shanshan
More informationPlasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System
Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,
More informationA Phosphatase Holoenzyme Comprised of Shoc2/Sur8 and the Catalytic Subunit of PP1 Functions as an M-Ras Effector to Modulate Raf Activity
Molecular Cell 22, 217 230, April 21, 2006 ª2006 Elsevier Inc. DOI 10.1016/j.molcel.2006.03.027 A Phosphatase Holoenzyme Comprised of Shoc2/Sur8 and the Catalytic Subunit of PP1 Functions as an M-Ras Effector
More information(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site.
SUPPLEMENTRY INFORMTION SUPPLEMENTL FIGURES Figure S1. () Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site. () Western blot of ligated and unligated sciatic
More informationRegulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132
Neuron, Volume 65 Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132 Dieter Edbauer, Joel R. Neilson, Kelly A. Foster, Chi-Fong Wang, Daniel P. Seeburg, Matthew
More informationSupplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
More informationLecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationSUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL Materials and Methods Primers for ChIP/qPCR (Fig. 3): CG7939 (RpL32) Rp49+10F Rp49+110R Rp49+241F Rp49+341R Rp49+549F Rp49+613R TCTGGTTTCCGGCAAGGTATGT GCAGTTCAACTCGAAACCGCCAAA ATACTGCCCAAGAAGCTAGCCCAA
More informationTranslation of HTT mrna with expanded CAG repeats is regulated by
Supplementary Information Translation of HTT mrna with expanded CAG repeats is regulated by the MID1-PP2A protein complex Sybille Krauß 1,*, Nadine Griesche 1, Ewa Jastrzebska 2,3, Changwei Chen 4, Désiree
More informationfrom Dr. David Livingston. Rabbit anti-myc, V5, and BACH1 were raised by immunizing rabbits with peptides EQKLISEEDI, GKPIPNPLLGLDST, and
upporting Material Experimental Procedures: Cell culture and antibodies All cell lines were maintained in RPMI 164 medium with 1% fetal calf serum at 37 C in 5% CO 2 (v/v). For HCC 1937-BRCA1 cells and
More informationRevision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines
Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines Further information can be found at: http://stke.sciencemag.org/sites/default/files/researcharticlerevmsinstructions_0.pdf.
More informationAims: -Purification of a specific protein. -Study of protein-protein interactions
Aims: -Purification of a specific protein -Study of protein-protein interactions This is a reliable method for purifying total IgG from crude protein mixtures such as serum. Protein A (linked to resin
More informationBeta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand
SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin
More informationSupplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR
Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC
More informationTo assess the localization of Citrine fusion proteins, we performed antibody staining to
Trinh et al 1 SUPPLEMENTAL MATERIAL FlipTraps recapitulate endogenous protein localization To assess the localization of Citrine fusion proteins, we performed antibody staining to compare the expression
More informationab G alpha i Activation Assay Kit
ab173234 G alpha i Activation Assay Kit Instructions for Use For the simple and fast measurement of G alpha i activation. This product is for research use only and is not intended for diagnostic use. Version
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationThe Conserved Isoleucine Valine Phenylalanine Motif Couples Activation State and Endocytic Functions of b-arrestins
Traffic 2007 Blackwell Munksgaard # 2007 The Authors doi: 10.1111/j.1600-0854.2007.00578.x The Conserved Isoleucine Valine Phenylalanine Motif Couples Activation State and Endocytic Functions of b-arrestins
More informationSupplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto
Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in
More informationSmall-Molecule Drug Target Identification/Deconvolution Technologies
Small-Molecule Drug Target Identification/Deconvolution Technologies Case-Studies Shantani Target ID Technology Tool Box Target Deconvolution is not Trivial = A single Tool / Technology May Not necessarily
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/323/5910/124/dc1 Supporting Online Material for Regulation of Neuronal Survival Factor MEF2D by Chaperone-Mediated Autophagy Qian Yang, Hua She, Marla Gearing, Emanuela
More informationA novel two-step genome editing strategy with CRISPR-Cas9 provides new insights into telomerase action and TERT gene expression
Xi et al. Genome Biology (2015) 16:231 DOI 10.1186/s13059-015-0791-1 RESEARCH A novel two-step genome editing strategy with CRISPR-Cas9 provides new insights into telomerase action and TERT gene expression
More informationEndoplasmic Reticulum Stress Induction of the Grp78/BiP Promoter: Activating Mechanisms Mediated by YY1 and Its Interactive Chromatin Modifiers
MOLECULAR AND CELLULAR BIOLOGY, June 2005, p. 4529 4540 Vol. 25, No. 11 0270-7306/05/$08.00 0 doi:10.1128/mcb.25.11.4529 4540.2005 Copyright 2005, American Society for Microbiology. All Rights Reserved.
More informationSupplemental Figure 1. Mutation in NLA Causes Increased Pi Uptake Activity and
Supplemental Figure 1. Mutation in NLA Causes Increased Pi Uptake Activity and PHT1 Protein Amounts. (A) Shoot morphology of 19-day-old nla mutants under Pi-sufficient conditions. (B) [ 33 P]Pi uptake
More informationFigure S6. Detection of anti-gfp antibodies in anti-dna and normal plasma without competition DNA--9
Supplementary Information Ultrasensitive antibody detection by agglutination-pcr (ADAP) Cheng-ting Tsai 1 *, Peter V. Robinson 1 *, Carole A. Spencer 2 and Carolyn R. Bertozzi 3,4ǂ Department of 1 Chemistry,
More informationAntibody Services from GenScript
Services from GenScript www.genscript.com GenScript USA Inc. 860 Centennial Ave., Piscataway, NJ 08854 USA Toll-Free: 1-877-436-7274 Fax: 1-732-210-0262 1-732-855-5878 Academic Services Pharmaceutical
More informationaffects the development of newborn neurons Brain Mind Institute and School of Life Sciences, Ecole Polytechnique Fédérale de
Shedding of neurexin 3β ectodomain by ADAM10 releases a soluble fragment that affects the development of newborn neurons Erika Borcel* a, Magda Palczynska* a, Marine Krzisch b, Mitko Dimitrov a, Giorgio
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/3/6/ra27/dc Supplementary Materials for AAA+ Proteins and Coordinate PIKK Activity and Function in Nonsense-Mediated mrna Decay Natsuko Izumi, Akio Yamashita,*
More informationHow to run Alpha assay: How to setup an Alpha assay Make your own assay!
How to run Alpha assay: How to setup an Alpha assay Make your own assay! 1 2009 PerkinElmer AlphaLISA kits - recommendations before starting the assay Samples: Phenol red and hemoglobin: choose AlphaLISA
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationof Medicine, Zhejiang University, Hangzhou, Zhejiang , China Michigan, 4424B MS-1, 1301 Catherine Street, Ann Arbor, MI 48109, USA.
Supplemental figure legends: Neddylation inhibitor MLN4924 suppresses growth and migration of human gastric cancer cells Huiyin Lan 1,2#, Zaiming Tang 1#, Hongchuan Jin 2, and Yi Sun 1,3,4* 1 Institute
More informationSmooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation
Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang
More informationSupplemental Data. Aung et al. (2011). Plant Cell /tpc
35S pro:pmd1-yfp 10 µm Supplemental Figure 1. -terminal YFP fusion of PMD1 (PMD1-YFP, in green) is localized to the cytosol. grobacterium cells harboring 35S pro :PMD1-YFP were infiltrated into tobacco
More information