Vials - VIsualizing ALternative splicing of genes. By: Louie Dinh
|
|
|
- Louise Beasley
- 5 years ago
- Views:
Transcription
1 Vials - VIsualizing ALternative splicing of genes By: Louie Dinh
2 Biology! I m going to have to explain a bit about the cell works before the paper makes any sense.
3 Central Dogma [For Computer Scientists] REVIEW: Compiling Source Code Source Code Compile Object Code Link Executable
4 NEW: Compiling Life Central Dogma [For Biologists] DNA Transcription RNA Translation Protein DNA is like source code. Instructions for how to create an organism. ACTG. Highly Stable. Passed between generations. - Cell is like a computer. Source code needs an architecture to execute on! Many different types in your body. Similar to how your source code must run in multiple environments. Multiplatform is hard! - Protein is like an executable. It s the thing that does stuff. It modules the chemical interactions, ties your ligaments together, digests the food you eat.
5 Central Dogma [For Computer Scientists] GOTCHA: Alternative Splicing DNA Transcription RNA Translation Protein Alternative Splicing Actually I left something out Just like how you can have compiler flags to modify your programs during linking This is called alternative splicing. You have the same source code but you can optionally compile in different bits so that you can adapt it to different architectures and environments.
6 Architecture Of A Gene Just one more thing. In a gene there are introns and exons. Introns are like comments. They don t get compiled into the final transcript They get processed out in the cell. Also the start and end sites of these exons are wobbly. Early truncation happens.
![Data Generation We have technology to read *all* the RNA in a cell [RNAseq] Uses a technique called WGSS Sonic Boom!](/docs-images/84/89184935/images/7-0.jpg "Remap onto the reference genome You get a histogram with the number of reads that maps to each letter in the genome.")
7 Data Generation We have technology to read *all* the RNA in a cell [RNAseq] Uses a technique called WGSS Sonic Boom! Remap onto the reference genome You get a histogram with the number of reads that maps to each letter in the genome. Acts as a measure of abundance Problem: We want to explore the isoforms not the base pair abundance We have technology to read *all* the RNA in a cell [RNAseq] Uses a technique called WGSS Sonic Boom! Remap onto the reference genome You get a histogram with the number of reads that maps to each letter in the genome. Acts as a measure of abundance Problem: We want to explore the isoforms not the base pair abundance
8 Gene As Graph - A gene can really be thought of as a graph - Nodes are the exon variants.
9 Junction Reads as Edges - Junction reads are reads that span between two exons. - Comes from a particular isoform
10 What Is The Data?
11 Tabular and Graph Tabular data - base pair abundance. How many reads cover every single letter? Key = (Sample ID, Genome Location), Value = Count Tabular data [derived] - Isoform Abundance Key = (Sample ID, Genome Location, Exon Inclusion/Exclusin Mask) Value= Count Multivariate DAG - Junction Support Nodes = Exon, Edges = Junction Reads. Isoform = Path through graph.
12 Why: Tasks
13 3 Main Tasks 1. Compare isoforms between samples [e.g one particular person] and between groups [e.g Glioblastoma versus Lymphoma Patients] 2. Discover new isoforms. 3. Control data quality
14 Designed For Scalability. Fixes Sashimi Graphs.
15 Overview 3 Views (Junction, Isoform Abundance, Expression Abundance) Abundance =raw. Junction support = raw, Isoform abundance = derived Heavy use of linked highlighting. Selection in any one view will affect all other views Small multiples - Each view shows different data but all views are anchored to the absolute position in the genome. Very clever.
16 Scalability Is A Key Goal Notice efficiency of encoding for volume of data. Hundreds of samples. Hundreds of reads per BP Uses visually efficient encodings throughout Allows custom aggregation by grouping of samples. Distortion - Stretch And Squish to collapse introns. All the action is in the exons.
17 Expression View - Key = (Loc, Sample), Val = # Abundance at the per base pair level Allows custom aggregation via user defined groups Hue is used for encoding group memberships in other views Focus by hover - linked highlighting across all views Shows how often each base pair is read in the sample Aggregates samples additively into the group view at the top Focus by hover - will do a linked highlight the sample across all views Main place for user defined aggregation. Lets you group samples which is propagated to all other views and encoded with color.
18 Isoform Abundance View - Each row is a particular isoform - Dark bars represent the exon that is included - Grayed out area represents the full spectrum of that exon s splicing - Spatial position on an aligned scale. - Dot plots showing abundance per sample. Embedded barplot showing distribution. - If you click the +
19 Overview + Detail On Demand - One dot per sample. Aggregate by group.
20 Junction View - Graph Based Data - Shows junction reads. - For a particular start site, shows the projection. - Line marks into the projection show the end of the junction - Dot plots showing abundance of junction support
21 In Context... - Actual view in Vials - Fades all other junctions on hover - Triangle glyphs are distorted to fit adjacent exon truncation sites
22 - Again the junction support view. - Multiform with data shown as both dotplots and boxplots - Map group membership to hue - Allows for comparison between groups and samples. - Actually a study of the SRSF7 gene. Regulates alternative splicing. -
23 GBM vs LAML - You can see that exon 4 is differentially expressed - Included much more in GBM than in LAML - Sanity check on the other edge.
24 Synthesis + Critique Great job on scalability. Details on Demand, Distortion, Custom Aggregation + Filtering Visual efficiency was prioritized (dot plots + boxplots, aligned position) Global coordinate system allows easy navigation and browsing. Keeps orientation. Excellent analysis of tasks. Co-authors are analysts. Didn t address mismapped reads. Some motifs can be very prevalent. No facilities for annotation. Hard to remember discoveries.
25 Questions?
Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility
2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,
ChIP-seq and RNA-seq
ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)
ChIP-seq and RNA-seq. Farhat Habib
ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions
MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE?
MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? Lesson Plan: Title Introduction to the Genome Browser: what is a gene? JOYCE STAMM Objectives Demonstrate basic skills in using the UCSC Genome
User s Manual Version 1.0
User s Manual Version 1.0 University of Utah School of Medicine Department of Bioinformatics 421 S. Wakara Way, Salt Lake City, Utah 84108-3514 http://genomics.chpc.utah.edu/cas Contact us at issue.leelab@gmail.com
Introduction to RNA-Seq in GeneSpring NGS Software
Introduction to RNA-Seq in GeneSpring NGS Software Dipa Roy Choudhury, Ph.D. Strand Scientific Intelligence and Agilent Technologies Learn more at www.genespring.com Introduction to RNA-Seq In a few years,
MODULE 5: TRANSLATION
MODULE 5: TRANSLATION Lesson Plan: CARINA ENDRES HOWELL, LEOCADIA PALIULIS Title Translation Objectives Determine the codons for specific amino acids and identify reading frames by looking at the Base
RNA-Seq with the Tuxedo Suite
RNA-Seq with the Tuxedo Suite Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 2015 Workshop The Basic Tuxedo Suite References Trapnell C, et al. 2009 TopHat: discovering splice junctions with
RNA-SEQUENCING ANALYSIS
RNA-SEQUENCING ANALYSIS Joseph Powell SISG- 2018 CONTENTS Introduction to RNA sequencing Data structure Analyses Transcript counting Alternative splicing Allele specific expression Discovery APPLICATIONS
Analysis of RNA-seq Data
Analysis of RNA-seq Data A physicist and an engineer are in a hot-air balloon. Soon, they find themselves lost in a canyon somewhere. They yell out for help: "Helllloooooo! Where are we?" 15 minutes later,
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Processing of mutations and generation of simulated controls. On the left, a diagram illustrates the manner in which covariate-matched simulated mutations were obtained, filtered
Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist
Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC
Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html
Collect, analyze and synthesize. Annotation. Annotation for D. virilis. Evidence Based Annotation. GEP goals: Evidence for Gene Models 08/22/2017
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
Introduction to RNAseq Analysis. Milena Kraus Apr 18, 2016
Introduction to RNAseq Analysis Milena Kraus Apr 18, 2016 Agenda What is RNA sequencing used for? 1. Biological background 2. From wet lab sample to transcriptome a. Experimental procedure b. Raw data
Collect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
measuring gene expression December 5, 2017
measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA
Measuring and Understanding Gene Expression
Measuring and Understanding Gene Expression Dr. Lars Eijssen Dept. Of Bioinformatics BiGCaT Sciences programme 2014 Why are genes interesting? TRANSCRIPTION Genome Genomics Transcriptome Transcriptomics
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID caspase 9, apoptosis-related cysteine peptidase CASP9 Human This gene encodes a
PrimePCR Assay Validation Report
Gene Information Gene Name minichromosome maintenance complex component 8 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID MCM8 Human The protein encoded by
Using the Genome Browser: A Practical Guide. Travis Saari
Using the Genome Browser: A Practical Guide Travis Saari What is it for? Problem: Bioinformatics programs produce an overwhelming amount of data Difficult to understand anything from the raw data Data
Annotation of contig27 in the Muller F Element of D. elegans. Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans.
David Wang Bio 434W 4/27/15 Annotation of contig27 in the Muller F Element of D. elegans Abstract Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans. Genscan predicted six
Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
SUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: Plot shows the percentage of initially identified backsplice junctions against the Read depth value. Junctional circrna candidate have one mate
AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
Analysis of Biological Sequences SPH
Analysis of Biological Sequences SPH 140.638 swheelan@jhmi.edu nuts and bolts meet Tuesdays & Thursdays, 3:30-4:50 no exam; grade derived from 3-4 homework assignments plus a final project (open book,
9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3
cdna libraries, EST clusters, gene prediction and functional annotation Biosciences 741: Genomics Fall, 2013 Week 3 1 2 3 4 5 6 Figure 2.14 Relationship between gene structure, cdna, and EST sequences
Computational gene finding
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
The first thing you will see is the opening page. SeqMonk scans your copy and make sure everything is in order, indicated by the green check marks.
Open Seqmonk Launch SeqMonk The first thing you will see is the opening page. SeqMonk scans your copy and make sure everything is in order, indicated by the green check marks. SeqMonk Analysis Page 1 Create
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID peptidylglycine alpha-amidating monooxygenase PAM Human This gene encodes a multifunctional
About Strand NGS. Strand Genomics, Inc All rights reserved.
About Strand NGS Strand NGS-formerly known as Avadis NGS, is an integrated platform that provides analysis, management and visualization tools for next-generation sequencing data. It supports extensive
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID PARK2 co-regulated PACRG Human This gene encodes a protein that is conserved across
RNA-Seq. Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University
RNA-Seq Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University joshua.ainsley@tufts.edu Day five Alternative splicing Assembly RNA edits Alternative splicing
The Human Genome Project
The Human Genome Project The Human Genome Project Began in 1990 The Mission of the HGP: The quest to understand the human genome and the role it plays in both health and disease. The true payoff from the
Transcriptome analysis
Statistical Bioinformatics: Transcriptome analysis Stefan Seemann seemann@rth.dk University of Copenhagen April 11th 2018 Outline: a) How to assess the quality of sequencing reads? b) How to normalize
Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID protein kinase N1 PKN1 Human The protein encoded by this gene belongs to the protein
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID protein phosphatase, Mg2+/Mn2+ dependent, 1A PPM1A Human The protein encoded by
Result Tables The Result Table, which indicates chromosomal positions and annotated gene names, promoter regions and CpG islands, is the best way for
Result Tables The Result Table, which indicates chromosomal positions and annotated gene names, promoter regions and CpG islands, is the best way for you to discover methylation changes at specific genomic
Make the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
Warm Up #15: Using the white printer paper on the table:
Warm Up #15: Using the white printer paper on the table: 1. Fold it into quarters. 2. Draw out the possible structure of what you think this picture is showing in one of the boxes (Hint: This is a macromolecule).
Which Process Is The First Step In Making A Protein From Dna Instructions >>>CLICK HERE<<<
Which Process Is The First Step In Making A Protein From Dna Instructions How do the instructions in DNA reach the ribosomes in the cytoplasm? RNA is needed for Then it helps build the protein. RNA is
PrimePCR Assay Validation Report
Gene Information Gene Name SRY (sex determining region Y)-box 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SOX6 Human This gene encodes a member of the
3'A C G A C C A G T A A A 5'
AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of
Machine Learning. HMM applications in computational biology
10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly
Motif Search CMSC 423
Motif Search CMSC 423 Central Dogma of Biology proteins Translation mrna (T U) Transcription Genome DNA = double-stranded, linear molecule each strand is string over {A,C,G,T} strands are complements of
Experimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis
-Seq Analysis Quality Control checks Reproducibility Reliability -seq vs Microarray Higher sensitivity and dynamic range Lower technical variation Available for all species Novel transcript identification
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact
Chapter 14 Active Reading Guide From Gene to Protein
Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single
Gene Identification in silico
Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction
RNA-Seq Analysis. August Strand Genomics, Inc All rights reserved.
RNA-Seq Analysis August 2014 Strand Genomics, Inc. 2014. All rights reserved. Contents Introduction... 3 Sample import... 3 Quantification... 4 Novel exon... 5 Differential expression... 12 Differential
Transcription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences
Transcription and Translation DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Protein Structure Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different
10/06/2014. RNA-Seq analysis. With reference assembly. Cormier Alexandre, PhD student UMR8227, Algal Genetics Group
RNA-Seq analysis With reference assembly Cormier Alexandre, PhD student UMR8227, Algal Genetics Group Summary 2 Typical RNA-seq workflow Introduction Reference genome Reference transcriptome Reference
Lab Week 9 - A Sample Annotation Problem (adapted by Chris Shaffer from a worksheet by Varun Sundaram, WU-STL, Class of 2009)
Lab Week 9 - A Sample Annotation Problem (adapted by Chris Shaffer from a worksheet by Varun Sundaram, WU-STL, Class of 2009) Prerequisites: BLAST Exercise: An In-Depth Introduction to NCBI BLAST Familiarity
Human Molecular Genetics Prof. S. Ganesh Department of Biological Sciences and Bioengineering Indian Institute of Technology, Kanpur
Human Molecular Genetics Prof. S. Ganesh Department of Biological Sciences and Bioengineering Indian Institute of Technology, Kanpur Module - 01 Lecture - 01 Fundamentals of Central Dogma Part 1 (DNA,
Systematic evaluation of spliced alignment programs for RNA- seq data
Systematic evaluation of spliced alignment programs for RNA- seq data Pär G. Engström, Tamara Steijger, Botond Sipos, Gregory R. Grant, André Kahles, RGASP Consortium, Gunnar Rätsch, Nick Goldman, Tim
Hands-On Four Investigating Inherited Diseases
Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise
Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017
Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017 Topics to cover today What is Next Generation Sequencing (NGS)? Why do we need NGS? Common approaches to NGS NGS
Transcription. DNA to RNA
Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy
Investigating Inherited Diseases
Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise to inherited diseases.
SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS
SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS SETTLES@UCDAVIS.EDU Bioinformatics Core Genome Center UC Davis BIOINFORMATICS.UCDAVIS.EDU DISCLAIMER This talk/workshop
Transcriptome Assembly, Functional Annotation (and a few other related thoughts)
Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types
Finding Genes, Building Search Strategies and Visiting a Gene Page
Finding Genes, Building Search Strategies and Visiting a Gene Page 1. Finding a gene using text search. For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium. Hint: use
Chapter 17: From Gene to Protein
Name Period Chapter 17: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to
PrimePCR Assay Validation Report
Gene Information Gene Name 3-hydroxybutyrate dehydrogenase, type 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID BDH1 Human This gene encodes a member of
Explainer: What is a gene?
Explainer: What is a gene? By The Conversation, adapted by Newsela staff on 03.29.17 Word Count 1,016 Level 1050L TOP: DNA is found in the form of a double helix. Our DNA makes up our genes which play
Finding Genes, Building Search Strategies and Visiting a Gene Page
Finding Genes, Building Search Strategies and Visiting a Gene Page 1. Finding a gene using text search. For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium. Hint: use
Introduction to Microarray Analysis
Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray
PrimePCR Assay Validation Report
Gene Information Gene Name laminin, beta 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID LAMB3 Human The product encoded by this gene is a laminin that
Videos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
Quick Review of Protein Synthesis
Collin College BIOL. 2401 Quick Review of Protein Synthesis. Proteins and Protein Synthesis Proteins are the molecular units that do most of the work in a cell. They function as molecular catalysts, help
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase
From reads to results: differential. Alicia Oshlack Head of Bioinformatics
From reads to results: differential expression analysis with ihrna seq Alicia Oshlack Head of Bioinformatics Murdoch Childrens Research Institute Benefits and opportunities ii of RNA seq All transcripts
Analysis of Biological Sequences SPH
Analysis of Biological Sequences SPH 140.638 swheelan@jhmi.edu nuts and bolts meet Tuesdays & Thursdays, 3:30-4:50 no exam; grade derived from 3-4 homework assignments plus a final project (open book,
PeCan Data Portal. rnal/v48/n1/full/ng.3466.html
PeCan Data Portal https://pecan.stjude.org/ http://www.nature.com/ng/jou rnal/v48/n1/full/ng.3466.html Home Page Pie chart of samples representing cancer types in Data Portal cohorts Top genes for diagnosis
Computational gene finding
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression
Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,
Lecture 2: Biology Basics Continued. Fall 2018 August 23, 2018
Lecture 2: Biology Basics Continued Fall 2018 August 23, 2018 Genetic Material for Life Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine,
measuring gene expression December 11, 2018
measuring gene expression December 11, 2018 Intervening Sequences (introns): how does the cell get rid of them? Splicing!!! Highly conserved ribonucleoprotein complex recognizes intron/exon junctions and
Chapter 14: Gene Expression: From Gene to Protein
Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect
Outline. Array platform considerations: Comparison between the technologies available in microarrays
Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of
Videos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
COMP 555 Bioalgorithms. Fall Lecture 1: Course Introduction
COMP 555 Bioalgorithms Fall 2014 Jan Prins Lecture 1: Course Introduction Read Chapter 1 and Chapter 3, Secns 3.1-3.7 1 Intended Audience COMP 555: Bioalgorithms Suitable for both undergraduate and graduate
PrimePCR Assay Validation Report
Gene Information Gene Name major histocompatibility complex, class II, DR beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID HLA-DRB1 Human HLA-DRB1 belongs
Genome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does
user s guide Question 1
Question 1 How does one find a gene of interest and determine that gene s structure? Once the gene has been located on the map, how does one easily examine other genes in that same region? doi:10.1038/ng966
Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8
Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically
RNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
Chapter 17: From Gene to Protein
Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master
PrimePCR Assay Validation Report
Gene Information Gene Name fibroblast growth factor receptor 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID FGFR1 Human The protein encoded by this gene
Applications of short-read
Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Sequencing applications RNA-Seq includes experiments
Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016
Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA
GenBank Growth. In 2003 ~ 31 million sequences ~ 37 billion base pairs
Gene Finding GenBank Growth GenBank Growth In 2003 ~ 31 million sequences ~ 37 billion base pairs GenBank: Exponential Growth Growth of GenBank in billions of base pairs from release 3 in April of 1994
Browser Exercises - I. Alignments and Comparative genomics
Browser Exercises - I Alignments and Comparative genomics 1. Navigating to the Genome Browser (GBrowse) Note: For this exercise use http://www.tritrypdb.org a. Navigate to the Genome Browser (GBrowse)
Gene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
Transcription Start Sites Project Report
Transcription Start Sites Project Report Student name: Student email: Faculty advisor: College/university: Project details Project name: Project species: Date of submission: Number of genes in project:
Connect the dots DNA to DISEASE
Teachers Material Connect the dots DNA to DISEASE Developed by: M. Oltmann & A. James. California State Standards Cell Biology 1.d. Students know the central dogma of molecular biology outlines the flow
Biotechnology Unit 3: DNA to Proteins. From DNA to RNA
From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of