HGVS Mutation Nomenclature Queries

Size: px
Start display at page:

Download "HGVS Mutation Nomenclature Queries"

Transcription

1 Molecular Genetics Participants Meeting 2014 HGVS Mutation Nomenclature Queries UK NATIONAL EXTERNAL QUALITY ASSESSMENT SERVICES

2 General Remark HGVS nomenclature aim: To provide unambiguous descriptions for professionals. Do no omit them! Suggestion: Explain their meaning to non-professionals p.? unknown effect on protein p.(tyr25*) Amino acid codon 25 predicted to change from Tyrosine to STOP

3 Q1 Please advise on most appropriate RNA &/or protein nomenclature for a nucleotide change at the last base of an exon which is predicted to abolish normal splicing (but no RNA evidence) Also is it acceptable to omit RNA & protein nomenclature in this instance (bearing in mind that p.? etc. may be confusing to those reading the clinical report). for example c.298g>c, which would lead to p.(ala100pro) if normally spliced but splice-site software indicates that normal splicing is very unlikely; can we just omit the protein nomenclature or should we use p.?; should we include r.spl? or r.(spl?) as well, or is this optional?

4 A1 UK NEQAS for Molecular Genetics RNA & protein descriptions should be provided, even if predicted Example: c.298g>c, r.(298g>c), p.(ala100pro) if normally spliced. Splice-site software: normal splicing is very unlikely: c.298g>c, r.(spl?), p.?

5 Q2 We have started to use genomic coordinates that reference the whole human chromosome when identifying variants, ie Chr6.hg19:g _ dupAGA. Can you provide guidance on appropriate nomenclature?

6 A2 chr6.hg19:g _ dup is correct. AGA is optional Alternatives: chr6:g _ dup (hg19) NC_ :g _ dup

7 Q3 I would like to discuss in general the nomenclature of whole gene deletions detected by MLPA testing

8 A3a Proposed MLPA deletion format: Similar to array-based deletions (last-position present_first-position-deleted)_ (last-position-deleted_first-position-present) c.(233+1_234-1)_(1234+1_1235-1)del

9 A3b Proposed MLPA duplication format: Similar to array-based tandem duplications (last-position normal_first-position-duplicated)_ (last-position-duplicated_first-position-normal) c.(233+1_234-1)_(1234+1_1235-1)dup

10 A3c MLPA insertion at unknown location Format? HGVS Insertion: c.?ins(233+1_234-1)_(1234+1_1235-1) ISCN: c.(233+1_234-1)_(1234+1_1235-1)x3

11 Q4 UK NEQAS for Molecular Genetics Are these the correct nomenclature for the following? Whole Gene Deletion: both breakpoints are unknown and outside the RB1 gene c.(?_-166)_(*1815_?)del NB start of known sequence of RB1 gene; Ref Seq NM_ *1815 RB1 gene poly A site

12 A4 Similar to MLPA Whole Gene Deletion: UK NEQAS for Molecular Genetics both breakpoints are unknown and outside the RB1 gene c.(?_-166)_(*1815_?)del Correct Preferred reference sequence: RefSeq Gene (NG_) or LRG

13 Q5 UK NEQAS for Molecular Genetics Are these the correct nomenclature for the following? Partial Deletion: a) 5 breakpoint is outside the RB1 gene, 3 breakpoint in intron 2 (ex2 is deleted but ex3 is not) c.(?_-166)_264+?del NB start of known sequence of RB1 gene; Ref Seq NM_ last base of RB1 exon 2 b) 5 breakpoint in intron 17 (ex17 is not deleted but ex18 is deleted) 3 breakpoint is outside the RB1 gene c.1696-?_(*1815+?) NB start of RB1 exon 18; *1815 RB1 gene poly A site

14 A5a Similar to MLPA Partial Deletion: a) 5 breakpoint is outside the RB1 gene, 3 breakpoint in intron 2 (ex2 is deleted but ex3 is not) c.(?_-166)_264+?del should be: c.(?_-166)_(264+1_265-1)del NB -166 start of known sequence of RB1 gene; Ref Seq NM_ last base of RB1 exon 2

15 A5b Similar to MLPA Partial Deletion: b) 5 breakpoint in intron 17 (ex17 is not deleted but ex18 is deleted) 3 breakpoint is outside the RB1 gene c.1696-?_(*1815+?) should be: c.(1695+1_1696-1)_(*1815+?) NB 1696 start of RB1 exon 18; *1815 RB1 gene poly A site

16 Q6 Numbering of variants in non-coding exons or 5' of the ATG site. How is this decided such as the GJB2 variant which is 3' of the non-coding exon 1. Deenoyelle et al calls this mutation -3170G>A or alternatively it is called: c.-23+1g>a

17 A6 Numbering of variants in 5 UTR intron: GJB2 variant c.-23+1g>a correct -3170G>A is wrong: c. missing c would refer to position in 5 UTR OR upstream intergenic position

18 Q&A7 Is there nomenclature to indicate acquired/somatic variants? / for mosaicism; // for chimerism c.[=/83g>c] or c.[=//83g>c]

19 Q&A8 We feel that the use of * as a stop codon does not immediately alert a clinician to the possible severity of a mutation, unless they are familiar with nomenclature Explain in text

20 Q9 * for termination codons - we still use X and don't want to use * as this is a wild-card term that would make these mutations unsearchable in databases. We also do not like "Ter" as we don't think this stands out enough compared to missense changes and could be misinterpreted as a missense change by a user not well versed in genetic terminology.

21 A9 Why * for termination codons: X: IUPAC code for unknown amino acid * wild-card: No problem when description between " " p.tyr25* 6 Pubmed hits p.tyr25* 0 Pubmed hits

22 Q10 Amino acid level brackets Which is correct: a) for a homozygous change - p.[(cys282tyr) (;) (Cys282Tyr)] or - p.[(cys282tyr);(cys282tyr)] b) for a heterozygous change - p.[(arg38trp) (;) (Ala44Ser)]

23 A10a Amino acid level allele descriptions Which is correct: a) for a homozygous change - p.[(cys282tyr)(;)(cys282tyr)] or - p.[(cys282tyr);(cys282tyr)] Neither! p.[(cys282tyr)];[(cys282tyr)]

24 A10a Amino acid level allele descriptions b) Heterozygous change, same allele - p.[(arg38trp);(ala44ser)];[=] Heterozygous change, phasing unknown - p.[(arg38trp)(;)(ala44ser)] Compound heterozygous change - p.[(arg38trp)];[(ala44ser)]

25 Q11 In the body of the text in a report we have been advised to use p.(cys282tyr) instead of (p.cys282tyr). We were using the second way in the grammatical sense rather than as HGVS nomenclature.

26 A11 p.(cys282tyr) correct when no RNA analyzed p.cys282tyr correct when RNA analyzed r.845g>a (p.cys282tyr) Only used in combination

27 Q12 In commonly described variants where the protein level change is known from the cdna change is it still necessary to use the () brackets e.g. p.(phe508del) rather than p.phe508del?

28 A12 In general: RNA analyzed, protein change known: p.phe508del Note: Unknown genetic background effects may affect your conclusion!

29 Q13 UK NEQAS for Molecular Genetics p.(glu123ala) we don't use the brackets as these seem unnecessary. HGVS states the brackets can only be omitted if protein/rna analysis have been done but protein and RNA analysis are not widely used for missense and synonymous changes unless there is a reasonable suspicion of a splicing defect. We don't feel that omitting the brackets is misleading to users.

30 A13 p.(glu123ala) indicates a prediction Your evidence only supports DNA level descriptions Missense, synonymous and nonsense changes affect splicing more often than you think. Misclassification can harm patients

31 Finally We would like reassurance that usage of X/Ter or alternative placing of brackets will not cause marks to be lost in NEQAS schemes as both are routinely understood and we will be making any deviations from HGVS clear in our supporting information with reports. For UK NEQAS to decide

Describing variants. recommendations for the description of DNA changes. Johan den Dunnen. HGVS.org. chair SVD-WG

Describing variants. recommendations for the description of DNA changes. Johan den Dunnen. HGVS.org. chair SVD-WG Describing variants "mutation nomenclature" recommendations for the description of DNA changes Johan den Dunnen chair SVD-WG http://www.hgvs.org/varnomen/ VarNomen @ HGVS.org HGVS / HVP / HUGO Sequence

More information

Mutation entries in SMA databases Guidelines for national curators

Mutation entries in SMA databases Guidelines for national curators 1 Mutation entries in SMA databases Guidelines for national curators GENERAL CONSIDERATIONS Role of the curator(s) of a national database Molecular data can be collected by many different ways. There are

More information

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014 Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide

More information

Understanding Genes & Mutations. John A Phillips III May 16, 2005

Understanding Genes & Mutations. John A Phillips III May 16, 2005 Understanding Genes & Mutations John A Phillips III May 16, 2005 Learning Objectives Understand gene structure Become familiar with genetic & mutation databases Be able to find information on genetic variation

More information

Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017

Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017 Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017 Topics to cover today What is Next Generation Sequencing (NGS)? Why do we need NGS? Common approaches to NGS NGS

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

Chapter 14: Genes in Action

Chapter 14: Genes in Action Chapter 14: Genes in Action Section 1: Mutation and Genetic Change Mutation: Nondisjuction: a failure of homologous chromosomes to separate during meiosis I or the failure of sister chromatids to separate

More information

Genome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)

Genome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA

More information

Enzyme that uses RNA as a template to synthesize a complementary DNA

Enzyme that uses RNA as a template to synthesize a complementary DNA Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have

More information

BS 50 Genetics and Genomics Week of Oct 24

BS 50 Genetics and Genomics Week of Oct 24 BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.

More information

Additional Practice Problems for Reading Period

Additional Practice Problems for Reading Period BS 50 Genetics and Genomics Reading Period Additional Practice Problems for Reading Period Question 1. In patients with a particular type of leukemia, their leukemic B lymphocytes display a translocation

More information

Hands-On Four Investigating Inherited Diseases

Hands-On Four Investigating Inherited Diseases Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise

More information

GENETICS and the DNA code NOTES

GENETICS and the DNA code NOTES GENETICS and the DNA code NOTES BACKGROUND DNA is the hereditary material of most organisms. It is an organic compound made of two strands, twisted around one another to form a double helix. Each strand

More information

Assignment 9: Genetic Variation

Assignment 9: Genetic Variation Assignment 9: Genetic Variation Due Date: Friday, March 30 th, 2018, 10 am In this assignment, you will profile genome variation information and attempt to answer biologically relevant questions. The variant

More information

Question 2: There are 5 retroelements (2 LINEs and 3 LTRs), 6 unclassified elements (XDMR and XDMR_DM), and 7 satellite sequences.

Question 2: There are 5 retroelements (2 LINEs and 3 LTRs), 6 unclassified elements (XDMR and XDMR_DM), and 7 satellite sequences. Bio4342 Exercise 1 Answers: Detecting and Interpreting Genetic Homology (Answers prepared by Wilson Leung) Question 1: Low complexity DNA can be described as sequences that consist primarily of one or

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

MRC-Holland MLPA. Description version 12; 27 November 2015

MRC-Holland MLPA. Description version 12; 27 November 2015 SALSA MLPA probemix P079-A3 OTC Lot A3-1015. As compared to previous version (lot A2-0211), 5 reference probes have been replaced. Also, 8 reference probes and the TSPAN7 flanking probe have been removed.

More information

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6. Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)

More information

UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding

UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene

More information

USER MANUAL for the use of the human Genome Clinical Annotation Tool (h-gcat) uthors: Klaas J. Wierenga, MD & Zhijie Jiang, P PhD

USER MANUAL for the use of the human Genome Clinical Annotation Tool (h-gcat) uthors: Klaas J. Wierenga, MD & Zhijie Jiang, P PhD USER MANUAL for the use of the human Genome Clinical Annotation Tool (h-gcat)) Authors: Klaas J. Wierenga, MD & Zhijie Jiang, PhD First edition, May 2013 0 Introduction The Human Genome Clinical Annotation

More information

Lecture 2: Biology Basics Continued

Lecture 2: Biology Basics Continued Lecture 2: Biology Basics Continued Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine, Guanine, Thymine, and Cytosine which pair A-T and

More information

Genes and Proteins in Health. and Disease

Genes and Proteins in Health. and Disease Genes and Health and I can describe the structure of proteins All proteins contain the chemical elements Carbon, Hydrogen, Oxygen and Nitrogen. Some also contain sulphur. Proteins are built from subunits

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

Aaditya Khatri. Abstract

Aaditya Khatri. Abstract Abstract In this project, Chimp-chunk 2-7 was annotated. Chimp-chunk 2-7 is an 80 kb region on chromosome 5 of the chimpanzee genome. Analysis with the Mapviewer function using the NCBI non-redundant database

More information

Gene mutation and DNA polymorphism

Gene mutation and DNA polymorphism Gene mutation and DNA polymorphism Outline of this chapter Gene Mutation DNA Polymorphism Gene Mutation Definition Major Types Definition A gene mutation is a change in the nucleotide sequence that composes

More information

American Board of Medical Genetics and Genomics

American Board of Medical Genetics and Genomics American Board of Medical Genetics and Genomics Logbook Guidelines for Certification in Laboratory Genetics and Genomics for the 2019 Examination as of 11/10/2016 Purpose: The purpose of the logbook is

More information

Explain why the scientists used the same restriction endonuclease enzymes on each DNA sample

Explain why the scientists used the same restriction endonuclease enzymes on each DNA sample Q1.Some populations of flies are becoming resistant to insecticides intended to kill them. Scientists developed a method for finding out whether a fly was carrying a recessive allele, r, that gives resistance

More information

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene

More information

Release Notes for Genomes Processed Using Complete Genomics Software

Release Notes for Genomes Processed Using Complete Genomics Software Release Notes for Genomes Processed Using Complete Genomics Software Version 1.11.0 Related Documents... 1 Changes to Version 1.11.0... 2 Changes to Version 1.10.0... 6 Changes to Version 1.9.0... 10 Changes

More information

MRC-Holland MLPA. Description version 05; 31 August 2017

MRC-Holland MLPA. Description version 05; 31 August 2017 mix P318-A2 Hirschsprung-2 Lot A2-0614. Compared to version A1 (lot A1-1009), the control fragments have been changed (QDX2) and some lengths have been adjusted. Hirschsprung disease is the main cause

More information

Introduction to the UCSC genome browser

Introduction to the UCSC genome browser Introduction to the UCSC genome browser Dominik Beck NHMRC Peter Doherty and CINSW ECR Fellow, Senior Lecturer Lowy Cancer Research Centre, UNSW and Centre for Health Technology, UTS SYDNEY NSW AUSTRALIA

More information

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct

More information

Intragenic suppressors: true revertants

Intragenic suppressors: true revertants Suppressor Genetics: intragenic and informational suppressors We have covered one approach used in genetics to study gene function: classical forward genetics where an investigator selects or screens for

More information

Gene Identification in silico

Gene Identification in silico Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction

More information

Chapter 8: DNA and RNA

Chapter 8: DNA and RNA Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

Bundle 5 Test Review

Bundle 5 Test Review Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

More information

TIGR THE INSTITUTE FOR GENOMIC RESEARCH

TIGR THE INSTITUTE FOR GENOMIC RESEARCH Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,

More information

VARIANT TERMINOLOGY AND EXON NUMBERING

VARIANT TERMINOLOGY AND EXON NUMBERING HVP/GL/003-01/EN 2016-01-28 G/DSDBAC HVP GUIDELINE VARIANT TERMINOLOGY AND EXON NUMBERING Authors Raymond Dalgleish, Mauno Vihinen Editor Timothy D. Smith Published by: Human Variome Project International

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

Helps DNA put genetic code into action RNA Structure

Helps DNA put genetic code into action RNA Structure 13.1 RNA Helps DNA put genetic code into action RNA Structure Single Stranded Nucleotides building blocks to RNA Ribose (5C sugar) Phosphate Group Nitrogenous base: Adenine, Uracil Guanine, Cytosine Disposable

More information

Keystone Biology Remediation B2: Genetics

Keystone Biology Remediation B2: Genetics Keystone Biology Remediation B2: Genetics Assessment Anchors: to describe and/or predict observed patterns of inheritance (i.e. dominant, recessive, codominance, incomplete dominance, sex-linked, polygenic,

More information

Gene Regulation & Mutation 8.6,8.7

Gene Regulation & Mutation 8.6,8.7 Gene Regulation & Mutation 8.6,8.7 Eukaryotic Gene Regulation Transcription factors: ensure proteins are made at right time and in right amounts. One type forms complexes that guide & stabilize binding

More information

BIOL 300 Foundations of Biology Summer 2017 Telleen Lecture Outline

BIOL 300 Foundations of Biology Summer 2017 Telleen Lecture Outline BIOL 300 Foundations of Biology Summer 2017 Telleen Lecture Outline RNA, the Genetic Code, Proteins I. How RNA differs from DNA A. The sugar ribose replaces deoxyribose. The presence of the oxygen on the

More information

Training materials.

Training materials. Training materials Ensembl training materials are protected by a CC BY license http://creativecommons.org/licenses/by/4.0/ If you wish to re-use these materials, please credit Ensembl for their creation

More information

7.2 Protein Synthesis. From DNA to Protein Animation

7.2 Protein Synthesis. From DNA to Protein Animation 7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They

More information

Ensembl Tools. EBI is an Outstation of the European Molecular Biology Laboratory.

Ensembl Tools. EBI is an Outstation of the European Molecular Biology Laboratory. Ensembl Tools EBI is an Outstation of the European Molecular Biology Laboratory. Questions? We ve muted all the mics Ask questions in the Chat box in the webinar interface I will check the Chat box periodically

More information

BIOL 225 Genetics-Final Exam November 17, 2006 Dr. Sandra Davis

BIOL 225 Genetics-Final Exam November 17, 2006 Dr. Sandra Davis BIOL 225 Genetics-Final Exam November 17, 2006 Dr. Sandra Davis INSTRUCTIONS: 1. Read the questions carefully and write your answers in the space provided. If you need more space, clearly indicate WHERE

More information

Problem Set 8. Answer Key

Problem Set 8. Answer Key MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no

More information

Bioinformatics small variants Data Analysis. Guidelines. genomescan.nl

Bioinformatics small variants Data Analysis. Guidelines. genomescan.nl Next Generation Sequencing Bioinformatics small variants Data Analysis Guidelines genomescan.nl GenomeScan s Guidelines for Small Variant Analysis on NGS Data Using our own proprietary data analysis pipelines

More information

Eukaryotic Gene Structure

Eukaryotic Gene Structure Eukaryotic Gene Structure Terminology Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Gene Basic physical and

More information

Today s lecture: Types of mutations and their impact on protein function

Today s lecture: Types of mutations and their impact on protein function Today s lecture: Types of mutations and their impact on protein function Mutations can be classified by their effect on the DNA sequence OR the encoded protein 1 From my Lecture 4 (10/1): Classification

More information

MATH 5610, Computational Biology

MATH 5610, Computational Biology MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class

More information

Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013

Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance

More information

Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein?

Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Messenger RNA Carries Information for Protein Synthesis from the DNA to Ribosomes Ribosomes Consist

More information

CH 17 :From Gene to Protein

CH 17 :From Gene to Protein CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there

More information

Identification of Single Nucleotide Polymorphisms and associated Disease Genes using NCBI resources

Identification of Single Nucleotide Polymorphisms and associated Disease Genes using NCBI resources Identification of Single Nucleotide Polymorphisms and associated Disease Genes using NCBI resources Navreet Kaur M.Tech Student Department of Computer Engineering. University College of Engineering, Punjabi

More information

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons, From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes

More information

FINDING THE PAIN GENE How do geneticists connect a specific gene with a specific phenotype?

FINDING THE PAIN GENE How do geneticists connect a specific gene with a specific phenotype? FINDING THE PAIN GENE How do geneticists connect a specific gene with a specific phenotype? 1 Linkage & Recombination HUH? What? Why? Who cares? How? Multiple choice question. Each colored line represents

More information

Chapter 14 Active Reading Guide From Gene to Protein

Chapter 14 Active Reading Guide From Gene to Protein Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single

More information

Protein Synthesis

Protein Synthesis HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is

More information

Unit 1: DNA and the Genome Sub-topic 6: Mutation

Unit 1: DNA and the Genome Sub-topic 6: Mutation Unit 1: DNA and the Genome Sub-topic 6: Mutation Page 1 of 24 On completion of this topic I will be able to state that: mutations are random changes in the genome, causing no protein or an altered protein

More information

SENIOR BIOLOGY. Blueprint of life and Genetics: the Code Broken? INTRODUCTORY NOTES NAME SCHOOL / ORGANISATION DATE. Bay 12, 1417.

SENIOR BIOLOGY. Blueprint of life and Genetics: the Code Broken? INTRODUCTORY NOTES NAME SCHOOL / ORGANISATION DATE. Bay 12, 1417. SENIOR BIOLOGY Blueprint of life and Genetics: the Code Broken? NAME SCHOOL / ORGANISATION DATE Bay 12, 1417 Bay number Specimen number INTRODUCTORY NOTES Blueprint of Life In this part of the workshop

More information

Gene-centered resources at NCBI

Gene-centered resources at NCBI COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving

More information

Measurement of Molecular Genetic Variation. Forces Creating Genetic Variation. Mutation: Nucleotide Substitutions

Measurement of Molecular Genetic Variation. Forces Creating Genetic Variation. Mutation: Nucleotide Substitutions Measurement of Molecular Genetic Variation Genetic Variation Is The Necessary Prerequisite For All Evolution And For Studying All The Major Problem Areas In Molecular Evolution. How We Score And Measure

More information

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino

More information

Browsing Genes and Genomes with Ensembl

Browsing Genes and Genomes with Ensembl Browsing Genes and Genomes with Ensembl Victoria Newman Ensembl Outreach Officer EMBL-EBI Objectives What is Ensembl? What type of data can you get in Ensembl? How to navigate the Ensembl browser website.

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

SNP calling and VCF format

SNP calling and VCF format SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide

More information

Identification of the Photoreceptor Transcriptional Co-Repressor SAMD11 as Novel Cause of. Autosomal Recessive Retinitis Pigmentosa

Identification of the Photoreceptor Transcriptional Co-Repressor SAMD11 as Novel Cause of. Autosomal Recessive Retinitis Pigmentosa Identification of the Photoreceptor Transcriptional Co-Repressor SAMD11 as Novel Cause of Autosomal Recessive Retinitis Pigmentosa Corton M 1,2 *, Avila-Fernández A 1,2, Campello L 3, Sánchez M 1,2, Benavides

More information

The Genetic Code: Translation. Pre-class reading Chapter 17: Pages

The Genetic Code: Translation. Pre-class reading Chapter 17: Pages The Genetic Code: Translation Pre-class reading Chapter 17: Pages 336-348 Nomenclature needed: Translation RN (m, t, r) Signal peptide sequence Mutations Ribosomes + Polyribosomes Codon (triplet code)

More information

Genomics and Gene Recognition Genes and Blue Genes

Genomics and Gene Recognition Genes and Blue Genes Genomics and Gene Recognition Genes and Blue Genes November 3, 2004 Eukaryotic Gene Structure eukaryotic genomes are considerably more complex than those of prokaryotes eukaryotic cells have organelles

More information

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

More information

Exploring genomic databases: Practical session "

Exploring genomic databases: Practical session Exploring genomic databases: Practical session Work through the following practical exercises on your own. The objective of these exercises is to become familiar with the information available in each

More information

132 Grundlagen der Bioinformatik, SoSe 14, D. Huson, June 22, This exposition is based on the following source, which is recommended reading:

132 Grundlagen der Bioinformatik, SoSe 14, D. Huson, June 22, This exposition is based on the following source, which is recommended reading: 132 Grundlagen der Bioinformatik, SoSe 14, D. Huson, June 22, 214 1 Gene Prediction Using HMMs This exposition is based on the following source, which is recommended reading: 1. Chris Burge and Samuel

More information

AMERICAN BOARD OF MEDICAL GENETICS

AMERICAN BOARD OF MEDICAL GENETICS AMERICAN BOARD OF MEDICAL GENETICS Logbook Guidelines for Certification in Clinical Molecular Genetics for the 2015 Examination Purpose: The purpose of the logbook is to document that the applicant has

More information

Grundlagen der Bioinformatik, SoSe 11, D. Huson, July 4, This exposition is based on the following source, which is recommended reading:

Grundlagen der Bioinformatik, SoSe 11, D. Huson, July 4, This exposition is based on the following source, which is recommended reading: Grundlagen der Bioinformatik, SoSe 11, D. Huson, July 4, 211 155 12 Gene Prediction Using HMMs This exposition is based on the following source, which is recommended reading: 1. Chris Burge and Samuel

More information

Chapter 14: Gene Expression: From Gene to Protein

Chapter 14: Gene Expression: From Gene to Protein Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect

More information

2. From the first paragraph in this section, find three ways in which RNA differs from DNA.

2. From the first paragraph in this section, find three ways in which RNA differs from DNA. Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine

More information

SNPs - GWAS - eqtls. Sebastian Schmeier

SNPs - GWAS - eqtls. Sebastian Schmeier SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association

More information

From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp

More information

(a) Which enzyme(s) make 5' - 3' phosphodiester bonds? (c) Which enzyme(s) make single-strand breaks in DNA backbones?

(a) Which enzyme(s) make 5' - 3' phosphodiester bonds? (c) Which enzyme(s) make single-strand breaks in DNA backbones? EXAMPLE QUESTIONS AND ANSWERS 1. Topoisomerase does which one of the following? (a) Makes new DNA strands. (b) Unties knots in DNA molecules. (c) Joins the ends of double-stranded DNA molecules. (d) Is

More information

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more

More information

12 Interaction of Genes

12 Interaction of Genes 12 Interaction of Genes Yeast genetics has been particularly amenable for identifying and characterizing gene products that directly or indirectly interact with each other, especially when two mutations

More information

Terminology: chromosome; gene; allele; proteins; enzymes

Terminology: chromosome; gene; allele; proteins; enzymes Title Workshop on genetic disease and gene therapy Authors Danielle Higham (BSc Genetics), Dr. Maggy Fostier Contact Maggy.fostier@manchester.ac.uk Target level KS4 science, GCSE (or A-level) Publication

More information

Unit 1 Human cells. 1. Division and differentiation in human cells

Unit 1 Human cells. 1. Division and differentiation in human cells Unit 1 Human cells 1. Division and differentiation in human cells Stem cells Describe the process of differentiation. Explain how differentiation is brought about with reference to genes. Name the two

More information

NUCLEOTIDE RESOLUTION STRUCTURAL VARIATION DETECTION USING NEXT- GENERATION WHOLE GENOME RESEQUENCING

NUCLEOTIDE RESOLUTION STRUCTURAL VARIATION DETECTION USING NEXT- GENERATION WHOLE GENOME RESEQUENCING NUCLEOTIDE RESOLUTION STRUCTURAL VARIATION DETECTION USING NEXT- GENERATION WHOLE GENOME RESEQUENCING Ken Chen, Ph.D. kchen@genome.wustl.edu The Genome Center, Washington University in St. Louis The path

More information

Basic concepts and terminology

Basic concepts and terminology Basic concepts and terminology Mutation is the ultimate source of organismal variation. Every newborn human carries several dozen unique mutations in his/her genome. It is thus often brought forward that

More information

Variant calling in NGS experiments

Variant calling in NGS experiments Variant calling in NGS experiments Jorge Jiménez jjimeneza@cipf.es BIER CIBERER Genomics Department Centro de Investigacion Principe Felipe (CIPF) (Valencia, Spain) 1 Index 1. NGS workflow 2. Variant calling

More information

Genome Annotation. What Does Annotation Describe??? Genome duplications Genes Mobile genetic elements Small repeats Genetic diversity

Genome Annotation. What Does Annotation Describe??? Genome duplications Genes Mobile genetic elements Small repeats Genetic diversity Genome Annotation Genome Sequencing Costliest aspect of sequencing the genome o But Devoid of content Genome must be annotated o Annotation definition Analyzing the raw sequence of a genome and describing

More information

DNA RNA Protein. THE DISCOVERY AND STRUCTURE OF DNA (SB2a) What is DNA? SCIENTISTS WHEN? IMPORTANT DISCOVERY

DNA RNA Protein. THE DISCOVERY AND STRUCTURE OF DNA (SB2a) What is DNA? SCIENTISTS WHEN? IMPORTANT DISCOVERY DNA RNA Protein Notes THE DISCOVERY AND STRUCTURE OF DNA (SB2a) SCIENTISTS WHEN? IMPORTANT DISCOVERY Frederick Mieshcer Discovered in the white blood cells Phoebus Levene Oswald Avery Erwin Chargaff Alfred

More information

EMSA Mutant SOX10 proteins interfere with the DNA binding of wild type SOX10

EMSA Mutant SOX10 proteins interfere with the DNA binding of wild type SOX10 18-05-2010 SOX10 IL FENOTIPO MENO GRAVE È DOVUTO A DOWNREGULATION DA NMD Intron Minigene approach: * * Mutazione introdotta come controllo Northern blotting * mrna levels Inoue et al., Nature Genetics

More information

Protein Synthesis Notes

Protein Synthesis Notes Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription

More information

ENZYMES AND METABOLIC PATHWAYS

ENZYMES AND METABOLIC PATHWAYS ENZYMES AND METABOLIC PATHWAYS This document is licensed under the Attribution-NonCommercial-ShareAlike 2.5 Italy license, available at http://creativecommons.org/licenses/by-nc-sa/2.5/it/ 1. Enzymes build

More information

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)

Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total) Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master

More information