Supplementary Figure S1

Size: px
Start display at page:

Download "Supplementary Figure S1"

Transcription

1 Supplementary Figure S1 A (i) pscn-ndtpa (ii) () SM(PEO) 6 Mal-PEO6- -ndtpa Anti-γH2AX (i) (ii) EDC, sulfo-nhs NH 2 -SH -SH EGF EGF-PEO 6 - -ndtpa Anti-γH2AX-PNE (i) (ii) pscn-ndtpa SANH Anti-γH2AX -ndtpa Ser-SH NaIO 4 O=SH SH- -ndtpa SMPT EGF -SS- -ndtpa Supplementary Figure S1. Schematic overview of the synthesis of (A) non-cleavable anti-γh2ax-pne and () cleavable anti-γh2ax-n-ss-e.

2 Supplementary Figure S2 A nd (%) 123 I-EGF bou 1 5 EGF Anti-γH2AX-PNE P = Log concentration competitor (nm) bound (%) 123 I-anti-γH2AX 1 Anti-γH2AX Anti-γH2AX-PNE 5 p = Log concentration competitor (nm) C kda Supplementary Figure S2. (A) MDA-M-468 cultures were exposed to 123 I-EGF for 2 h plus increasing concentrations of EGF, anti-γh2ax-pne or anti-γh2ax-n-ss-e. () Extracts from irradiated, γh2ax-containing 231-H2N cells were coated onto a RIA plate and exposed to 123 I-anti-γH2AX for 2 h plus increasing amounts of anti-γh2ax, antiγh2ax-pne or anti-γh2ax-n-ss-e. For both (A) and () the relative amount of 123 I that bound to plates was determined and LogIC 5 values were calculated. Results are shown as the mean of three replicates ± SD (C) PAGE analysis of 1. unmodified antiγh2ax, 2. anti-γh2ax-pne and 3. anti-γh2ax-n-ss-e.

3 Supplementary Figure S3 A 3 Control + Glutathione 4 CPM (normalised ) 2 1 CPM (normalised d) I-EGF Cleaved product Fraction fraction C CPM (normalis sed) IEGF I-EGF +cleaved low MW product Supplementary Figure S3. (A) Anti-γH2AX-N-SS-( 123 I-EGF) was exposed to or 1 mm glutathione. Size exclusion chromatography was performed using a G5 sephadex minicolumn. The amount of 123 I in each fraction was measured. () 123 I-EGF was synthesized as described d in the methods section. G25 size exclusion chromatography h was then performed on 123 I-EGF and the cleaved product resulting from (A). (C) To demonstrate that EGF is released from rigg-n-ss-e, rigg-n-ss-e was exposed to glutathione and purified by G5 size exclusion chromatography. Then, EGFR positive MDA-M-468 cells were exposed to 123 I-EGF for 2 h at 4 C with or without addition of the low molecular weight peak product. locking of 123 I-EGF binding to MDA-M-468 cells show that at least some of the low MW fraction binds to EGFR.

4 Supplementary Figure S4 A 231-H2N 4h post IR DAPI AF555- anti-γh2ax-pne Merge 4 Gy 4h post IR 4 Gy DAPI AF555- anti-γh2ax-n-ss-e Merge Supplementary Figure S4: (A) 231-H2N cells were exposed for 4 h to AF555- labeled anti- H2AX-PNE (red), fixed, and mounted with DAPI (blue). () 231-H2N cells were exposed for 4 h to AF555-labeled anti- H2AX-N-SS-E (red), fixed, and mounted with DAPI (blue).

5 Supplementary Figure S5 4 h post IR AF555-anti-γH2AX-N-SS-E or DAPI γh2ax AF555-rIgG-N-SS-E Merge 4 Gy 24 h post IR rigg-n-ss-e Gy rigg-n-ss-e 4 Gy Supplementary Figure S5: SQ2b cells were exposed for 1 h to AF555-labeled antiγh2ax-n-ss-e or rigg-n-ss-e, and irradiated (4 Gy) or sham irradiated. After 4 or 24 h, cells were fixed, stained for γh2ax (green) and mounted with DAPI (blue).

6 Supplementary Figure S6 A ound (cpm) In-EGF (nm) MDA-M-468 Gy, 1h 4 Gy, 1h Gy, 4h 4 Gy, 4h SQ2b Gy 1h 4 Gy 1h Gy 4h 4Gy4h 4h 231-H2N Gy, 1h 4 Gy, 1h Gy, 4h 4 Gy, 4h DAPI EGFR Merge 231-H2N SQ2b MD DA-M-468 Supplementary Figure S6: (A) MDA-M-468, SQ2b or 231-H2N cells were exposed to IR (4 Gy) or sham-irradiated. After 1or 4h, cells were exposed for 2h at 4 C to increasing concentrations of 111 In-EGF. To evaluate EGFR expression, the amount of membrane-bound 111 In was determined. The number of EGFR/cell was unaltered by IR. () MDA-M-468, SQ2b and 231-H2N cells were fixed, permeabilized and stained for EGFR (adapted from Cornelissen et al. J Nucl Med 211; 52: ).

7 Supplementary Figure S7 -SS- -SS- A. EGFR binding. EGFR-mediated C. Reductive internalization cleavage D. Endosomal escape & nuclear localization E. Irradiation & γh2ax foci formation F. 111 In-anti-γH2AX-N binds to γh2ax focus G. 111 In decays H. More DNA damage and more γh2ax foci I. Cell death Supplementary Figure S7. Proposed mechanism of action of 111 In-anti-γH2AX-N-SS-E. (A) 111 In-anti-γH2AX-N-SS-E binds to EGFR on the tumor cell membrane. () This binding triggers EGFR-mediated endocytosis and 111 In-anti-γH2AX-N-SS-E becomes encapsulated in an endosome. (C) There, glutathione and reductive enzymes cleave the disulphide bond, to release 111 In-anti-γH2AX-N, which (D) due to the NLS sequence, escapes from the endosome and localizes in the nucleus, through importin-nls interaction. (E) γh2ax foci form following IR. (F) 111 In-anti-γH2AX-N binds to γh2ax foci. (G) As 111 In decays, it emits a shower of Auger electrons at the DS site, which (H) causes more DSs, and more γh2ax foci to be formed, eventually (I) leading to cell death.

8 Supplementary Figure S8 relat tive 123 I counts I-NLS + NaIO4 2h + NaIO4 24h fraction Supplementary Figure S8: 123 I-labeled NLS shows a single peak on P4 SEC (black curve). When 123 I-NLS was reacted with.8 mg/ml NaIO 4 for 2 h there was no formation of higher molecular weight fragments (grey curve). However, after 24 h, there was evidence of dimerization (red curve).

Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the

Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the prey clones identified in the yeast two hybrid screen.

More information

Supplementary Figure 1. Additional RNAi screen data

Supplementary Figure 1. Additional RNAi screen data Supplementary Figure 1. Additional RNAi screen data A. Cisplatin induced ATR autophosphorylation. Western blot illustrating ATR and phospho-atr (T1989) in cells exposed to 1 µm cisplatin for 24 hours prior

More information

Overview of Solulink Products. June 2011

Overview of Solulink Products. June 2011 Overview of Solulink Products June 2011 1 Who we are Established in 2003, Solulink develops, patents, manufactures, and sells consumables to over 1,000 customers in life science, diagnostic, and pharmaceutical

More information

FIGURE S1. Representative images to illustrate RAD51 foci induction in FANCD2 wild-type (wt) and

FIGURE S1. Representative images to illustrate RAD51 foci induction in FANCD2 wild-type (wt) and Supplementary Figures FIGURE S1. Representative images to illustrate RAD51 foci induction in FANCD2 wild-type (wt) and mutant (mut) cells. Higher magnification is shown in Figure 1A. Arrows indicate cisplatin-induced

More information

Solutions to 7.02 Quiz II 10/27/05

Solutions to 7.02 Quiz II 10/27/05 Solutions to 7.02 Quiz II 10/27/05 Class Average = 83 Standard Deviation = 9 Range Grade % 87-100 A 43 74-86 B 39 55-73 C 17 > 54 D 1 Question 1 (56 points) While studying deep sea bacteria, you discover

More information

Figure S6. Detection of anti-gfp antibodies in anti-dna and normal plasma without competition DNA--9

Figure S6. Detection of anti-gfp antibodies in anti-dna and normal plasma without competition DNA--9 Supplementary Information Ultrasensitive antibody detection by agglutination-pcr (ADAP) Cheng-ting Tsai 1 *, Peter V. Robinson 1 *, Carole A. Spencer 2 and Carolyn R. Bertozzi 3,4ǂ Department of 1 Chemistry,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2579 Figure S1 Incorporation of heavy isotope-labeled amino acids and enrichment of di-glycine modified peptides. The incorporation of isotopelabeled amino acids in peptides was calculated

More information

Supplementary Information. Small Molecule-Induced Domain Swapping as a Mechanism for Controlling Protein Function and Assembly

Supplementary Information. Small Molecule-Induced Domain Swapping as a Mechanism for Controlling Protein Function and Assembly Supplementary Information Small Molecule-Induced Domain Swapping as a Mechanism for Controlling Protein Function and Assembly Joshua M. Karchin, Jeung-Hoi Ha, Kevin E. Namitz, Michael S. Cosgrove, and

More information

Supplemental Material to: SRam Sripad, Dongyoung Kim, Raimund Ober, E. Sally Ward

Supplemental Material to: SRam Sripad, Dongyoung Kim, Raimund Ober, E. Sally Ward Landes Bioscience www.landesbioscience.com Supplemental Material to: SRam Sripad, Dongyoung Kim, Raimund Ober, E. Sally Ward The level of HER2 expression is a predictor of antibody- HER2 trafficking behavior

More information

Supplemental Figure 1: GB-induced cell death is ROS-dependent. (a-b) K562 cells pre-incubated or not with NAC for 1h were treated with a sublytic

Supplemental Figure 1: GB-induced cell death is ROS-dependent. (a-b) K562 cells pre-incubated or not with NAC for 1h were treated with a sublytic Supplemental Figure 1: GB-induced cell death is ROS-dependent. (a-b) K562 cells pre-incubated or not with NAC for 1h were treated with a sublytic dose of P +/- GB. ROS production (a) and cell death (b)

More information

A RRM1 H2AX DAPI. RRM1 H2AX DAPI Merge. Cont. sirna RRM1

A RRM1 H2AX DAPI. RRM1 H2AX DAPI Merge. Cont. sirna RRM1 A H2AX DAPI H2AX DAPI Merge Cont sirna Figure S1: Accumulation of RRM1 at DNA damage sites (A) HeLa cells were subjected to in situ detergent extraction without IR irradiation, and immunostained with the

More information

Oligonucleotides were purchased from Eurogentec, purified by denaturing gel electrophoresis

Oligonucleotides were purchased from Eurogentec, purified by denaturing gel electrophoresis SUPPLEMENRY INFORMION Purification of probes and Oligonucleotides sequence Oligonucleotides were purchased from Eurogentec, purified by denaturing gel electrophoresis and recovered by electroelution. Labelling

More information

DOI: 10.1038/ncb3259 A Ismail et al. Supplementary Figure 1 B 60000 45000 SSC 30000 15000 Live cells 0 0 15000 30000 45000 60000 FSC- PARR 60000 45000 PARR Width 30000 FSC- 15000 Single cells 0 0 15000

More information

Protein analysis. Dr. Mamoun Ahram Summer semester, Resources This lecture Campbell and Farrell s Biochemistry, Chapters 5

Protein analysis. Dr. Mamoun Ahram Summer semester, Resources This lecture Campbell and Farrell s Biochemistry, Chapters 5 Protein analysis Dr. Mamoun Ahram Summer semester, 2015-2016 Resources This lecture Campbell and Farrell s Biochemistry, Chapters 5 Bases of protein separation Proteins can be purified on the basis Solubility

More information

BACTERIAL PRODUCTION EXPRESSION METHOD OVERVIEW: PEF # GENE NAME EXPRESSION VECTOR MOLECULAR WEIGHT kda (full-length) 34.

BACTERIAL PRODUCTION EXPRESSION METHOD OVERVIEW: PEF # GENE NAME EXPRESSION VECTOR MOLECULAR WEIGHT kda (full-length) 34. BACTERIAL PRODUCTION PEF # GENE NAME EXPRESSION VECTOR MOLECULAR WEIGHT 2015-XXXX XXXX pet-32a 50.9 kda (full-length) 34.0 kda (cleaved) EXPRESSION METHOD OVERVIEW: Plasmid DNA was transformed into BL21

More information

Supplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494

Supplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494 Supplementary Figure 1 Pol structure-function analysis (a) Inactivating polymerase and helicase mutations do not alter the stability of Pol. Flag epitopes were introduced using CRISPR/Cas9 gene targeting

More information

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

More information

BEH.462/3.962J Molecular Principles of Biomaterials Spring 2003

BEH.462/3.962J Molecular Principles of Biomaterials Spring 2003 Lecture 17: Drug targeting Last time: Today: Intracellular drug delivery Drug targeting Reading: T.J. Wickham, Ligand-directed targeting of genes to the site of disease, Nat. Med. 9(1) 135-139 (2003) Drug

More information

Case 7 A Storage Protein From Seeds of Brassica nigra is a Serine Protease Inhibitor

Case 7 A Storage Protein From Seeds of Brassica nigra is a Serine Protease Inhibitor Case 7 A Storage Protein From Seeds of Brassica nigra is a Serine Protease Inhibitor Focus concept Purification of a novel seed storage protein allows sequence analysis and determination of the protein

More information

Extracting Pure Proteins from Cells

Extracting Pure Proteins from Cells Extracting Pure Proteins from Cells 0 Purification techniques focus mainly on size & charge 0 The first step is homogenization (grinding, Potter Elvejhem homogenizer, sonication, freezing and thawing,

More information

Evaluation of Cu(I) Binding to the E2 Domain of the Amyloid. Precursor Protein A Lesson in Quantification of Metal Binding to

Evaluation of Cu(I) Binding to the E2 Domain of the Amyloid. Precursor Protein A Lesson in Quantification of Metal Binding to Electronic Supplementary Material (ESI) for Metallomics. This journal is The Royal Society of Chemistry 2017 Evaluation of Cu(I) Binding to the E2 Domain of the Amyloid Precursor Protein A Lesson in Quantification

More information

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and

More information

Visualizing mechanical tension across membrane receptors with a fluorescent sensor

Visualizing mechanical tension across membrane receptors with a fluorescent sensor Nature Methods Visualizing mechanical tension across membrane receptors with a fluorescent sensor Daniel R. Stabley, Carol Jurchenko, Stephen S. Marshall, Khalid S. Salaita Supplementary Figure 1 Fabrication

More information

Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous

Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous Preparation and purification of polyclonal antibodies Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous injections of glutathione S-transferase-ARHGAP25-(509-619) (GST-coiled

More information

Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.

Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb. Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length

More information

Supplementatry Fig 1. Domain structure, biophysical characterisation and electron microscopy of a TD. (a) XTACC3/Maskin and XMAP215/chTOG domain

Supplementatry Fig 1. Domain structure, biophysical characterisation and electron microscopy of a TD. (a) XTACC3/Maskin and XMAP215/chTOG domain Supplementatry Fig 1. Domain structure, biophysical characterisation and electron microscopy of a TD. (a) XTACC3/Maskin and XMAP215/chTOG domain architecture. Various C-terminal fragments were cloned and

More information

pt7ht vector and over-expressed in E. coli as inclusion bodies. Cells were lysed in 6 M

pt7ht vector and over-expressed in E. coli as inclusion bodies. Cells were lysed in 6 M Supplementary Methods MIG6 production, purification, inhibition, and kinase assays MIG6 segment 1 (30mer, residues 334 364) peptide was synthesized using standard solid-phase peptide synthesis as described

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 215 Supporting Information Quantitative Description of Thermodynamic and Kinetic Properties of the

More information

SUPPLEMENTAL MATERIAL BIOCHEMICAL AND STRUCTURAL STUDIES ON THE M. TUBERCULOSIS O 6 -METHYLGUANINE METHYLTRANSFERASE AND MUTATED VARIANTS

SUPPLEMENTAL MATERIAL BIOCHEMICAL AND STRUCTURAL STUDIES ON THE M. TUBERCULOSIS O 6 -METHYLGUANINE METHYLTRANSFERASE AND MUTATED VARIANTS SUPPLEMENTAL MATERIAL BIOCHEMICAL AND STRUCTURAL STUDIES ON THE M. TUBERCULOSIS O 6 -METHYLGUANINE METHYLTRANSFERASE AND MUTATED VARIANTS Riccardo Miggiano 1, Valentina Casazza 1, Silvia Garavaglia 1,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Figure S1: Activation of the ATM pathway by I-PpoI. A. HEK293T cells were either untransfected, vector transfected, transfected with an I-PpoI expression vector, or subjected to 2Gy γ-irradiation. 24 hrs

More information

SUPPLEMENTAL MATERIAL. Supplemental Methods:

SUPPLEMENTAL MATERIAL. Supplemental Methods: SUPPLEMENTAL MATERIAL Supplemental Methods: Immunoprecipitation- As we described but with some modifications [22]. As part of another ongoing project, lysate from human umbilical vein endothelial cells

More information

Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and

Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary

More information

Isolation of the recombinant middle and head + middle modules.

Isolation of the recombinant middle and head + middle modules. Supplementary Figure 1 Isolation of the recombinant middle and head + middle modules. (a) Scheme illustrating the multi-step purification protocol for the reconstituted middle module. Extract from infected

More information

Supplemental Materials and Methods

Supplemental Materials and Methods Supplemental Materials and Methods Co-immunoprecipitation (Co-IP) assay Cells were lysed with NETN buffer (20 mm Tris-HCl, ph 8.0, 0 mm NaCl, 1 mm EDT, 0.5% Nonidet P-40) containing 50 mm β-glycerophosphate,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Conserved arginines on the rim of Hfq catalyze base pair formation and exchange Subrata Panja and Sarah A. Woodson T.C. Jenkins Department of Biophysics, Johns Hopkins University,

More information

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) Quiz 1 Kinetics Review Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) I will post the problems with solutions on Toolkit for those that can t make

More information

Streptavidin Particles Technical Information

Streptavidin Particles Technical Information Streptavidin Particles Technical Information Streptavidin Streptavidin is a protein (MW of approx. 66,000) made up of four identical subunits, each containing a high affinity binding site for biotin (KD

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/ncb37 a Supplementary Figure 1 Dapi EU γh2ax Overlay b Dapi NBS1-GFP Firbillarin Overlay c Pre-laser 2 min 5 min 1 min 2 min 3 min 4 min 5 min 6 min 7 min d Dapi GFP-MRE11 γh2ax Overlay Supplementary

More information

Supplementary Figure S1. N-terminal fragments of LRRK1 bind to Grb2.

Supplementary Figure S1. N-terminal fragments of LRRK1 bind to Grb2. Myc- HA-Grb2 Mr(K) 105 IP HA 75 25 105 1-1163 1-595 - + - + - + 1164-1989 Blot Myc HA total lysate 75 25 Myc HA Supplementary Figure S1. N-terminal fragments of bind to Grb2. COS7 cells were cotransfected

More information

Purification: Step 1. Lecture 11 Protein and Peptide Chemistry. Cells: Break them open! Crude Extract

Purification: Step 1. Lecture 11 Protein and Peptide Chemistry. Cells: Break them open! Crude Extract Purification: Step 1 Lecture 11 Protein and Peptide Chemistry Cells: Break them open! Crude Extract Total contents of cell Margaret A. Daugherty Fall 2003 Big Problem: Crude extract is not the natural

More information

Purification: Step 1. Protein and Peptide Chemistry. Lecture 11. Big Problem: Crude extract is not the natural environment. Cells: Break them open!

Purification: Step 1. Protein and Peptide Chemistry. Lecture 11. Big Problem: Crude extract is not the natural environment. Cells: Break them open! Lecture 11 Protein and Peptide Chemistry Margaret A. Daugherty Fall 2003 Purification: Step 1 Cells: Break them open! Crude Extract Total contents of cell Big Problem: Crude extract is not the natural

More information

1 24 C63 C β- β-

1 24 C63 C β- β- M40 Signal leaved RS1 Domain 59 110 142 Discoidin Domain 223 1 24 63 219 224 + - β- β- M M e e O O H H His 6 -Tag 250 150 100 75 50 37 * 25 20 Supplementary Figure 1 Purification of wild-type retinoschisin.

More information

SUPPLEMENTARY INFORMATION. Reengineering Protein Interfaces Yields Copper-Inducible Ferritin Cage Assembly

SUPPLEMENTARY INFORMATION. Reengineering Protein Interfaces Yields Copper-Inducible Ferritin Cage Assembly SUPPLEMENTARY INFORMATION Reengineering Protein Interfaces Yields Copper-Inducible Ferritin Cage Assembly Dustin J. E. Huard, Kathleen M. Kane and F. Akif Tezcan* Department of Chemistry and Biochemistry,

More information

Compound 2 (EDC HCl)

Compound 2 (EDC HCl) H NHBoc Compound 1 Bzl NH 2 Aniline HCl Et N C N N Compound 2 (EDC HCl) CHCl 3, rt HN Bzl NHBoc Compound 3 HN Bzl H 2, Pd/C HN H CF 3 CH, rt NH 2 AcH-H 2, rt NH 2 Compound 4 Compound 5 (γ-ga) Fig. S1 Scheme

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION (Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).

More information

Supporting Information for

Supporting Information for Supporting Information for Building Electromagnetic Hot Spots in Living Cells via Target-Triggered Nanoparticle Dimerization Wen Zhou, 1,2 Qiang Li, 1 Huiqiao Liu, 1 Jie Yang, 1 Dingbin Liu 1,2 * 1. College

More information

Supplemental Figure S1. Nucleotide and deduced amino acid sequences of pepper CaHSP70a (Capsicum annuum heat shock protein 70a) cdna.

Supplemental Figure S1. Nucleotide and deduced amino acid sequences of pepper CaHSP70a (Capsicum annuum heat shock protein 70a) cdna. Supplemental Figure S1. Nucleotide and deduced amino acid sequences of pepper (Capsicum annuum heat shock protein 70a) cdna. Translation initiation codon is shown in bold typeface; termination codon is

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENRY INFORMION doi:.38/nature In vivo nucleosome mapping D4+ Lymphocytes radient-based and I-bead cell sorting D8+ Lymphocytes ranulocytes Lyse the cells Isolate and sequence mononucleosome cores

More information

XactEdit Cas9 Nuclease with NLS User Manual

XactEdit Cas9 Nuclease with NLS User Manual XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures 1-8

SUPPLEMENTARY INFORMATION. Supplementary Figures 1-8 SUPPLEMENTARY INFORMATION Supplementary Figures 1-8 Supplementary Figure 1. TFAM residues contacting the DNA minor groove (A) TFAM contacts on nonspecific DNA. Leu58, Ile81, Asn163, Pro178, and Leu182

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane

More information

SUPPLEMENTAL MATERIAL. Supplemental material contains Supplemental Figure Legends and Supplemental Figures 1 to

SUPPLEMENTAL MATERIAL. Supplemental material contains Supplemental Figure Legends and Supplemental Figures 1 to SUPPLEMENTAL MATERIAL Supplemental material contains Supplemental Figure Legends and Supplemental Figures 1 to 6. SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Overview of the mechanisms by which

More information

Automated Imaging and Dual-Mask Analysis of γh2ax Foci to Determine DNA Damage on an Individual Cell Basis

Automated Imaging and Dual-Mask Analysis of γh2ax Foci to Determine DNA Damage on an Individual Cell Basis A p p l i c a t i o n N o t e Automated Imaging and Dual-Mask Analysis of γh2ax Foci to Determine DNA Damage on an Individual Cell Basis Brad Larson, BioTek Instruments, Inc., Winooski, VT USA Asha Sinha

More information

Supplementary Fig. S1

Supplementary Fig. S1 Supplementary Fig. S1 CL IP Unc931Flag + + + + IP: αh I: αflg Unc931 CL IP Unc931Flag + + + + FL IP: αflg I: αh Shorter fragment Supplementary Fig. S1: Unc931 associates with full length and Cterminal

More information

Protein Purification and Characterization Techniques. Nafith Abu Tarboush, DDS, MSc, PhD

Protein Purification and Characterization Techniques. Nafith Abu Tarboush, DDS, MSc, PhD Protein Purification and Characterization Techniques Nafith Abu Tarboush, DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush Extracting Pure Proteins from Cells Purification techniques focus

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Results Construct purification and coupling. Two A1-GP1bα ReaLiSM constructs, with and without cysteine residues near the N and C-termini (Fig. S2a), were expressed and purified by Ni affinity chromatography

More information

Immunoglobulins. (1 of 2)

Immunoglobulins. (1 of 2) Immunoglobulins (1 of 2) Immunoglobulins (Igs) = antibodies Each B cell synthesizes Igs of single specificity for a specific epitope B cell receptors (BCRs) are the Igs on B cell surface Humoral immunity

More information

T-cell response. Taken from NIAID: s.aspx

T-cell response. Taken from NIAID:   s.aspx T-cell receptor T-cell response 1. Macrophage or dendritic cell digest antigen bacteria, virus 2. Fragments of Ag bind to major histo-compatiblity (MHC) proteins in macrophage. 3. MHC I-Ag fragment expressed

More information

Supplementary information, Figure S1A ShHTL7 interacted with MAX2 but not another F-box protein COI1.

Supplementary information, Figure S1A ShHTL7 interacted with MAX2 but not another F-box protein COI1. GR24 (μm) 0 20 0 20 GST-ShHTL7 anti-gst His-MAX2 His-COI1 PVDF staining Supplementary information, Figure S1A ShHTL7 interacted with MAX2 but not another F-box protein COI1. Pull-down assays using GST-ShHTL7

More information

Paper presentation PNAS October 20, 2009 vol. 106 no

Paper presentation PNAS October 20, 2009 vol. 106 no Paper presentation Continuous imaging of plasmon rulers in live cells reveals early-stage caspase-3 activation at the single-molecule level Young-wook Jun a, Sassan Sheikholeslami a,1, Daniel R. Hostetter

More information

Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b)

Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b) Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) A schematic overview of the production and amplification of a single pirna from a transposon transcript. The

More information

SUPPLEMENTARY INFORMATION FIGURE LEGENDS

SUPPLEMENTARY INFORMATION FIGURE LEGENDS SUPPLEMENTARY INFORMATION FIGURE LEGENDS Fig. S1. Radiation-induced phosphorylation of Rad50 at a specific site. A. Rad50 is an in vitro substrate for ATM. A series of Rad50-GSTs covering the entire molecule

More information

Applications involving the ViroCyt Virus Counter in the production of various recombinant proteins

Applications involving the ViroCyt Virus Counter in the production of various recombinant proteins Applications involving the ViroCyt Virus Counter in the production of various recombinant proteins Chris Kemp Kempbio, Inc. Frederick, MD USA chris.kemp@kempbioinc.com Presentation Summary Kempbio, Inc.

More information

Design of Thiol ene Photoclick Hydrogels Using Facile Techniques for Cell Culture Applications

Design of Thiol ene Photoclick Hydrogels Using Facile Techniques for Cell Culture Applications Electronic Supplementary Material (ESI) for Biomaterials Science. This journal is The Royal Society of Chemistry 2014 Design of Thiol ene Photoclick Hydrogels Using Facile Techniques for Cell Culture Applications

More information

PDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ

PDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ PDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ Supplementary Material Figure S1. PDIP46 is associated with Pol isolated by immunoaffinity chromatography.

More information

Lecture 5: 8/31. CHAPTER 5 Techniques in Protein Biochemistry

Lecture 5: 8/31. CHAPTER 5 Techniques in Protein Biochemistry Lecture 5: 8/31 CHAPTER 5 Techniques in Protein Biochemistry Chapter 5 Outline The proteome is the entire set of proteins expressed and modified by a cell under a particular set of biochemical conditions.

More information

DNA STRUCTURE. Nucleotides: Nitrogenous Bases (Carry the Genetic Code) Expectation Sheet: DNA & Cell Cycle. I can statements: Basic Information:

DNA STRUCTURE. Nucleotides: Nitrogenous Bases (Carry the Genetic Code) Expectation Sheet: DNA & Cell Cycle. I can statements: Basic Information: Expectation Sheet: DNA & Cell Cycle NAME: Test is 11/8/17 I can statements: I can discuss how DNA is found in all organisms and that the structure is common to all living things. I can diagram and label

More information

Case 7 A Storage Protein From Seeds of Brassica nigra is a Serine Protease Inhibitor Last modified 29 September 2005

Case 7 A Storage Protein From Seeds of Brassica nigra is a Serine Protease Inhibitor Last modified 29 September 2005 Case 7 A Storage Protein From Seeds of Brassica nigra is a Serine Protease Inhibitor Last modified 9 September 005 Focus concept Purification of a novel seed storage protein allows sequence analysis and

More information

University of Bristol - Explore Bristol Research

University of Bristol - Explore Bristol Research Butterer, A., Pernstich, C., Smith, R. M., Sobott, F., Szczelkun, M. D., & Tóth, J. (2014). Type III restriction endonucleases are heterotrimeric: comprising one helicase-nuclease subunit and a dimeric

More information

antibody specific production rates [pg/d/cell] growth rates [%/d] culture flask miniperm CL1000 culture flask miniperm CL1000

antibody specific production rates [pg/d/cell] growth rates [%/d] culture flask miniperm CL1000 culture flask miniperm CL1000 Table 1: Growth rates of transfectomas and production, concentrations and yields of monomeric (2-IgA) and dimeric 2-IgA (2-dIgA) under different culture conditions. antibody specific production rates [pg/d/cell]

More information

Supplementary information

Supplementary information Supplementary information The E3 ligase RNF8 regulates KU80 removal and NHEJ repair Lin Feng 1, Junjie Chen 1 1 Department of Experimental Radiation Oncology, The University of Texas M. D. Anderson Cancer

More information

SUPPLEMENTARY INFORMATION. doi: /nature Human 1 Mouse 1 Xenopus Human 2 Mouse 2 Danio Dros Sulso

SUPPLEMENTARY INFORMATION. doi: /nature Human 1 Mouse 1 Xenopus Human 2 Mouse 2 Danio Dros Sulso S1 Human 1 Mouse 1 Xenopus Human 2 Mouse 2 Danio Dros Sulso Human 1 Mouse 1 Xenopus Human 2 Mouse 2 Danio Dros Sulso Human 1 Mouse 1 Xenopus Human 2 Mouse 2 Danio Dros Sulso Human 1 Mouse 1 Xenopus Human

More information

Manipulation of Purified DNA

Manipulation of Purified DNA Manipulation of Purified DNA To produce the recombinant DNA molecule, the vector, as well as the DNA to be cloned, must be cut at specific points and then joined together in a controlled manner by DNA

More information

Estradiol-Estrogen Receptor α Mediates the Expression of the CXXC5 Gene through the Estrogen Response Element-Dependent Signaling Pathway

Estradiol-Estrogen Receptor α Mediates the Expression of the CXXC5 Gene through the Estrogen Response Element-Dependent Signaling Pathway Estradiol-Estrogen Receptor α Mediates the Expression of the CXXC5 Gene through the Estrogen Response Element-Dependent Signaling Pathway Pelin Yaşar, Gamze Ayaz and Mesut Muyan SUPPLEMENTARY INFORMATION

More information

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying

More information

Biodegradable nanobrushes for drug delivery

Biodegradable nanobrushes for drug delivery Nanotek & Expo 2014 Biodegradable nanobrushes for drug delivery Eggehard Holler, Hui Ding, Ramachandran Murali, Julia Y. Ljubimova edars-sinai Medical enter, Los Angeles, USA Liposome Nanoparticle Gold

More information

Supplementary Information for

Supplementary Information for Supplementary Information for Siglec-7 Engagement by GBS -protein Suppresses Pyroptotic Cell Death of Natural Killer Cells Jerry J. Fong a,b, Chih-Ming Tsai a,b, Sudeshna Saha a,b, Victor Nizet a,c,d Ajit

More information

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc. Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers

More information

Single-cell genome sequencing at ultra-high-throughput with microfluidic droplet barcoding

Single-cell genome sequencing at ultra-high-throughput with microfluidic droplet barcoding CORRECTION NOTICE Nat. Biotechnol. doi:10.1038/nbt.3880 Single-cell genome sequencing at ultra-high-throughput with microfluidic droplet barcoding Freeman Lan, Benjamin Demaree, Noorsher Ahmed & Adam R

More information

Heparan Sulphate in Breast Cancer Low, Y.L.A 1 and Yip, C.W.G 2

Heparan Sulphate in Breast Cancer Low, Y.L.A 1 and Yip, C.W.G 2 Heparan Sulphate in Breast Cancer Low, Y.L.A 1 and Yip, C.W.G 2 Department of Anatomy, Yong Loo Lin School of Medicine, National University of Singapore MD10, 4 Medical Drive, Singapore 117597 ABSTRACT

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3209 Supplementary Figure 1 IR induces the association of FH with chromatin. a, U2OS cells synchronized by thymidine double block (2 mm) underwent no release (G1 phase) or release for 2

More information

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG. Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination

More information

Gene Forward Primer Reverse Primer GAPDH ATCATCCCTGCCTCTACTGG GTCAGGTCCACCACTGACAC SSB1 AACTTCAGTGAGCCAAACCC GTTCTCAGAGGCTGGAGAGG

Gene Forward Primer Reverse Primer GAPDH ATCATCCCTGCCTCTACTGG GTCAGGTCCACCACTGACAC SSB1 AACTTCAGTGAGCCAAACCC GTTCTCAGAGGCTGGAGAGG Supplemental Data EXPERIMENTAL PROCEDURES Plasmids and Antibodies- Full length cdna of INT11 or INT12 were cloned into ps- Flag-SBP vector respectively. Anti-RNA pol II (RPB1) was purchased from Santa

More information

Conformation of the Mineralocorticoid Receptor N- terminal Domain: Evidence for Induced and Stable Structure

Conformation of the Mineralocorticoid Receptor N- terminal Domain: Evidence for Induced and Stable Structure ME-10-0005 Conformation of the Mineralocorticoid Receptor N- terminal Domain: Evidence for Induced and Stable Structure Katharina Fischer 1, Sharon M. Kelly 2, Kate Watt 1, Nicholas C. Price 2 and Iain

More information

A fluorescent probe for cysteine depalmitoylation reveals dynamic APT signaling

A fluorescent probe for cysteine depalmitoylation reveals dynamic APT signaling SUPPLEMENTARY INFRMATIN A fluorescent probe for cysteine depalmitoylation reveals dynamic APT signaling Rahul S. Kathayat 1, Pablo D. Elvira 1, Bryan C. Dickinson 1 * 1 Department of Chemistry, The University

More information

JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Hong et al.,

JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Hong et al., Supplemental material JCB Hong et al., http://www.jcb.org/cgi/content/full/jcb.201412127/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Analysis of purified proteins by SDS-PAGE and pull-down assays. (A) Coomassie-stained

More information

TITLE: Molecularly Targeted Dose-Enhancement Radiotherapy Using Gold and Luminescent Nanoparticles in an Orthotopic Human Prostate Cancer Rat Model

TITLE: Molecularly Targeted Dose-Enhancement Radiotherapy Using Gold and Luminescent Nanoparticles in an Orthotopic Human Prostate Cancer Rat Model AD Award Number: W81XWH-11-1-0324 TITLE: Molecularly Targeted Dose-Enhancement Radiotherapy Using Gold and Luminescent Nanoparticles in an Orthotopic Human Prostate Cancer Rat Model PRINCIPAL INVESTIGATOR:

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION DOI: 10.1038/NNANO.2013.71 DNA sequencing with electrical conductance measurements of a DNA polymerase Yu-Shiun Chen, Chia-Hui Lee, Meng-Yen Hung, Hsu-An Pan, Jin-Chern Chiou,

More information

MT minus end catastrophe

MT minus end catastrophe DOI: 1.138/ncb3241 MT minus end catastrophe frequency [s -1 ].2.15.1.5 control mgfp- TPX2 * * mgfp- TPX2 mini Supplementary Figure 1. TPX2 reduces catastrophes at the microtubule minus ends. Modified box-and-whiskers

More information

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43

More information

Samhita et al., Figure S1

Samhita et al., Figure S1 amhita et al., Figure 1 22 o C o C 37 o C 42 o C Figure 1: Growth of E. coli strains KL16 and KL16 metzwv. Replicates of E. coli strains KL16 and KL16 metzwv were grown overnight in LB. A loopful of culture

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 215 Electronic Supplementary Information Selective cell elimination in vitro and in vivo cell elimination

More information

Reading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation

Reading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation Lecture 3 Reading Lecture 3: 24-25, 45, 55-66 Lecture 4: 66-71, 75-79 Vectors Definition Properties Types Transformation 56 VECTORS- Definition Vectors are carriers of a DNA fragment of interest Insert

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods sirna sequences used in this study The sequences of Stealth Select RNAi for ALK and FLOT-1 were as follows: ALK sense no.1 (ALK): 5 -AAUACUGACAGCCACAGGCAAUGUC-3 ; ALK

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.1805 Visualization and Selective Chemical Targeting of RNA G-quadruplex Structures in the Cytoplasm of Human Cells Giulia Biffi 1, Marco Di Antonio 2, David Tannahill 1 and Shankar Balasubramanian

More information

TALEN mediated targeted editing of GM2/GD2-synthase gene modulates anchorage independent growth by reducing anoikis resistance in mouse tumor cells

TALEN mediated targeted editing of GM2/GD2-synthase gene modulates anchorage independent growth by reducing anoikis resistance in mouse tumor cells Supplementary Information for TALEN mediated targeted editing of GM2/GD2-synthase gene modulates anchorage independent growth by reducing anoikis resistance in mouse tumor cells Barun Mahata 1, Avisek

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid

More information

Detection and study of the formation and repair of DNA double-strand breaks after irradiation

Detection and study of the formation and repair of DNA double-strand breaks after irradiation Laboratory of Radiation Biology (LRB) Detection and study of the formation and repair of DNA double-strand breaks after irradiation Students: Ioana-Cezara Bucataru Bianca-Gabriela Zota Katarína Žirová

More information

% Viability. isw2 ino isw2 ino isw2 ino isw2 ino mM HU 4-NQO CPT

% Viability. isw2 ino isw2 ino isw2 ino isw2 ino mM HU 4-NQO CPT a Drug concentration b 1.3% MMS nhp1 nhp1 8 nhp1 mag1.5% MMS.3% MMS nhp1 nhp1 ino8 9 ino8 9 % Viability 4.5% MMS ino8 9 ino8 9 2.5.1.15 % MMS c d nhp1 nhp1 nhp1 nhp1 nhp1 nhp1 Control (YPD) γ IR (1 gy)

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/404/ra120/dc1 Supplementary Materials for The subcellular localization and activity of cortactin is regulated by acetylation and interaction with Keap1 Akihiro

More information