Bioinformatics for Cell Biologists

Size: px
Start display at page:

Download "Bioinformatics for Cell Biologists"

Transcription

1 Bioinformatics for Cell Biologists Rickard Sandberg Karolinska Institutet May 2013

2 OUTLINE INTRODUCTION Introduce yourselves HISTORY MODERN What is bioinformatics today? COURSE ONLINE LEARNING OPPORTUNITIES

3 INTRODUCE YOURSELVES 1-minute summary Project (1 sentence summary) Bioinformatics resources you are currently using Expectations of the course

4 THE ORIGIN Bioinformatics as a subject was born when we obtained methods to read DNA and protein sequences When the number of protein and DNA sequences made manual sequence comparisons and alignments impractical

5 MARGARET DAYHOFF Margaret Dayhoff, Started the Atlas of Protein Sequence and Structure (1969) Started the Protein Identification Resource (1972) to search for related sequences (homology) to infer evolutionary relationships (phylogeny) substition matrix, 1-letter amino acid code, point-accepted-mutations (PAM)

6 MILESTONES IN ALGORITHMIC DEVELOPMENT Algorithmic development in sequence comparisons Needleman-Wunch algorithm (1970) Smith-Waterman algorithm for alignment (1981) FASTP algorithm by Lipman and Pearson (1985) FASTA algorithm by Pearson, Lipman (1988) BLAST program implemented (Altshul et al.) (1990) BLAT program by Jim Kent (2000s)

7 DATABASES Institutes and centers for bioinformatics National Center for Biotechnological Information, NCBI (1988) European Bioinformatics Institute, EBI (1992) Famous databases established Swiss-Prot database created by University of Geneva and EMBL (1986) PRINTS database of protein motifs (Attwood and Beck) 1994 GenBank by NCBI (1982), EMBL-Bank (1980)

8 GENBANK (NCBI) SEQUENCE GROWTH

9 DATABASES CONTAINING INFORMATION OF HUMAN SEQUENCE VARIATION

10 COMPARATIVE GENOMICS

11 METAGENOMICS

12 COMMON PATTERN TO ALL THESE DATA

13 DEFINITION Computational methods for the anaylses of biological processes

14 IMPORTANT ASPECTS OF BIOINFORMATICS Tools that drive new biological discoveries Extends experiments one single genes - allows for generalization Have changed how we make experiments Storage, indexing, retrieval, comparison and visualization of biological data

15 BIOINFORMATICS-BASED DISCOVERIES Comparative genomics was imperative in identifying the microrna:rna interaction rules

16 GENOME-WIDE MINDSET Genomics are changing the way we ask questions in biology

17 When graduate students approach me these days about what is an interesting area to go into if you want to make a major contribution to biomedical research, the first thing out of my mouth is bioinformatics we are woefully short in terms of having a critical mass of people who understand both biology and computational approaches Francis Collins, director of the National Human Genome Research Institute

18 In the future, use of biological information collected in repositories, will play an ever increasingly important role in biology. European Molecular Biology Organization, EMBO, is considering information biology as one of the cornerstones of modern/future biology!

19 PROGRAM Bioinformatics for Cell Biologists May 2013 Mon 13th Tue 14th Wed 15th Thu 16th Fri 17th 9 am Introduction Alignments Gene expression analyses Genome-wide methods to Preparation time for :15 Rickard S. Åsa B. Rickard S. study translational regulation individual presentations :30 Ola Larsson, CCK :45 10 am Introduction Protein bioinformatics Network analyses of gene Statistics for Genomic Examination :15 Rickard S. Åsa B. expression data Studies presentations :30 Erik Fredlund, MTC Rickard S. (7+3 min per person) :45 Rickard, Åsa och Daniel 11 am Bioinformatics Phylogeny Next-gen bioinformatics ChIP-Seq data analyses Examination :15 Overview Lars Arvestad, SciLife Rickard S. Mikael Huss, SciLife presentations :30 Rickard S. (7+3 min per person) :45 Rickard, Åsa och Daniel 12 PM :15 L U N C H L U N C H L U N C H L U N C H L U N C H :30 :45 1 PM Computer lab 1. Computer lab 2. Computer lab 3. Computer lab 4. Examination :15 Genomic resources Alignments, Protein Gene expression with ChIP-Seq analyses in Galaxy presentations :30 bioinformatics microarrays and RNA-Seq How to use public (7+3 min per person) :45 repositories Rickard, Åsa och Daniel 2 PM Examination :15 Rickard Åsa och Daniel Rickard och Daniel Rickard och Daniel presentations :30 (7+3 min per person) :45 Rickard, Åsa och Daniel 3 PM :15 :30 :45 4 PM :15 :30 :45 5 PM Room A216, CMB, Berzelius väg 35 Enter, Computer lab, Utopia, Berzelius (close to Restaurant Jöns Jacob and KI library)

20 PRACTICALS All lectures will be in room A216 Code to enter the doors: 2000 All computer labs in Utopia Examination in A216 (powerpoint or white board)

21 EXAMINATION Methods workshop Recieve a Nature Biotechnology methods primer Task: present the method for the rest of the class 10 min (7+3) individual presentations Examiners: Me, Asa and Daniel Friday

22 TYPES OF BIOINFORMATIC ANALYSES Use bioinformatics resources online (tools and db) Use bioinformatics software environments (e.g. R) Develop new tools to address new questions (e.g. python, perl)

23 ONLINE COURSES OVERVIEW

24 I NTRODUCTION COURSERA H ISTORY M ODERN C OURSE O NLINE L EARNING O PPORTUNITIES

25 GALAXY

26 ROSALIND

27 SOFTWARE CARPENTRY

28 COFFEE Questions?

Bioinformatics for Cell Biologists

Bioinformatics for Cell Biologists Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena

More information

ELE4120 Bioinformatics. Tutorial 5

ELE4120 Bioinformatics. Tutorial 5 ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar

More information

CS 177 Introduction to Bioinformatics

CS 177 Introduction to Bioinformatics CS 177 to Dr. Tom Wilke Department of Microbiology and Tropical Medicine e-mail: mtmtxw@gwumc.edu Tel.: 202 994 3635 Prof. Rahul Simha? School of Engineering and Applied Science (SEAS) e-mail: simha@seas.gwu.edu

More information

Practical Bioinformatics for Biologists (BIOS 441/641)

Practical Bioinformatics for Biologists (BIOS 441/641) Practical Bioinformatics for Biologists (BIOS 441/641) - Course overview Yanbin Yin MO444 1 Room and computer access Room entry code: 2159 Computer access: user poduser 2 Compared to BIOS 443/643 and 646

More information

Two Mark question and Answers

Two Mark question and Answers 1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What

More information

Comparative Bioinformatics. BSCI348S Fall 2003 Midterm 1

Comparative Bioinformatics. BSCI348S Fall 2003 Midterm 1 BSCI348S Fall 2003 Midterm 1 Multiple Choice: select the single best answer to the question or completion of the phrase. (5 points each) 1. The field of bioinformatics a. uses biomimetic algorithms to

More information

Types of Databases - By Scope

Types of Databases - By Scope Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

Big picture and history

Big picture and history Big picture and history (and Computational Biology) CS-5700 / BIO-5323 Outline 1 2 3 4 Outline 1 2 3 4 First to be databased were proteins The development of protein- s (Sanger and Tuppy 1951) led to the

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map

More information

Klinisk kemisk diagnostik BIOINFORMATICS

Klinisk kemisk diagnostik BIOINFORMATICS Klinisk kemisk diagnostik - 2017 BIOINFORMATICS What is bioinformatics? Bioinformatics: Research, development, or application of computational tools and approaches for expanding the use of biological,

More information

Practical Bioinformatics for Biologists (BIOS493/700)

Practical Bioinformatics for Biologists (BIOS493/700) Practical Bioinformatics for Biologists (BIOS493/700) - Course overview Yanbin Yin Spring 2013 MO444 1 BIOS 643 and 646 Minimum theoretical intro A LOT of practical applications Goal: enhance the use of

More information

Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson

Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Dortmund, 16.-20.07.2007 Lectures: Sven Rahmann Exercises: Udo Feldkamp, Michael Wurst 1 Goals of this course Learn about Software tools Databases Methods (Algorithms) in

More information

MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305

MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305 MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305 UNIT-1 MARINE GENOMICS AND PROTEOMICS 1. Define genomics? 2. Scope and functional genomics? 3. What is Genetics? 4. Define functional genomics? 5. What

More information

GNET 744 Biological Sequence Analysis, Protein Structure and Genome-Wide Data

GNET 744 Biological Sequence Analysis, Protein Structure and Genome-Wide Data GNET 744 Biological Sequence Analysis, Protein Structure and Genome-Wide Data This course provides an introduction to basic protein structure/function analyses, sequencing informatics and macromolecular

More information

Scoring Alignments. Genome 373 Genomic Informatics Elhanan Borenstein

Scoring Alignments. Genome 373 Genomic Informatics Elhanan Borenstein Scoring Alignments Genome 373 Genomic Informatics Elhanan Borenstein A quick review Course logistics Genomes (so many genomes) The computational bottleneck Python: Programs, input and output Number and

More information

Bioinformatics for Proteomics. Ann Loraine

Bioinformatics for Proteomics. Ann Loraine Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data

More information

Sequence Based Function Annotation

Sequence Based Function Annotation Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological

More information

Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology

Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Bioinformatics Model Answers Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Page 1 of 15 Previous years questions asked. 1. Describe the software used in bioinformatics 2. Name four

More information

Genetics and Bioinformatics

Genetics and Bioinformatics Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases.

What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases. What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases. Bioinformatics is the marriage of molecular biology with computer

More information

G4120: Introduction to Computational Biology

G4120: Introduction to Computational Biology G4120: Introduction to Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Lecture 3 February 13, 2003 Copyright 2003 Oliver Jovanovic, All Rights Reserved. Bioinformatics

More information

Challenging algorithms in bioinformatics

Challenging algorithms in bioinformatics Challenging algorithms in bioinformatics 11 October 2018 Torbjørn Rognes Department of Informatics, UiO torognes@ifi.uio.no What is bioinformatics? Definition: Bioinformatics is the development and use

More information

Single alignment: FASTA. 17 march 2017

Single alignment: FASTA. 17 march 2017 Single alignment: FASTA 17 march 2017 FASTA is a DNA and protein sequence alignment software package first described (as FASTP) by David J. Lipman and William R. Pearson in 1985.[1] FASTA is pronounced

More information

What is Bioinformatics?

What is Bioinformatics? What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is

More information

CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools

CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools CAP 5510: Introduction to Bioinformatics : Bioinformatics Tools ECS 254A / EC 2474; Phone x3748; Email: giri@cis.fiu.edu My Homepage: http://www.cs.fiu.edu/~giri http://www.cs.fiu.edu/~giri/teach/bioinfs15.html

More information

SECTION ONE Introduction and Biological Databases

SECTION ONE Introduction and Biological Databases SECTION ONE Introduction and Biological Databases CHAPTER ONE Introduction Quantitation and quantitative tools are indispensable in modern biology. Most biological research involves application of some

More information

ESSENTIAL BIOINFORMATICS

ESSENTIAL BIOINFORMATICS ESSENTIAL BIOINFORMATICS Essential Bioinformatics is a concise yet comprehensive textbook of bioinformatics that provides a broad introduction to the entire field. Written specifically for a life science

More information

BIMM 143: Introduction to Bioinformatics (Winter 2018)

BIMM 143: Introduction to Bioinformatics (Winter 2018) BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST

More information

Textbook Reading Guidelines

Textbook Reading Guidelines Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: May 1, 2009 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science

More information

RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR

RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR MB 401: RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR Objectives: The overall aim of the course is to deepen knowledge regarding basic concepts of Biostatistics, the research process in occupational therapy

More information

Bioinformatics Databases

Bioinformatics Databases Bioinformatics Databases Dr. Taysir Hassan Abdel Hamid Lecturer, Information Systems Department Faculty of Computer and Information Assiut University taysirhs@aun.edu.eg taysir_soliman@hotmail.com Agenda

More information

BIOL 274 Introduction to Bioinformatics Fall 2016

BIOL 274 Introduction to Bioinformatics Fall 2016 Instructor: Eric S. Ho (hoe@lafayette.edu) Office: Kunkel 13 Office hours: TTh 2-4 pm Lecture: MWF 11:00-11:50 am, Venue: Kunkel 117 Lab: M/W 1:10-4:00 pm, Venue: Kunkel 313B TAs: Amy Boles (bolesa@lafayette.edu),

More information

Introduction to Bioinformatics for Medical Research. Gideon Greenspan TA: Oleg Rokhlenko. Lecture 1

Introduction to Bioinformatics for Medical Research. Gideon Greenspan TA: Oleg Rokhlenko. Lecture 1 Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il TA: Oleg Rokhlenko Lecture 1 Introduction to Bioinformatics Introduction to Bioinformatics What is Bioinformatics?

More information

Introduction and Public Sequence Databases. BME 110/BIOL 181 CompBio Tools

Introduction and Public Sequence Databases. BME 110/BIOL 181 CompBio Tools Introduction and Public Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 29, 2011 Course Syllabus: Admin http://www.soe.ucsc.edu/classes/bme110/spring11 Reading: Chapters 1, 2 (pp.29-56),

More information

Sequence Databases and database scanning

Sequence Databases and database scanning Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases.

More information

BGGN 213: Foundations of Bioinformatics (Fall 2017)

BGGN 213: Foundations of Bioinformatics (Fall 2017) BGGN 213: Foundations of Bioinformatics (Fall 2017) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bggn213_f17/ DRAFT: 2017-08-10 (15:02:30 PDT on

More information

Basic Local Alignment Search Tool

Basic Local Alignment Search Tool 14.06.2010 Table of contents 1 History History 2 global local 3 Score functions Score matrices 4 5 Comparison to FASTA References of BLAST History the program was designed by Stephen W. Altschul, Warren

More information

Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University

Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned

More information

CAP 5510/CGS 5166: Bioinformatics & Bioinformatic Tools GIRI NARASIMHAN, SCIS, FIU

CAP 5510/CGS 5166: Bioinformatics & Bioinformatic Tools GIRI NARASIMHAN, SCIS, FIU CAP 5510/CGS 5166: Bioinformatics & Bioinformatic Tools GIRI NARASIMHAN, SCIS, FIU Three major public DNA databases!2! GenBank NCBI (Natl Center for Biotechnology Information) www.ncbi.nlm.nih.gov! EMBL

More information

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005 Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

Introduction. CS482/682 Computational Techniques in Biological Sequence Analysis

Introduction. CS482/682 Computational Techniques in Biological Sequence Analysis Introduction CS482/682 Computational Techniques in Biological Sequence Analysis Outline Course logistics A few example problems Course staff Instructor: Bin Ma (DC 3345, http://www.cs.uwaterloo.ca/~binma)

More information

Gene Identification in silico

Gene Identification in silico Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction

More information

ALGORITHMS IN BIO INFORMATICS. Chapman & Hall/CRC Mathematical and Computational Biology Series A PRACTICAL INTRODUCTION. CRC Press WING-KIN SUNG

ALGORITHMS IN BIO INFORMATICS. Chapman & Hall/CRC Mathematical and Computational Biology Series A PRACTICAL INTRODUCTION. CRC Press WING-KIN SUNG Chapman & Hall/CRC Mathematical and Computational Biology Series ALGORITHMS IN BIO INFORMATICS A PRACTICAL INTRODUCTION WING-KIN SUNG CRC Press Taylor & Francis Group Boca Raton London New York CRC Press

More information

CAP 5510/CGS 5166: Bioinformatics & Bioinformatic Tools GIRI NARASIMHAN, SCIS, FIU

CAP 5510/CGS 5166: Bioinformatics & Bioinformatic Tools GIRI NARASIMHAN, SCIS, FIU CAP 5510/CGS 5166: Bioinformatics & Bioinformatic Tools GIRI NARASIMHAN, SCIS, FIU !2 Sequence Alignment! Global: Needleman-Wunsch-Sellers (1970).! Local: Smith-Waterman (1981) Useful when commonality

More information

BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP

BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP Jasper Decuyper BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP MB&C2017 Workshop Bioinformatics for dummies 2 INTRODUCTION Imagine your workspace without the computers Both in research laboratories and in

More information

Chapter 2: Access to Information

Chapter 2: Access to Information Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI

More information

Protein Bioinformatics Part I: Access to information

Protein Bioinformatics Part I: Access to information Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures

More information

NCBI web resources I: databases and Entrez

NCBI web resources I: databases and Entrez NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table

More information

COMPUTER RESOURCES II:

COMPUTER RESOURCES II: COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer

More information

Outline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases

Outline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases Chapter 7: Similarity searches on sequence databases All science is either physics or stamp collection. Ernest Rutherford Outline Why is similarity important BLAST Protein and DNA Interpreting BLAST Individualizing

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional

More information

The String Alignment Problem. Comparative Sequence Sizes. The String Alignment Problem. The String Alignment Problem.

The String Alignment Problem. Comparative Sequence Sizes. The String Alignment Problem. The String Alignment Problem. Dec-82 Oct-84 Aug-86 Jun-88 Apr-90 Feb-92 Nov-93 Sep-95 Jul-97 May-99 Mar-01 Jan-03 Nov-04 Sep-06 Jul-08 May-10 Mar-12 Growth of GenBank 160,000,000,000 180,000,000 Introduction to Bioinformatics Iosif

More information

Imaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized

Imaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized 1 2 3 Imaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized medicine, risk assessment etc Public Health Bio

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Changhui (Charles) Yan Old Main 401 F http://www.cs.usu.edu www.cs.usu.edu/~cyan 1 How Old Is The Discipline? "The term bioinformatics is a relatively recent invention, not

More information

Introduction to EMBL-EBI.

Introduction to EMBL-EBI. Introduction to EMBL-EBI www.ebi.ac.uk What is EMBL-EBI? Part of EMBL Austria, Belgium, Croatia, Denmark, Finland, France, Germany, Greece, Iceland, Ireland, Israel, Italy, Luxembourg, the Netherlands,

More information

FACULTY OF LIFE SCIENCES

FACULTY OF LIFE SCIENCES FACULTY OF LIFE SCIENCES SYLLABUS FOR Interdisciplinary Course Biotechnology (UG & PG) (Under Credit Based Continuous Evaluation Grading System) Examinations: 2015-16 GURU NANAK DEV UNIVERSITY AMRITSAR

More information

BIOINFORMATICS AND FUNCTIONAL GENOMICS

BIOINFORMATICS AND FUNCTIONAL GENOMICS BIOINFORMATICS AND FUNCTIONAL GENOMICS third edition Jonathan Pevsner Bioinformatics and Functional Genomics Bioinformatics and Functional Genomics Third Edition Jonathan Pevsner Department of Neurology,

More information

Annotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station

Annotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station Annotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station 1 Library preparation Sequencing Hypothesis testing Bioinformatics 2 Why annotate?

More information

Chimp Sequence Annotation: Region 2_3

Chimp Sequence Annotation: Region 2_3 Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker

More information

The University of California, Santa Cruz (UCSC) Genome Browser

The University of California, Santa Cruz (UCSC) Genome Browser The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,

More information

BIOINFORMATICS IN BIOCHEMISTRY

BIOINFORMATICS IN BIOCHEMISTRY BIOINFORMATICS IN BIOCHEMISTRY Bioinformatics a field at the interface of molecular biology, computer science, and mathematics Bioinformatics focuses on the analysis of molecular sequences (DNA, RNA, and

More information

Why learn sequence database searching? Searching Molecular Databases with BLAST

Why learn sequence database searching? Searching Molecular Databases with BLAST Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results

More information

Typically, to be biologically related means to share a common ancestor. In biology, we call this homologous

Typically, to be biologically related means to share a common ancestor. In biology, we call this homologous Typically, to be biologically related means to share a common ancestor. In biology, we call this homologous. Two proteins sharing a common ancestor are said to be homologs. Homologyoften implies structural

More information

Genome 373: Genomic Informatics. Elhanan Borenstein

Genome 373: Genomic Informatics. Elhanan Borenstein Genome 373: Genomic Informatics Elhanan Borenstein Genome 373 This course is intended to introduce students to the breadth of problems and methods in computational analysis of genomes and biological systems,

More information

Introduction to 'Omics and Bioinformatics

Introduction to 'Omics and Bioinformatics Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current

More information

EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science

EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can

More information

Data Mining for Biological Data Analysis

Data Mining for Biological Data Analysis Data Mining for Biological Data Analysis Data Mining and Text Mining (UIC 583 @ Politecnico di Milano) References Data Mining Course by Gregory-Platesky Shapiro available at www.kdnuggets.com Jiawei Han

More information

Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010

Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact

More information

Biological databases an introduction

Biological databases an introduction Biological databases an introduction By Dr. Erik Bongcam-Rudloff SLU 2017 Biological Databases Sequence Databases Genome Databases Structure Databases Sequence Databases The sequence databases are the

More information

INTRODUCTION TO BIOINFORMATICS. SAINTS GENETICS Ian Bosdet

INTRODUCTION TO BIOINFORMATICS. SAINTS GENETICS Ian Bosdet INTRODUCTION TO BIOINFORMATICS SAINTS GENETICS 12-120522 - Ian Bosdet (ibosdet@bccancer.bc.ca) Bioinformatics bioinformatics is: the application of computational techniques to the fields of biology and

More information

CECS Introduction to Bioinformatics University of Louisville Spring 2004 Dr. Eric Rouchka

CECS Introduction to Bioinformatics University of Louisville Spring 2004 Dr. Eric Rouchka Dr. Awwad Abdoh Radwan Dept Pharm Organic Chemistry, Faculty of Pharmacy, Assiut University. 29/09/2005 Required Texts Image Source: http://www.amazon.com/ Other Bioinformatics Books Image Source: http://www.amazon.com/

More information

Basic Bioinformatics: Homology, Sequence Alignment,

Basic Bioinformatics: Homology, Sequence Alignment, Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi

More information

Overview of Health Informatics. ITI BMI-Dept

Overview of Health Informatics. ITI BMI-Dept Overview of Health Informatics ITI BMI-Dept Fellowship Week 5 Overview of Health Informatics ITI, BMI-Dept Day 10 7/5/2010 2 Agenda 1-Bioinformatics Definitions 2-System Biology 3-Bioinformatics vs Computational

More information

Workshop on Genomics. Český Krumlov Monday, January 7, 13

Workshop on Genomics. Český Krumlov Monday, January 7, 13 Workshop on Genomics Český Krumlov 2013 objectives of this presentation provide some information about the setting and logistics provide some background information about the Workshop help you establish

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru

More information

DNA Sequence Alignment based on Bioinformatics

DNA Sequence Alignment based on Bioinformatics DNA Sequence Alignment based on Bioinformatics Shivani Sharma, Amardeep singh Computer Engineering,Punjabi University,Patiala,India Email: Shivanisharma89@hotmail.com Abstract: DNA Sequence alignmentis

More information

Sequence Analysis. BBSI 2006: Lecture #(χ+3) Takis Benos (2006) BBSI MAY P. Benos 1

Sequence Analysis. BBSI 2006: Lecture #(χ+3) Takis Benos (2006) BBSI MAY P. Benos 1 Sequence Analysis (part III) BBSI 2006: Lecture #(χ+3) Takis Benos (2006) BBSI 2006 31-MAY-2006 2006 P. Benos 1 Outline Sequence variation Distance measures Scoring matrices Pairwise alignments (global,

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Joyce Nzioki Plan for the Week Introduction to Bioinformatics Raw sanger sequence data Introduction to CLC Bio Quality Control

More information

ONLINE BIOINFORMATICS RESOURCES

ONLINE BIOINFORMATICS RESOURCES Dedan Githae Email: d.githae@cgiar.org BecA-ILRI Hub; Nairobi, Kenya 16 May, 2014 ONLINE BIOINFORMATICS RESOURCES Introduction to Molecular Biology and Bioinformatics (IMBB) 2014 The larger picture.. Lower

More information

9 polymorphisms (SNPs) DNA fingerprinting with microsatellites, restriction

9 polymorphisms (SNPs) DNA fingerprinting with microsatellites, restriction BIOL 260 Principles of Genetics, Fall 2013, 4.0 credits Date Lecture topic Chapter 06 Sep-Fri Introduction 1 DNA: The genetic material 2 DNA replication 3 Gene function 4 20 Sep-Fri: Last day for student-

More information

Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras. Lecture - 5a Protein sequence databases

Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras. Lecture - 5a Protein sequence databases Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras Lecture - 5a Protein sequence databases In this lecture, we will mainly discuss on Protein Sequence

More information

Analysis of Biological Sequences SPH

Analysis of Biological Sequences SPH Analysis of Biological Sequences SPH 140.638 swheelan@jhmi.edu nuts and bolts meet Tuesdays & Thursdays, 3:30-4:50 no exam; grade derived from 3-4 homework assignments plus a final project (open book,

More information

Ensembl workshop. Thomas Randall, PhD bioinformatics.unc.edu. handouts, papers, datasets

Ensembl workshop. Thomas Randall, PhD bioinformatics.unc.edu.   handouts, papers, datasets Ensembl workshop Thomas Randall, PhD tarandal@email.unc.edu bioinformatics.unc.edu www.unc.edu/~tarandal/ensembl handouts, papers, datasets Ensembl is a joint project between EMBL - EBI and the Sanger

More information

Product Applications for the Sequence Analysis Collection

Product Applications for the Sequence Analysis Collection Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a

More information

Bioinformatics: course introduction

Bioinformatics: course introduction Bioinformatics: course introduction Filip Železný Czech Technical University in Prague Faculty of Electrical Engineering Department of Cybernetics Intelligent Data Analysis lab http://ida.felk.cvut.cz

More information

Integrated UG/PG Biotechnology (Fifth Semester) End Semester Examination, 2013 LBTC 504: Bioinformatics. Model Answers

Integrated UG/PG Biotechnology (Fifth Semester) End Semester Examination, 2013 LBTC 504: Bioinformatics. Model Answers Integrated UG/PG Biotechnology (Fifth Semester) End Semester Examination, 2013 LBTC 504: Bioinformatics Model Answers Answer Key for Section-A (Objective Type Questions) Question 1. (i) (c) Both of the

More information

bioinformatica 6EF2F181AA1830ABC10ABAC56EA5E191 Bioinformatica 1 / 5

bioinformatica 6EF2F181AA1830ABC10ABAC56EA5E191 Bioinformatica 1 / 5 Bioinformatica 1 / 5 2 / 5 3 / 5 Bioinformatica Bioinformatics is the name given to these mathematical and computing approaches used to glean understanding of biological processes. Common activities in

More information

Course Competencies Template Form 112

Course Competencies Template Form 112 ` Course Competencies Template Form 112 GENERAL INFORMATION Course Prefix/Number: BSC-2426 Number of Credits: 3 Degree Type Course Title: Biotechnology Methods and Applications-I B.A. B.S. B.A.S A.A. A.S.

More information

Course Competencies Template Form 112

Course Competencies Template Form 112 ` Course Competencies Template Form 112 GENERAL INFORMATION Course Prefix/Number: BSC-2426 Number of Credits: 3 Degree Type Course Title: Biotechnology Methods and Applications-I B.A. B.S. B.A.S A.A. A.S.

More information

Principles of Genetics, Spring 2013, 4.0 credits

Principles of Genetics, Spring 2013, 4.0 credits BIOL 362 Principles of Genetics, Spring 2013, 4.0 credits Date Lecture topic Chapter 23 Jan-Wed Introduction 1 28 Jan-Mon DNA: The genetic material 2 30 Jan-Wed DNA replication 3 04 Feb-Mon Gene function

More information

Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine

Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will

More information

M. Phil. (Computer Science) Programme < >

M. Phil. (Computer Science) Programme < > M. Phil. (Computer Science) Programme Department of Information and Communication Technology, Fakir Mohan University, Vyasa Vihar, Balasore-756019, Odisha. MPCS11: Research Methodology Unit

More information