GeneClip U1 Hairpin Cloning Systems INSTRUCTIONS FOR USE OF PRODUCTS C8750, C8760, C8770, C8780 AND C8790.

Transcription

1 Technical Manual eneclip U1 Hairpin Cloning Systems INSTRUCTIONS FOR USE OF PRODUCTS C8750, C8760, C8770, C8780 AND C8790. PRINTED IN USA. Revised 3/11

2 eneclip U1 Hairpin Cloning Systems All technical literature is available on the Internet at Please visit the web site to verify that you are using the most current version of this Technical Manual. Please contact Promega Technical Services if you have questions on use of this system. 1. Description Product Components and Storage Conditions Oligonucleotide Design...6 A. sirna Hairpin Target Sequence Selection...6 B. eneclip Hairpin Oligonucleotide Design Cloning a Hairpin Insert into the peneclip Vectors...8 A. Oligonucleotide Dilution and Annealing...8 B. Ligation of a Hairpin Insert into the peneclip Vectors...8 C. Transformation of E. coli with peneclip Vectors Containing Inserts...10 D. Purifying Recombinant Plasmid DNA...12 E. Screening for Inserts Using Pst I Digestion Transfection of peneclip Vector Constructs in an sirna Suppression Assay...13 A. Transient Transfection of the peneclip Vector Constructs...13 B. Stable Transfection of the peneclip Puromycin, Hygromycin and Neomycin Vector Constructs...14 C. Quantitating sirna Target ene Suppression Troubleshooting References Appendix...19 A. peneclip Vector Maps and Sequence Reference Points...19 B. peneclip Basic Vector Restriction Enzyme Sites...24 C. peneclip Puromycin Vector Restriction Enzyme Sites...26 D. peneclip Hygromycin Vector Restriction Enzyme Sites...28 E. peneclip Neomycin Vector Restriction Enzyme Sites...30 F. peneclip hmfp Vector Restriction Enzyme Sites Composition of Buffers and Solutions...34 H. Related Products...34 Revised 3/11 Page 1

3 1. Description RNA interference (RNAi), a phenomenon in which double-stranded RNA suppresses expression of a target protein by stimulating specific degradation of the target mrna, provides a powerful genetic tool for selectively silencing gene expression in many eukaryotes (1 6). In mammalian systems, short interfering RNAs (sirnas) are the main effectors of the RNAi process (7,8). The sequence-specific RNAi effect can be observed by introduction of sirnas into cells either via transfection or by endogenous expression of base transcripts (8 10). In vivo expression of sirnas can be effectively achieved by generating DNA vectors containing a U1 RNA polymerase promoter, a template for transcription of an sirna and a transcription terminator sequence, then transfecting these into eukaryotic cells. In cells, RNA polymerase II normally recognizes the U1 promoter to transcribe small nuclear RNAs. The U1 promoter has been used successfully to generate sirnas in mammalian cells (11). eneclip U1 Hairpin Cloning Systems In the eneclip U1 Hairpin Cloning Systems, sirnas are expressed as foldback stem-loop structures that are transcribed from the U1 promoter. The eneclip U1 Hairpin Cloning Systems include linearized plasmids (peneclip Vectors) designed for easy and fast cloning of hairpin target sequences to allow expression of sirna target sequences in human cells. The peneclip Vectors contain the human U1 promoter, which allows transcription of the hairpin target sequences and generation of hairpin sirna in vivo. The eneclip U1 Hairpin Cloning System Basic is intended for transient suppression of the gene of interest. The eneclip U1 Hairpin Cloning System hmfp enables easy determination of transfection efficiency and allows selection of transfected cells by fluorescence-activated cell sorting (FACS ; 12 14). The other eneclip U1 Hairpin Cloning Systems offer antibiotic marker options (neomycin, hygromycin or puromycin) for selecting stably transfected eukaryotic cells so that experimental results do not depend on transfection efficiency. Hairpin Insert Two DNA oligonucleotides, supplied by the user, are synthesized and annealed to form a DNA insert that contains the hairpin sirna target sequence. Upon annealing, the oligonucleotides form ends that are compatible with the ends of the linearized peneclip Vector and facilitate a sticky end ligation (Figure 1). All of the peneclip Vectors contain the Amp r gene, which confers resistance to ampicillin and allows selection in E. coli. Page 2 Revised 3/11

4 Screening for Successful Ligation The eneclip U1 Hairpin Cloning Systems are designed to allow easy determination of successful ligation. Successful ligation of the annealed oligonucleotides and the vector results in creation of a second Pst I restriction site in addition to the Pst I site already present in the peneclip Vectors. The presence of an insert can be confirmed by Pst I digestion; clones containing an insert will produce two bands on an agarose gel. Features More Vector Choices: These systems provide vectors containing a variety of eukaryotic, antibiotic-selectable markers for stable transfection, or hmfp for determination of transfection efficiency and selection of transfected cells by FACS analysis. Time Savings: Vectors are supplied predigested to eliminate time-consuming vector preparation. Convenience: The system includes T4 DNA Ligase, 2X Rapid Ligation Buffer, Nuclease-Free Water and Oligo Annealing Buffer in addition to the peneclip Vector. Easier Identification of Desired Clones: A Pst I digestion quickly identifies positive recombinants. Revised 3/11 Page 3

5 5 3 TCTC Annealed Hairpin Oligonucleotides CT ACTC 3 5 CA U1 Promoter AA peneclip Vector PstI Ligation U1 Promoter TCTC AA CTCA ACTC New PstI site Hairpin oligonucleotides ligated into the peneclip Vector PstI Screening for inserts by PstI digestion 4714MA Figure 1. Overview of the eneclip U1 Hairpin Cloning System protocol. Page 4 Revised 3/11

6 2. Product Components and Storage Conditions Product eneclip U1 Hairpin Cloning System Basic (a,b,c) Each system contains sufficient reagents for 20 ligation reactions. 200µl 2X Rapid Ligation Buffer 100 units T4 DNA Ligase 1.2µg peneclip Basic Vector, 50µg/ml 1ml Oligo Annealing Buffer 1.25ml Nuclease-Free Water Product eneclip U1 Hairpin Cloning System Puromycin (a,b,c) Each system contains sufficient reagents for 20 ligation reactions. 200µl 2X Rapid Ligation Buffer 100 units T4 DNA Ligase 1.2µg peneclip Puromycin Vector, 50µg/ml 1ml Oligo Annealing Buffer 1.25ml Nuclease-Free Water Product eneclip U1 Hairpin Cloning System Hygromycin (a,b,c) Each system contains sufficient reagents for 20 ligation reactions. 200µl 2X Rapid Ligation Buffer 100 units T4 DNA Ligase 1.2µg peneclip Hygromycin Vector, 50µg/ml 1ml Oligo Annealing Buffer 1.25ml Nuclease-Free Water Product eneclip U1 Hairpin Cloning System Neomycin (a,b,c) Each system contains sufficient reagents for 20 ligation reactions. 200µl 2X Rapid Ligation Buffer 100 units T4 DNA Ligase 1.2µg peneclip Neomycin Vector, 50µg/ml 1ml Oligo Annealing Buffer 1.25ml Nuclease-Free Water Cat.# C8750 Cat.# C8760 Cat.# C8770 Cat.# C8780 Revised 3/11 Page 5

7 Product eneclip U1 Hairpin Cloning System hmfp (a g) Each system contains sufficient reagents for 20 ligation reactions. 200µl 2X Rapid Ligation Buffer 100 units T4 DNA Ligase 1.2µg peneclip hmfp Vector, 50µg/ml 1ml Oligo Annealing Buffer 1.25ml Nuclease-Free Water Storage Conditions: Store at 20 C. Cat.# C Oligonucleotide Design 3.A. sirna Hairpin Target Sequence Selection Choose a nucleotide target sequence that starts with a "" from the coding sequence of the gene of interest. eneral guidelines for target sequence selection are continuously being developed (15,16).! 3.B. Although the existing rules for sirna selection serve as a reliable guide, they do not ensure that each selected sirna sequence will reduce gene expression, and the optimal target sequence may have to be determined experimentally (17). As a negative control for RNA interference, use a nonspecific target sequence or a scrambled sequence. eneclip Hairpin Oligonucleotide Design The eneclip U1 Hairpin Cloning Systems are designed to allow easy and fast detection of successful hairpin insertion. Two hairpin oligonucleotides (oligonucleotides A and B, supplied by the user) are annealed to form a double-stranded DNA fragment for ligation into the peneclip Vectors. (Figures 1 and 4). The hairpin oligonucleotides used in these systems are under 60bp in length. Since detection of a 60bp insert is difficult using an agarose gel, we have devised a method to allow detection of inserts by Pst I digestion. The peneclip Vectors contain a single Pst I site. Insertion of the hairpin oligonucleotides creates a second Pst I site, and digestion with Pst I will yield two DNA fragments in the presence of an insert. Pst I digestion of peneclip Vectors that do not contain insert will result in linearization of the vector (see Section 4.E). Note: Two hairpin oligonucleotides must be ordered for each sequence tested. Standard desalting of the oligonucleotides is required prior to use; gel purification and 5 phosphorylation are not required. Page 6 Revised 3/11

8 Oligonucleotide A Oligonucleotide A forms the template strand for cellular RNA polymerase II and should contain the following elements: Overhang sequence. This four-nucleotide sequence (TCTC) is complementary to the overhang of the peneclip Vectors and completes the U1 promotor sequence. Hairpin sequence. Includes: Target sequence. See Section 3.A. This sequence, in conjunction with its reverse complement, forms the double-stranded portion of the cellular sirna hairpin. Loop sequence. This sequence provides flexibility for RNA hairpin formation within the cell. We have tested two different loop sequences (CTTCCTTCA and AATTCTCT) in our system and observed comparable suppression levels with each. Other loop sequences reported in the literature have not been tested (18). Target sequence reverse complement. This sequence, in conjunction with the target sequence, forms the double-stranded portion of the cellular RNA hairpin. Additional CT residues. The additional CT residues are required for the formation of the second Pst I site upon ligation of the insert. These two nucleotides also form the 3 overhang required for successful sirnas. Hairpin Sequence Target Loop Reverse Complement 5 TCTC CT MA Figure 2. Structure of oligonucleotide A. Oligonucleotide B Oligonucleotide B has regions that are complementary to oligonucleotide A, with additional sequences for ligation into the peneclip Vectors. Oligonucleotide B should contain the following elements: Hairpin sequence complement. This sequence is complementary to, and in the opposite orientation from, the hairpin sequence of oligonucleotide A. Overhang sequence. This sequence (ACTC) is complementary to the peneclip Vector overhang and contains an additional nucleotide to form a Pst I site upon successful ligation. This newly generated Pst I site allows easy detection of clones with inserts. 3 Hairpin Sequence Complement ACTC MA Figure 3. Structure of oligonucleotide B. Note that the sequence is represented in the 3 to 5 orientation. Revised 3/11 Page 7

9 An example of hairpin oligonucleotide sequences using the 19-nucleotide target mrna sequence, 5 ggccuuucacuacuccuac 3, is shown in Figure 4. Each oligonucleotide in this example is 57 nucleotides in length. 4. Cloning a Hairpin Insert into the peneclip Vectors Materials to Be Supplied by the User (Solution compositions are provided in Section 8.) oligonucleotide A (see Section 3) oligonucleotide B (see Section 3) high-efficiency competent cells ( cfu/µg) 1.5ml polypropylene microcentrifuge tubes or mm polypropylene tubes (Falcon Cat.# 2059) LB plates with ampicillin SOC medium 4.A. Oligonucleotide Dilution and Annealing 1. Dilute oligonucleotide A and oligonucleotide B in TE buffer or Nuclease- Free Water to a final concentration of 1µg/µl. 2. Assemble the annealing reaction as described below. oligonucleotide A (1µg/µl) 2µl oligonucleotide B (1µg/µl) 2µl Oligo Annealing Buffer 46µl Total volume 50µl The final concentration of each hairpin oligonucleotide is 40ng/µl. 3. Heat the annealing reaction at 90 C for 3 minutes. 4. Transfer to a 37 C water bath and incubate for 15 minutes. 5. The annealed hairpin oligonucleotides can be used immediately or stored at 20 C for up to one month. If the annealed oligonucleotides are stored at 20 C, thaw them at room temperature prior to use. Avoid thawing the annealed oligonucleotides at temperatures above room temperature. 4.B. Ligation of a Hairpin Insert into the peneclip Vectors The peneclip Vectors are provided as linearized vectors. No manipulation of the vectors is required prior to ligation. 1. Dilute the annealed hairpin oligonucleotides from Section 4.A, Step 5, just prior to assembling the ligation reaction as described below. Note: Do not store the diluted oligonucleotides. annealed hairpin oligonucleotides 5µl Nuclease-Free Water 45µl Total volume 50µl The final concentration of each oligonucleotide is 4ng/µl. Page 8 Revised 3/11

10 4713MA Target mrna sequence: 5 ggccuuucacuacuccuac 3 Hairpin Oligonucleotide Sequence: Oligonucleotide A Oligonucleotide B Overhang 5 3 Target Sequence Loop Target Reverse Complement TCTCggcctttcactactcctacCTTCCTTCAgtaggagtagtgaaaggccct ccggaaagtgatgaggatgaaacatcatcctcatcactttccgggactc Overhang Hairpin Oligonucleotide Inserted into the peneclip Vector U1 Promoter Transcription Start Site Vector Target Target Reverse Sequence Loop Complement Pst I* TCTCggcctttcactactcctacCTTCCTTCAgtaggagtagtgaaaggccctCA AAccggaaagtgatgaggatgAAACATcatcctcatcactttccgggaCTC *New Pst I site is generated to allow easy identification of positive clones. Figure 4. Example of hairpin oligonucleotide sequences. 3 5 Vector Revised 3/11 Page 9

11 2. Assemble the ligation reactions as described below. See Notes a and b. 4.C. Negative Control Standard (Minus Insert) Reaction 2X Rapid Ligation Buffer 5µl 5µl peneclip Vector (50ng/µl) 1µl 1µl annealed oligonucleotides A and B (4ng/µl each) 1µl Nuclease-Free Water 3µl 2µl T4 DNA Ligase (3 units/µl) 1µl 1µl Total volume 10µl 10µl Notes: a. The 2X Rapid Ligation Buffer contains ATP, which degrades during temperature fluctuations. Avoid multiple freeze-thaw cycles and exposure to frequent temperature changes by making single-use aliquots of the buffer after the buffer is thawed for the first time. Store the aliquots at 20 C. b. Vortex the 2X Rapid Ligation Buffer before each use. 3. Mix the reactions by pipetting. Incubate the reactions at room temperature for 5 minutes. Alternatively, the reactions can be incubated for 1 hour at room temperature or overnight at 4 C. Transformation of E. coli with peneclip Vectors Containing Inserts The ligation of fragments with a hairpin can be inefficient, so it is essential to use competent cells with a transformation efficiency of cfu/µg DNA in order to obtain a reasonable number of colonies. Transformation efficiency can be confirmed by performing a control transformation reaction using a known quantity of supercoiled plasmid DNA, typically 0.1ng, then calculating the number of colony forming units per microgram of DNA. We recommend using high-efficiency JM109 Competent Cells (Cat.# L2001). Other host strains, such as DH5α, may be used. If you are using competent cells other than JM109 Competent Cells purchased from Promega, be sure to follow the appropriate transformation protocol. Select transformants on LB/ampicillin plates. For best results, do not use plates that are more than 1 month old. Note: The use of plates containing IPT and X-gal is not recommended. Vectors containing insert may produce blue colonies. Therefore, blue/white screening is not appropriate. 1. Prepare two LB/ampicillin plates for each ligation reaction and control transformation. Equilibrate the plates to room temperature prior to plating cells. 2. Remove the frozen, high-efficiency Competent Cells from 70 C storage and place in an ice bath until just thawed (about 5 minutes). Mix the cells by gently flicking the tube. Page 10 Revised 3/11

12 3. For each ligation reaction and each transformation control, carefully transfer 50µl of cells into a sterile 1.5ml microcentrifuge tube on ice. Note: In our experience, using larger (17 100mm) polypropylene tubes (e.g., Falcon Cat.# 2059) increases transformation efficiency. Tubes from some manufacturers bind DNA, thereby decreasing the colony number, and should be avoided. 4. Briefly centrifuge the tubes containing the ligation reactions to collect contents at the bottom of the tube. Add 2µl of each ligation reaction to a tube prepared in Step 3. To perform a transformation control, add 0.1ng of supercoiled plasmid DNA to one of the tubes prepared in Step 3. Note: The peneclip Vectors are supplied linearized and are not appropriate as a transformation control. 5. ently flick the tubes to mix and place them on ice for 20 minutes. 6. Heat-shock the cells for seconds in a water bath at 42 C. Do not shake. 7. Immediately return the tubes to ice for 2 minutes. 8. Add 950µl of room-temperature SOC medium to each tube. LB broth may be substituted, but the number of colonies may be lower. 9. Incubate the tubes at 37 C with shaking (approximately 150rpm) for 1.5 hours. 10. Plate 50µl of each transformation onto duplicate LB/ampicillin plates. If a higher number of colonies is desired, pellet the cells by centrifugation at 1,000 g for 10 minutes, resuspend the cells in 200µl of SOC medium and plate 50µl of cells on each of 2 plates. 11. Incubate the plates overnight (16 24 hours) at 37 C. In our experience, at least 100 colonies per plate are routinely seen when using competent cells that are cfu/µg DNA if 50µl is plated. Notes: 1. The negative control ligation reaction allows determination of the number of background colonies resulting from the eneclip Vector alone. A successful ligation reaction with insert typically yields at least 50 times more colonies than the negative control ligation reaction. The efficiency of ligation will depend upon the hairpin oligonucleotide sequence. 2. The transformation efficiency of the competent cells can be determined using the following equation: Equation for Transformation Efficiency (cfu/µg) colonies on control plate ng of supercoiled plasmid DNA plated ng µg Revised 3/11 Page 11

13 4.D. Purifying Recombinant Plasmid DNA A standard plasmid miniprep procedure can be used for screening of inserts. The miniprep process can be both laborious and time-consuming, particularly when large numbers of minipreps are required. A convenient and reliable method is the Wizard Plus SV Minipreps DNA Purification System (Cat.# A1330). Plasmid purification protocols that reduce the amount of endotoxin in the DNA preparation are preferred to minimize the toxic effects of endotoxins on the cells during transfection. 4.E. Screening for Inserts Using Pst I Digestion The peneclip Vectors contain a single Pst I site. A second Pst I site is created upon insertion of the hairpin oligonucleotides, and digestion with the restriction enzyme Pst I will yield two DNA fragments. Pst I digestion of peneclip Vectors that do not contain insert will result in linearization of the vector (see Table 1). Table 1. Sizes of Pst I DNA Fragments Produced by Digestion of the peneclip Vectors in the Absence and Presence of an Insert. Pst I Fragments of Pst I Fragments of Vector Vector Without Insert Vector With Insert 1 peneclip Basic Vector 3,402bp 2,461bp + 991bp peneclip Puromycin Vector 4,561bp 3,209bp + 1,402bp peneclip Hygromycin Vector 4,989bp 3,892bp + 1,147bp peneclip Neomycin Vector 4,758bp 3,817bp + 991bp peneclip hmfp Vector 5,267bp 4,120bp + 1,197bp 1The size of the larger Pst I fragment may vary with the size of the hairpin oligonucleotide insert. The fragments sizes given here were determined using annealed hairpin oligonucleotides with a double-stranded region of 50bp. Page 12 Revised 3/11

14 5. Transfection of peneclip Vector Constructs in an sirna Suppression Assay Once the annealed hairpin oligonucleotides are ligated to the appropriate peneclip Vector, the resulting constructs can be used for transient expression or for stable transfection. peneclip Vectors that contain a selectable marker (peneclip Neomycin, Hygromycin or Puromycin Vectors) can be used for stable expression of a pool of cells or individual clones. Transfection of DNA into human cells may be mediated by cationic lipids, calcium phosphate, DEAE-Dextran, polybrene-dmso or electroporation. 5.A. Transient Transfection of the peneclip Vector Constructs High transfection efficiency is essential for achieving substantial suppression levels using a transient transfection approach. Prior to testing the inhibition, optimize the transfection conditions for maximum efficiency in the system to be tested (see below). The optimal conditions will vary with cell type, transfection method used and the amount of DNA. When using the peneclip Basic, Puromycin, Hygromycin or Neomycin Vectors, optimization can be performed using a FP reporter such as the Monster reen Fluorescent Protein phmfp Vector (Cat.# E6421). The peneclip hmfp Vector already contains the FP reporter. The FP reporter can also be used to determine transfection efficiency for the assay. To test the effectiveness of the peneclip Vector constructs (screening various sequences for levels of inhibition), the use of a reporter, such as FP, is highly recommended. This control can be performed as a separate transfection to determine the percentage of the cell population transfected or as a cotransfection where flow cytometry can be used to sort FP-positive cells. The level of target RNA suppression in transfected cells can then be determined by taking the transfection efficiency into account. Obtaining maximum suppression requires optimizing specific assay conditions. We have observed variations in suppression efficiency as a result of the cell line, cell culture conditions, target sequence and transfection conditions. Varying the amount of transfection reagent, amount of DNA and cell density can influence transfection efficiency. Obtaining the highest transfection efficiency with low toxicity is essential for maximizing the sirna interference (suppression) effect in a transient assay. Additionally, maintaining healthy cell cultures is essential for this application. The key considerations are discussed more fully below. Cell Density (Confluence) at Transfection The recommended cell density for most cell types at transfection is approximately 30 50%; this level is lower than standard transfection experiments where cells are plated at 50 70% confluency. The optimal cell density should be determined for each cell type. Maintaining a dividing cell culture is essential because effective gene suppression requires proliferating cells. Continued proliferation and the need to passage cells should be considered when determining the number of cells to plate. Revised 3/11 Page 13

15 5.B. Cell Proliferation Successful suppression of gene expression requires actively proliferating and dividing cells, so maintaining healthy cell cultures is essential for this application. It is essential to minimize the decrease in cell growth associated with nonspecific transfection effects and to maintain cell culture under subconfluent conditions to assure rapid cell division. We recommend using the CellTiter-lo Luminescent Cell Viability Assay (Cat.# 7570) to monitor cell viability and growth. Time The optimal time after transfection for analyzing interference effects must be determined empirically by testing a range of incubation times. Typically little inhibition is seen after 24 hours, but the maximal suppression time can vary from 48 to 96 hours depending on the cells used and the experimental targets tested. Stable Transfection of the peneclip Puromycin, Hygromycin and Neomycin Vector Constructs Note: The peneclip Basic and hmfp Vectors are not suitable for stable transfection. For stable expression, antibiotic selection must be applied following transfection. Cell lines vary in the level of resistance to antibiotics, so the level of resistance of a particular cell line must be tested before attempting stable selection of the cells. A kill curve will determine the minimum concentration of the antibiotic needed to kill nontransfected cells. The antibiotic concentration for selection will vary depending on the cell type and the growth rate. In addition, cells that are confluent are more resistant to antibiotics, so it is important to keep the cells subconfluent. The typical effective ranges and lengths of time needed for selection are given in Table 2. Table 2. Typical Conditions for Selection of Stable Transfectants. Effective Time Needed peneclip Vector Antibiotic Concentration For Selection peneclip Puromycin Vector Puromycin 1 10µg/ml 2 7 days peneclip Hygromycin Vector Hygromycin 100 1,000µg/ml 3 10 days peneclip Neomycin Vector ,000µg/ml 3 14 days For example, to generate a kill curve for -418 selection, test -418 concentrations of 0, 100, 200, 400, 600, 800 and 1,000µg/ml in the media to determine the concentration that is toxic to nontransfected cells. The miminum concentration of antibiotic that kills 100% of the cells should be used in subsequent experiments. Once the effective concentration of antibiotic has been determined, transfected cells can be selected for resistance. Page 14 Revised 3/11

16 1. Following transfection, seed the cells at a low cell density. 2. Apply antibiotic to the medium at the effective concentration determined from the kill curve. 3. Prepare a control plate for all selection experiments by treating nontransfected cells with antibiotic in medium under the experimental conditions. This control plate will confirm whether the conditions of antibiotic selection were sufficiently stringent to eliminate cells not expressing the resistance gene. 4. Change the medium every 2 3 days until drug-resistant clones appear. 5. Once clones (or pools of cells) are selected, grow the cells in media containing the antibiotic at a reduced antibiotic concentration, typically 25 50% of the level used during selection. 5.C. Quantitating sirna Target ene Suppression Reduction of the targeted gene expression can be measured by 1) monitoring phenotypic changes of the cell, 2) measuring changes in mrna levels (e.g., using RT-PCR), or 3) detecting changes in protein level by immunocytochemistry or Western blot analysis (19 22). The suppression effect will vary depending on the target, cell line and experimental conditions. Controlling for nonspecific effects on other targets is very important. As a negative control, cells can be transfected with either a nonspecific or scrambled target sequence. This will show that suppression of gene expression is specific to the expression of the hairpin sirna target sequences. When suppression is determined by Western analysis, positive controls for other genes (e.g., tubulin or actin) should be included. Additional details can be found in reference 23. Using the eneclip hmfp Vector, expression of hmfp allows normalization of target gene suppression to transfection efficiency. Alternatively, the suppressive effects can be analyzed only in transfected cells by separating those cells by FACS analysis or by analyzing target gene suppression at the individual cell level. Peak excitation of hmfp occurs at 505nm, with a shoulder at 480nm, and peak emission occurs at 515nm. hmfp expression can be monitored by fluorescence microscopy using an excitation filter of 470±20nm (470/40nm) and an emission filter of 515nm (long pass). The psicheck -1 and -2 Vectors (Cat.# C8011, C8021) can also be used to measure target gene suppression. These Vectors enable the monitoring of changes in expression of a target gene fused to a reporter, Renilla luciferase, gene. In these vectors, the gene of interest is cloned into the multiple cloning region located downstream of the Renilla translational stop codon. Initiation of the RNAi process towards a gene of interest results in cleavage and subsequent degradation of the fusion mrna. Measurement of decreased Renilla luciferase activity is a convenient indicator of RNAi effect (24). Revised 3/11 Page 15

17 6. Troubleshooting Symptoms Low number or no colonies Causes and Comments Ligation reaction failed. Ligation reactions with insert typically yield at least 50 times more colonies than negative control reactions. If the number of colonies is the same as the negative control, this indicates a problem with the insert or the ligation reaction. The 2X Rapid Ligation Buffer contains ATP, which degrades during temperature fluctuations. Avoid multiple freeze-thaw cycles by making single-use aliquots of the buffer. Use a fresh vial of buffer. Incorrect oligonucleotide sequences. Oligonucleotide A must have an overhang of TCTC, and oligonucleotide B must have an overhang of CTC. See Figure 4. Improper dilution of the 2X Rapid Ligation Buffer. The Rapid Ligation Buffer is provided at a 2X concentration. Use 5µl in a 10µl reaction. Ineffective transformation or poor-quality competent cells. Perform a control transformation with supercoiled plasmid DNA to ensure that the efficiency of the competent cells is cfu/µg DNA (see Section 4.C). The peneclip Vectors are supplied linearized and are not appropriate as transformation controls. Oligonucleotides failed to anneal. Confirm oligonucleotide sequences. Repeat annealing step and use annealed oligonucleotides immediately. Poor-quality oligonucleotides. Try HPLC- purified or gel-purified oligonucleotides. Insert not present in peneclip Vector Ligation reaction failed. Ligation reactions with insert typically yield at least 50 times more colonies than negative control reactions. If the number of colonies is the same as the negative control, this indicates a problem with the insert or the ligation reaction. The 2X Rapid Ligation Buffer contains ATP, which degrades during temperature fluctuations. Avoid multiple freeze-thaw cycles by making single-use aliquots of the buffer. Use a fresh vial of buffer. Page 16 Revised 3/11

18 Symptoms Insert not present in peneclip Vector (continued) No suppression or low-level suppression of target gene Causes and Comments Incorrect oligonucleotide sequences. Oligonucleotide A must have an overhang of TCTC, and oligonucleotide B must have an overhang of CTC. See Figure 4. Ineffective sirna target sequence. Test at least 3 6 target sequences for each mrna to identify the sequences that result in the highest level of suppression. Time point not optimal. Assay cells at several time points within 2 6 days after transfection to determine the peak effect. Low transfection efficiency. Use a FP vector, such as the Monster reen Fluorescent Protein phmfp Vector (Cat.# E6421), to determine transfection efficiency. If the efficiency is low, optimize transfection conditions, as described in Section 5. Inadequate detection. If reduction of the targeted gene is analyzed by immunocytochemistry or Western blot, check for antibody specificity. Include controls (e.g., actin or tubulin) in your analysis (20). Cell growth or viability affected by specific target sequence. Transfection of the vector may affect cell proliferation when compared to nontransfected cells. We recommend monitoring cell viability and growth to account for any changes in cell number during the suppression assay. 7. References 1. Bass, B.L. (2000) Double-stranded RNA as a template for gene silencing. Cell 101, Zamore, P.D. (2001) RNA interference: Listening to the sound of silence. Nat. Struct. Biol. 8, Sharp, P.A. (2001) RNA interference enes Dev. 15, Hutvagger,. and Zamore, P.D. (2002) RNAi: Nature abhors a double strand. Curr. Opin. enet. Dev. 12, Dykxhoorn, D.M., Novina, C.D. and Sharp, P.A. (2003) Killing the messenger: Short RNAs that silence gene expression. Nat. Rev. Mol. Cell Biol. 4, Denli, A.M. and Hannon,.J. (2003) RNAi: An ever-growing puzzle. Trends Biochem. Sci. 28, Revised 3/11 Page 17

19 7. References (continued) 7. Elbashir, S.M., Lendeckel, W. and Tuschl, T. (2001) RNA interference is mediated by 21- and 22-nucleotide RNAs. enes Dev. 15, Yu, J-Y. et al. (2002) RNA interference by expression of short-interfering RNA and hairpin RNAs in mammalian cells. Proc. Natl. Acad. Sci. USA 99, Sui,. et al. (2002) A DNA vector-based RNAi technology to suppress gene expression in mammalian cells. Proc. Natl. Acad. Sci. USA 99, Brummelkamp, T.R., Bernards, R. and Agami, R. (2002) A system for stable expression of short interfering RNAs in mammalian cells. Science 296, Novarino,. et al. (2004) Involvement of the intracellular ion channel CLIC1 in microglia-mediated β-amyloid-induced neurotoxicity. J. Neurosci. 24, Cormack, B.P., Valdivia, R.H. and Falkow, S. (1996) FACS-optimized mutants of the green fluorescent protein (FP). ene 173, Sorensen, T.U. et al. (1999) Safe sorting of FP-transduced live cells for subsequent culture using a modified FACS vantage. Cytometry 37, albraith, D.W. et al. (1999) Flow cytometric analysis and FACS sorting of cells based on FP accumulation. Methods Cell. Biol. 58, Khvorova, A. et al. (2003) Functional sirnas and mirnas exhibit strand bias. Cell 115, Ui-Tei, K. et al. (2004) uidelines for the selection of highly effective sirna sequences for mammalian and chick RNA interference. Nucl. Acid Res. 32, Vidugiriene, J. et al. (2004) The use of bioluminescent reporter genes for RNAi optimization. Promega Notes 87, Elbashir, S.M. et al. (2002) Analysis of gene function in somatic mammalian cells using small interfering RNAs. Methods 26, Xia, H. et al. (2002) sirna-mediated gene silencing in vitro and in vivo. Nat. Biotech. 20, Huang, Y. et al. (2003) Erbin suppresses the MAP kinase pathway. J. Biol. Chem. 278, Kullmann, M. et al. (2002) ELAV/Hu proteins inhibit p27 translation via an IRES element in the p27 5 UTR. enes Dev. 16, Lang, V. et al. (2003) βtrcp-mediated proteolysis of NF-κB p105 requires phosphorylation of p105 series 927 and 932. Mol. Cell. Biol. 23, Editorial (2003) Whither RNAi? Nature Cell Biol. 5, Kumar, R. et al. (2003) High-throughput selection of effective RNAi probes for gene silencing. enome Res. 13, Page 18 Revised 3/11

20 A 8. Appendix 8.A. peneclip Vector Maps and Sequence Reference Points The peneclip Vectors have overhangs of AA and CA. The listed locations of the vector features and restriction enzyme sites are in relation to base 1 (the T7 RNA polymerase transcription initiation site) and are numbered as though the overhangs had been filled in and then ligated. Amp r linearized peneclip Basic Vector (3,402bp) T7 U1 promoter 1 start A CA Pst I 1432 SP MA Figure 5. peneclip Basic Vector circle map and sequence reference points. peneclip Basic Vector Sequence Reference Points T7 RNA polymerase transcription initiation site 1 U1 promoter (human 392 to +1) bp spacer U1 termination sequence SP6 RNA polymerase promoter ( 17 to +3) SP6 RNA polymerase promoter binding site Binding site of puc/m13 Reverse Sequencing Primer β-lactamase (Amp r ) coding region Binding site of puc/m13 Forward Sequencing Primer T7 RNA polymerase promoter ( 17 to +3) Revised 3/11 Page 19

21 A Amp r linearized peneclip Puromycin Vector (4,561bp) T7 U1 promoter 1 start A Puromycin CA Pst I Synthetic 1843 Polyadenylation Signal SV40 Enhancer/ Early Promoter SP MA Figure 6. peneclip Puromycin Vector circle map and sequence reference points. peneclip Puromycin Vector Sequence Reference Points T7 RNA polymerase transcription initiation site 1 U1 promoter (human 392 to +1) bp spacer U1 termination sequence SP6 RNA polymerase promoter ( 17 to +3) SP6 RNA polymerase promoter binding site Binding site of puc/m13 Reverse Sequencing Primer SV40 enhancer and early promoter SV40 minimum origin of replication Puromycin-N-acetyltransferase coding region Synthetic polyadenylation signal β-lactamase (Amp r ) coding region Binding site of puc/m13 Forward Sequencing Primer T7 RNA polymerase promoter ( 17 to +3) Page 20 Revised 3/11

22 Amp r linearized peneclip Hygromycin Vector (4,989bp) T7 A A U1 promoter 1 start Hygromycin CA Synthetic Polyadenylation Signal Pst I 1588 SV40 Enhancer/ Early Promoter SP MA Figure 7. peneclip Hygromycin Vector circle map and sequence reference points. peneclip Hygromycin Vector Sequence Reference Points T7 RNA polymerase transcription initiation site 1 U1 promoter (human 392 to +1) bp spacer U1 termination sequence SP6 RNA polymerase promoter ( 17 to +3) SP6 RNA polymerase promoter binding site Binding site of puc/m13 Reverse Sequencing Primer SV40 enhancer and early promoter SV40 minimum origin of replication Hygromycin phosphotransferase coding region Synthetic polyadenylation signal β-lactamase (Amp r ) coding region Binding site of puc/m13 Forward Sequencing Primer T7 RNA polymerase promoter ( 17 to +3) Revised 3/11 Page 21

23 A Amp r linearized peneclip Neomycin Vector (4,758bp) T7 U1 promoter 1 start A Neomycin CA Synthetic Polyadenylation Signal Pst I 1432 SV40 Enhancer/ Early Promoter SP MA Figure 8. peneclip Neomycin Vector circle map and sequence reference points. peneclip Neomycin Vector Sequence Reference Points T7 RNA polymerase transcription initiation site 1 U1 promoter (human 392 to +1) bp spacer U1 termination sequence SP6 RNA polymerase promoter ( 17 to +3) SP6 RNA polymerase promoter binding site Binding site of puc/m13 Reverse Sequencing Primer SV40 enhancer and early promoter SV40 minimum origin of replication Neomycin phosphotransferase coding region Synthetic polyadenylation signal β-lactamase (Amp r ) coding region Binding site of puc/m13 Forward Sequencing Primer T7 RNA polymerase promoter ( 17 to +3) Page 22 Revised 3/11

24 A T7 1 start Amp r linearized peneclip hmfp Vector (5,267bp) A U1 promoter Intron hmfp Pst I 1638 CMV Promoter CA SP MA Figure 9. peneclip hmfp Vector circle map and sequence reference points. peneclip hmfp Vector Sequence Reference Points T7 RNA polymerase transcription initiation site 1 U1 promoter (human 392 to +1) bp spacer U1 termination sequence SP6 RNA polymerase promoter ( 17 to +3) SP6 RNA polymerase promoter binding site Binding site of puc/m13 Reverse Sequencing Primer CMV enhancer/promoter Chimeric intron hmfp open reading frame Synthetic polyadenylation signal β-lactamase (Amp r ) coding region Binding site of puc/m13 Forward Sequencing Primer T7 RNA polymerase promoter ( 17 to +3) Revised 3/11 Page 23

25 8.B. peneclip Basic Vector Restriction Enzyme Sites The peneclip Vectors have overhangs of AA and CA. The listed locations of the restriction enzyme sites are in relation to base 1 (the T7 RNA polymerase transcription initiation site). The following restriction enzyme tables were constructed using DNASTAR sequence analysis software. Please note that we have not verified this information by restriction digestion with each enzyme listed. The location given specifies the 3 end of the cut DNA (the base to the left of the cut site). For more information on the cut sites of these enzymes, or if you identify a discrepancy, please contact your local Promega Branch or Distributor. In the U.S., contact Promega Technical Services at Vector sequences are also available in the enbank database (enbank /EMBL Accession Number AY744385) and on the Internet at: Table 3. Restriction Enzymes That Cut the peneclip Basic Vector 1 5 Times. Aat II Acc I 2 29, 459 Acy I 2 109, 2334 Afl III 2 502, 905 Alw26 I , 2634 Alw44 I , 2464 AlwN I 2 242, 1321 Apa I 1 14 AspH I 4 497, 1223, 2383, 2468 Ava I 2 357, 487 Ava II 4 50, 305, 1935, 2157 BamH I 1 40 Ban I 3 649, 1745, 3028 Ban II 4 14, 358, 497, 3066 Bgl I , 3235 Bgl II Bsa I BsaA I BsaH I 2 109, 2334 Bsp120 I 1 10 BspH I , 2632 BssS I , 2461 BstX I BstZ I Bsu36 I 1 46 Cfr10 I , 3092 Cla I Dde I 5 46, 1180, 1588, 1754, 2294 Dra I , 1682, 2374 Dra III Drd I , 2946 *A second Pst I site is created upon ligation of an insert. Eae I 4 468, 744, 2185, 3372 Eag I Ear I 3 789, 2592, 3280 EclHK I Eco52 I Eco81 I 1 46 EcoICR I EcoR I 1 34 EcoR V 1 18 Fok I 5 522, 1763, 1944, 2231, 3318 Fsp I , 3242 Hae II 4 783, 1153, 3142, 3150 Hga I 5 84, 1016, 1593, 2323, 3208 Hinc II 2 30, 483 Hind II 2 30, 483 Hpa I Hsp92 I 2 109, 2334 Mae I 5 23, 1400, 1652, 1987, 3142 Mlu I Nae I Nci I , 1980, 2331 NgoM IV Not I Nsi I Nsp I PaeR7 I Ppu10 I Pst I* Page 24 Revised 3/11

26 Table 3. Restriction Enzymes That Cut the peneclip Basic Vector 1 5 Times (continued). Pvu I , 3263 Pvu II 3 333, 729, 3292 Rsa I Sac I Sal I 1 28 Sca I Sin I 4 50, 305, 1935, 2157 Ssp I , 2783 Sty I Tfi I 3 325, 740, 880 Vsp I 3 676, 735, 1969 Xba I 1 22 Xho I Xmn I 2 277, 2396 Table 4. Restriction Enzymes That Do Not Cut the peneclip Basic Vector. Acc B7 I Acc III Acc65 I Afl II Age I Asc I Avr II Bal I Bbe I BbrP I Bbs I Bbu I Bcl I Blp I Bpu1102 I BsaB I BsaM I Bsm I BspM I Bsr I BssH II Bst1107 I Bst98 I BstE II Csp I Csp45 I Dra II Dsa I Eco47 III Eco72 I EcoN I Ehe I Fse I Hind III I-Ppo I Kas I Kpn I Nar I Nco I Nde I Nhe I Nru I Pac I PflM I PinA I Pme I Pml I PpuM I PshA I Psp5 II PspA I Rsr II Sac II Sfi I Sgf I SgrA I Sma I SnaB I Spe I Sph I Spl I Srf I Sse8387 I Stu I Swa I Tth111 I Xcm I Xma I Table 5. Restriction Enzymes That Cut the peneclip Basic Vector 6 or More Times. Aci I Alu I Bbv I BsaO I BsaJ I Bsp1286 I Bsr I BsrS I Bst71 I BstO I BstU I Cfo I Dpn I Dpn II Fnu4H I Hae III Hha I Hinf I Hpa II Hph I Hsp92 II Mae II Mae III Mbo I Mbo II Mnl I Mse I Msp I MspA1 I Nde II Nla III Nla IV Ple I Sau3A I Sau96 I ScrF I SfaN I Taq I Tru9 I Xho II Note: The enzymes listed in boldface type are available from Promega. Revised 3/11 Page 25

27 8.C. peneclip Puromycin Vector Restriction Enzyme Sites The peneclip Vectors have overhangs of AA and CA. The listed locations of the restriction enzyme sites are in relation to base 1 (the T7 RNA polymerase transcription initiation site). The following restriction enzyme tables were constructed using DNASTAR sequence analysis software. Please note that we have not verified this information by restriction digestion with each enzyme listed. The location given specifies the 3 end of the cut DNA (the base to the left of the cut site). For more information on the cut sites of these enzymes, or if you identify a discrepancy, please contact your local Promega Branch or Distributor. In the U.S., contact Promega Technical Services at Vector sequences are also available in the enbank database (enbank /EMBL Accession Number AY745747) and on the Internet at: Table 6. Restriction Enzymes That Cut the peneclip Puromycin Vector 1 5 Times. Aat II 3 112, Acc I 3 29, 459, 1348 Acc65 I Afl III 2 502, 2063 Age I Alw26 I , 3017, 3793 Alw44 I , 3623 AlwN I 2 242, 2479 Apa I 1 14 AspH I 5 497, 1672, 2381, 3542, 3627 Ava I 4 357, 487, 1288, 1849 Avr II Bal I BamH I 2 40, 1844 Bbe I , 1581 Bbu I 2 943, 1015 Bgl I , 1455, 1586, 3076, 4394 Bgl II Bsa I , 3017 BsaA I Bsp120 I 1 10 BspH I , 3791 BssH II BssS I , 3620 BstE II BstX I BstZ I 2 468, 1687 Bsu36 I 1 46 Cfr10 I , 1868, 3036, 4251 Cla I Csp I Csp45 I Dra I , 2822, 2841, 3533 Dra III , 4150 Drd I , 4105 Dsa I 4 806, 1102, 1255, 1450 Eag I 2 468, 1687 Ear I 4 789, 1398, 3751, 4439 EclHK I Eco52 I 2 468, 1687 Eco81 I 1 46 EcoICR I EcoR I 1 34 EcoR V 1 18 Ehe I , 1579 Fsp I 3 799, 3178, 4401 Hinc II 3 30, 483, 1349 Hind II 3 30, 483, 1349 Hind III , 1942 Hpa I Kas I , 1577 Kpn I Mlu I Nae I Nar I , 1578 Nco I 2 806, 1102 NgoM IV Nhe I Not I Nsi I 3 515, 945, 1017 Page 26 Revised 3/11

28 Table 6. Restriction Enzymes That Cut the peneclip Puromycin Vector 1 5 Times (continued). Nsp I 3 943, 1015, 2067 PaeR7 I 2 487, 1849 PinA I Pme I Ppu10 I 3 511, 941, 1013 PspA I Pst I* Pvu I , 4422 Pvu II 4 333, 729, 871, 4451 Rsa I 4 847, 1248, 1297, 3436 Rsr II Sac I Sac II Sal I 2 28, 1347 Sca I *A second Pst I site is created upon ligation of an insert. Sfi I Sma I Sph I 2 943, 1015 Spl I Ssp I , 3942 Stu I , 1570 Sty I 5 120, 806, 1102, 1195, 1591 Tfi I 4 325, 740, 1217, 2038 Tth111 I Vsp I 3 676, 735, 3128 Xba I 2 22, 1862 Xho I 2 487, 1849 Xma I Xmn I 2 277, Table 7. Restriction Enzymes that Do Not Cut the peneclip Puromycin Vector. AccB7 I Acc III Afl II Asc I BbrP I Bbs I Bcl I Blp I Bpu1102 I BsaB I BsaM I Bsm I BspM I Bsr I Bst1107 I Bst98 I Dra II Eco47 III Eco72 I EcoN I Fse I I-Ppo I Nde I Nru I Pac I PflM I Pml I PpuM I PshA I Psp5 II Sgf I SgrA I SnaB I Spe I Srf I Sse8387 I Swa I Xcm I Table 8. Restriction Enzymes that Cut the peneclip Puromycin Vector 6 or More Times. Aci I Acy I Alu I Ava II Ban I Ban II Bbv I BsaO I BsaH I BsaJ I Bsp1286 I Bsr I BsrS I Bst71 I BstO I BstU I Cfo I Dde I Dpn I Dpn II Eae I Fnu4H I Fok I Hae II Hae III Hga I Hha I Hinf I Hpa II Hph I Hsp92 I Hsp92 II Mae I Mae II Mae III Mbo I Mbo II Mnl I Mse I Msp I MspA1 I Nci I Nde II Nla III Nla IV Ple I Sau3A I Sau96 I ScrF I SfaN I Note: The enzymes listed in boldface type are available from Promega. Sin I Taq I Tru9 I Xho II Revised 3/11 Page 27

29 8.D. peneclip Hygromycin Vector Restriction Enzyme Sites The peneclip Vectors have overhangs of AA and CA. The listed locations of the restriction enzyme sites are in relation to base 1 (the T7 RNA polymerase transcription initiation site) and are numbered as though the overhangs had been filled in and then ligated. The following restriction enzyme tables were constructed using DNASTAR sequence analysis software. Please note that we have not verified this information by restriction digestion with each enzyme listed. The location given specifies the 3 end of the cut DNA (the base to the left of the cut site). For more information on the cut sites of these enzymes, or if you identify a discrepancy, please contact your local Promega Branch or Distributor. In the U.S., contact Promega Technical Services at Vector sequences are also available in the enbank database (enbank /EMBL Accession Number AY745745) and on the Internet at: Table 9. Restriction Enzymes That Cut the peneclip Hygromycin Vector 1 5 Times. Aat II 2 112, 1278 Acc I 2 29, 459 Acc III , 2009, 2145 Acc65 I Acy I 4 109, 1275, 2243, 3921 Afl III 2 502, 2491 Age I Alw26 I , 4221 Alw44 I , 1833, 2805, 4051 AlwN I 2 242, 2907 Apa I 1 14 Ava I 4 357, 487, 1240, 2277 Avr II BamH I 1 40 Ban I 5 649, 845, 1825, 3332, 4615 Ban II 4 14, 358, 497, 4653 Bbu I 2 943, 1015 Bgl I , 3504, 4822 Bgl II Bsa I BsaA I BsaH I 4 109, 1275, 2243, 3921 Bsp120 I 1 10 BspH I , 4219 BspM I BssS I , 1830, 2664, 4048 BstX I BstZ I 4 468, 1456, 1621, 2191 Bsu36 I 1 46 Cfr10 I , 2296, 3464, 4679 Cla I Csp I Csp45 I Dra I , 3250, 3269, 3961 Dra III , 1832, 4578 Drd I , 2136, 2599, 4533 Dsa I 5 806, 1102, 1603, 1959, 2028 Eag I 4 468, 1456, 1621, 2191 Ear I 3 789, 4179, 4867 EclHK I , 3384 Eco52 I 4 468, 1456, 1621, 2191 Eco81 I 1 46 EcoICR I EcoR I 2 34, 1494 EcoR V 1 18 Fsp I 3 799, 3606, 4829 Hae II 4 783, 2739, 4729, 4737 Hinc II 3 30, 483, 2087 Hind II 3 30, 483, 2087 Hind III , 2370 Hpa I Hsp92 I 4 109, 1275, 2243, 3921 Kpn I Mlu I Nae I Nco I 3 806, 1102, 1603 Nde I NgoM IV Nhe I Not I Nsi I 3 515, 945, 1017 Nsp I 3 943, 1015, 2495 Page 28 Revised 3/11

30 Table 9. Restriction Enzymes That Cut the peneclip Hygromycin Vector 1 5 Times (continued). PaeR7 I 2 487, 2277 PinA I Pme I Ppu10 I 3 511, 941, 1013 PshA I PspA I Pst I* Pvu I , 1615, 3754, 4850 Pvu II 4 333, 729, 871, 4879 Rsa I 4 847, 2168, 2221, 3864 Rsr II Sac I Sac II Sal I 1 28 Sca I , *A second Pst I site is created upon ligation of an insert. Table 10. Restriction Enzymes that Do Not Cut the peneclip Hygromycin Vector. AccB7 I Afl II Asc I Bal I Bbe I BbrP I Bbs I Sfi I Sgf I , 1615 Sma I Sph I 2 943, 1015 Srf I Ssp I , 4370 Stu I Sty I 5 120, 806, 1102, 1195,1603 Tth111 I Vsp I 3 676, 735, 3556 Xba I 2 22, 2290 Xho I 2 487, 2277 Xma I Xmn I 2 277, 3983 Table 11. Restriction Enzymes that Cut the peneclip Hygromycin Vector 6 or More Times. Aci I Alu I Ava II Bbv I BsaO I BsaJ I Bsp1286 I Bsr I BsrS I Bcl I Blp I Bpu1102 I BsaB I BsaM I Bsm I Bsr I Bst71 I BstO I BstU I Cfo I Dde I Dpn I Dpn II Eae I Fnu4H I BssH II Bst1107 I Bst98 I BstE II Dra II Eco47 III Eco72 I Fok I Hae III Hga I Hha I Hinf I Hpa II Hph I Hsp92 II Mae I EcoN I Ehe I Fse I I-Ppo I Kas I Nar I Nru I Mae II Mae III Mbo I Mbo II Mnl I Mse I Msp I MspA1 I Nci I Pac I PflM I Pml I PpuM I Psp5 II SgrA I SnaB I Nde II Nla III Nla IV Ple I Sau3A I Sau96 I ScrF I SfaN I Sin I Note: The enzymes listed in boldface type are available from Promega. Spe I Spl I Sse8387 I Swa I Xcm I Taq I Tfi I Tru9 I Xho II Revised 3/11 Page 29