Outline. Array platform considerations: Comparison between the technologies available in microarrays

Size: px
Start display at page:

Download "Outline. Array platform considerations: Comparison between the technologies available in microarrays"

Transcription

1 Microarray overview

2 Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of microarrays in biology What do I need to be aware of when I retrieve public data

3 Typical Experiments Two-color experiment One-color experiment condition control condition control RNA extraction RNA labeling

4 Microarray Nomenclature Sample/Treatment/Condition/Experiment Probes Targets Targets Probes Two-color experiment One-color experiment condition control condition control RNA extraction RNA labeling Targets Probes Slide/Chip Chip

5 DNA Array Technologies (A) Affymetrix (B) Spotting

6 Array fabrication: Affymetrix Chip

7 Array fabrication: Photolithographic Synthesis Lamp Mask Chip

8 Array fabrication: Synthesis of Ordered Oligonucleotide Arrays UV light Light (deprotection) Mask O O O O O Substrate HO HO O O O T T T O O O Light (deprotection) T T O O O Mask Substrate C T T C C O REPEAT CATAT AGCTG TTCCG

9 Visual Inspection

10 Array fabrication: Spotting DNA Material By Robot

11 Array fabrication: Zooming in > 20,000 spots

12 Microarray Imperfections: fabrication and 1. High background hybridization 2. Comets Insufficient blocking Drying during hybridization Inefficient washing Smearing of DNA because of defective UV cross-linking or excessive DNA concentration

13 MicroArray Imperfections : fabrication and printing 7. Irregular spot morphology 8. Donut-shaped spots Due to pin defects: Poor pin tip design or damaged pin tip Irregular distribution of DNA within the spot due to rapid drying of slides.

14 MicroArray Imperfections: fabrication and printing 3. Bubbles during hybridization 4. Particle contamination 5. Pin Blockage Powder, dust or particulates from target

15 Array organization: Array organization: Printed DNA material PCR products of cdna libraries Oligonucleotides of bp-long Number of spots is between 10,000 to 20,000

16 Array organization: GeneChip Expression Array Design Gene Sequence or Expressed Sequence Tag (EST) 5 3 Multiple oligo probes of 25-mer Perfect Match Mismatch

17 Array organization: Affymetrix Expression Arrays Control Induced

18 Affymetrix vs Spotted Spotted array Affymetrix The winner Quantification Probes are in fluidic spots Covalently attached probes Affymetrix Sensitive to Absolute Expression High replicates number within chip Low replicates number within chip Affymetrix Sensitive to Differential expression Twice sample replicates /chip Direct comparison Sample per chip. Spotted Sensitive to Alternative splicing Replicates are of the same fragment Replicates are from different area of the gene Affymetrix Standardization There are no standards All the world use the same chip which is good for comparison Affymetrix/Spotted Economy Customization takes money because of imperfection but some time is the only way Expensive Affymetrix/Spotted Customization Gives flexibility Possible but very expensive Spotted

19 Difference: Analysis flow Quantification Two-color experiment Normalization Pre-processing Filtering noise out Data analysis One-color experiment

20 Common: Expression Experiments set Data Matrix (a result of quantification) Samples Each column comes from one array Genes c Gene expression matrix Each row represent one genes Gene expression levels

21 Applications of microarrays Evolution Most of gene expression differences between chimpanzees human have been detected in their brain. Development Associating apoptosis related gene expression with metamorphosis stages in a variety tissues of Drosophila Behavior Can predict the behavior of honey-bees workers by their brain gene expression. Tissue Molecular signature specific to subtype of cancer tissues Regulation Finding novel regulatory motifs by coupling motif search with co-expression Functional annotation Annotating unknown genes based on co expression (guilty by association) - Question about samples - Question about gene

22 Evolution: : Reveal species specific changes which cannot be revealed by genetic changes Chimanzee and human genomes are 98.7% identical. Therefore phylogentic analysis based on genome sequences cannot separate chimpanzee and human into different clades. Detecting gene expression from three tissues (leukocyte, liver and brain) in these species and orangutan could differentiate human and chimpanzee into mutually exclusive groups. W. Enard et al., Science 296, (2002).

23 Behavior: detecting of small expression differences Before that paper only small amount of genes in brain were shown to have changes in expression which are related to behavior. By conducting the right experimental design using ANOVA in this study they could detect small differences of gene expression in honey bees brain and therefore relate many genes to behavior. By this they could predict the behavior of honey-bees workers by their brain gene expression. C. W. Whitfield, A. M. Cziko, G. E. Robinson, Science 302, (2003).

24 Cancer tissues Finding hundreds of gene that differentiate between two or more groups of cancer tissues Using these set of genes to predict the fate of tissues in a stage where histological and other clinical parameters can not. S. Ramaswamy, K. N. Ross, E. S. Lander, T. R. Golub, Nat Genet 33, (2003).

25 Functional annotation Hybridized mrna from 60 conditions and tissues on predicted exons microarray. Exons that were expressed coherently and mapped adjacently on the chromosome (22) annotated as one gene. D. D. Shoemaker et al., Nature 409, (2001).

26 Regulatory motifs By linkage between regulatory motif and expression profiles, the right combination of regulatory motifs can be found. Y. Pilpel, P. Sudarsanam, G. M. Church, Nat Genet 29, (2001).

27 The Global View of Microarray To be able to predict and classify tissue/species we need many genes To be able to classify genes we need many samples

28 What not to do? Don t t use this technology for detecting the expression of few specific genes.. The reaction of the unchanged genes assumed to be the majority on the chip. It is not recommended to use one way subtraction libraries. The changes on the chip assumed to be symmetric Do not hybridize only two samples. Replicates are needed for noise estimation or reduction.

29 High throughput Annotation As much as the probe sequence is shorter there is a chance that it will catch other genes. Especially genes from the same gene families It would have been very useful to have a database that give you information about the probe specificity. (e.g., GeneAnnote)

30 Check list for working with published data Check whether you are working with absolute expression or with differential expression Check the array annotation annotation is dynamic and may be changed since the time it was entered Try to validate the specificity of the probes. Short probes can catch other gene transcripts with the same domain, gene from the same gene families and may reflect the differences of expression of alternative splice variants. Validate sample annotation!

31 Thank You

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Humboldt Universität zu Berlin. Grundlagen der Bioinformatik SS Microarrays. Lecture

Humboldt Universität zu Berlin. Grundlagen der Bioinformatik SS Microarrays. Lecture Humboldt Universität zu Berlin Microarrays Grundlagen der Bioinformatik SS 2017 Lecture 6 09.06.2017 Agenda 1.mRNA: Genomic background 2.Overview: Microarray 3.Data-analysis: Quality control & normalization

More information

What is a microarray

What is a microarray DNA Microarrays What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective

More information

SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.

SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology. SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture

More information

Microarray Technique. Some background. M. Nath

Microarray Technique. Some background. M. Nath Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique

More information

Outline. Analysis of Microarray Data. Most important design question. General experimental issues

Outline. Analysis of Microarray Data. Most important design question. General experimental issues Outline Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization Introduction to microarrays Experimental design Data normalization Other data transformation Exercises George Bell,

More information

Expression Array System

Expression Array System Integrated Science for Gene Expression Applied Biosystems Expression Array System Expression Array System SEE MORE GENES The most complete, most sensitive system for whole genome expression analysis. The

More information

DNA Microarray Data Oligonucleotide Arrays

DNA Microarray Data Oligonucleotide Arrays DNA Microarray Data Oligonucleotide Arrays Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Bioconductor Short Course 2003 Copyright 2002, all rights reserved Biological question Experimental

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

Spotted DNA Array Design. Todd Lowe Bio 210 Jan 13 & 15, 2003

Spotted DNA Array Design. Todd Lowe Bio 210 Jan 13 & 15, 2003 Spotted DNA Array Design Todd Lowe Bio 210 Jan 13 & 15, 2003 Making Your Own Array For Affymetrix-style GeneChips, most labs will use commercially available arrays, so no array design considerations Spotted

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

Typical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides

Typical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides Aminosilane coating Nexterion Slide A+ and Slide AStar Overview Type of coating Immobilization method Typical probes Ordering information Nexterion product Barcode option Item number Slides per pack Aminosilane

More information

Introduction to Bioinformatics. Fabian Hoti 6.10.

Introduction to Bioinformatics. Fabian Hoti 6.10. Introduction to Bioinformatics Fabian Hoti 6.10. Analysis of Microarray Data Introduction Different types of microarrays Experiment Design Data Normalization Feature selection/extraction Clustering Introduction

More information

Microarray Gene Expression Analysis at CNIO

Microarray Gene Expression Analysis at CNIO Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples

More information

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how

More information

EECS730: Introduction to Bioinformatics

EECS730: Introduction to Bioinformatics EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and

More information

measuring gene expression December 5, 2017

measuring gene expression December 5, 2017 measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA

More information

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

less sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput

less sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput Chapter 11: Gene Expression The availability of an annotated genome sequence enables massively parallel analysis of gene expression. The expression of all genes in an organism can be measured in one experiment.

More information

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

More information

Bioinformatics III Structural Bioinformatics and Genome Analysis. PART II: Genome Analysis. Chapter 7. DNA Microarrays

Bioinformatics III Structural Bioinformatics and Genome Analysis. PART II: Genome Analysis. Chapter 7. DNA Microarrays Bioinformatics III Structural Bioinformatics and Genome Analysis PART II: Genome Analysis Chapter 7. DNA Microarrays 7.1 Motivation 7.2 DNA Microarray History and current states 7.3 DNA Microarray Techniques

More information

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,

More information

REAL TIME PCR USING SYBR GREEN

REAL TIME PCR USING SYBR GREEN REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM

More information

Optimized in situ construction of oligomers on an array surface

Optimized in situ construction of oligomers on an array surface ã 2002 Oxford University Press Optimized in situ construction of oligomers on an array surface Andrew C. Tolonen*, Dinu F. Albeanu 1, Julia F. Corbett 2, Heather Handley, Charlotte Henson 3 and Pratap

More information

Serial Analysis of Gene Expression

Serial Analysis of Gene Expression Serial Analysis of Gene Expression Cloning of Tissue-Specific Genes Using SAGE and a Novel Computational Substraction Approach. Genomic (2001) Hung-Jui Shih Outline of Presentation SAGE EST Article TPE

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s

More information

Goals of pharmacogenomics

Goals of pharmacogenomics Goals of pharmacogenomics Use drugs better and use better drugs! People inherit/exhibit differences in drug: Absorption Metabolism and degradation of the drug Transport of drug to the target molecule Excretion

More information

Mapping strategies for sequence reads

Mapping strategies for sequence reads Mapping strategies for sequence reads Ernest Turro University of Cambridge 21 Oct 2013 Quantification A basic aim in genomics is working out the contents of a biological sample. 1. What distinct elements

More information

Canadian Bioinforma2cs Workshops

Canadian Bioinforma2cs Workshops Canadian Bioinforma2cs Workshops www.bioinforma2cs.ca Module #: Title of Module 2 1 Introduction to Microarrays & R Paul Boutros Morning Overview 09:00-11:00 Microarray Background Microarray Pre- Processing

More information

What we ll do today. Types of stem cells. Do engineered ips and ES cells have. What genes are special in stem cells?

What we ll do today. Types of stem cells. Do engineered ips and ES cells have. What genes are special in stem cells? Do engineered ips and ES cells have similar molecular signatures? What we ll do today Research questions in stem cell biology Comparing expression and epigenetics in stem cells asuring gene expression

More information

Genetic Engineering & Recombinant DNA

Genetic Engineering & Recombinant DNA Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied

More information

Gene Signal Estimates from Exon Arrays

Gene Signal Estimates from Exon Arrays Gene Signal Estimates from Exon Arrays I. Introduction: With exon arrays like the GeneChip Human Exon 1.0 ST Array, researchers can examine the transcriptional profile of an entire gene (Figure 1). Being

More information

Do engineered ips and ES cells have similar molecular signatures?

Do engineered ips and ES cells have similar molecular signatures? Do engineered ips and ES cells have similar molecular signatures? Comparing expression and epigenetics in stem cells George Bell, Ph.D. Bioinformatics and Research Computing 2012 Spring Lecture Series

More information

LATE-PCR. Linear-After-The-Exponential

LATE-PCR. Linear-After-The-Exponential LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Annotating 7G24-63 Justin Richner May 4, Figure 1: Map of my sequence

Annotating 7G24-63 Justin Richner May 4, Figure 1: Map of my sequence Annotating 7G24-63 Justin Richner May 4, 2005 Zfh2 exons Thd1 exons Pur-alpha exons 0 40 kb 8 = 1 kb = LINE, Penelope = DNA/Transib, Transib1 = DINE = Novel Repeat = LTR/PAO, Diver2 I = LTR/Gypsy, Invader

More information

Microarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6

Microarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6 Slide Selection Chart... J2 Epoxide-coated Slides... J3 UltraGAPS -coated Slides... J4 GAPS II-coated Slides... J5 Corning Cover Glass... J6 384-well Printing Plates... J6 Slide Mailers/Storage Boxes...

More information

DNA Microarrays Introduction Part 2. Todd Lowe BME/BIO 210 April 11, 2007

DNA Microarrays Introduction Part 2. Todd Lowe BME/BIO 210 April 11, 2007 DNA Microarrays Introduction Part 2 Todd Lowe BME/BIO 210 April 11, 2007 Reading Assigned For Friday, please read two papers and be prepared to discuss in detail: Comprehensive Identification of Cell Cycle-related

More information

SPH 247 Statistical Analysis of Laboratory Data

SPH 247 Statistical Analysis of Laboratory Data SPH 247 Statistical Analysis of Laboratory Data April 14, 2015 SPH 247 Statistical Analysis of Laboratory Data 1 Basic Design of Expression Arrays For each gene that is a target for the array, we have

More information

Functional Genomics in Plants

Functional Genomics in Plants Functional Genomics in Plants Jeffrey L Bennetzen, Purdue University, West Lafayette, Indiana, USA Functional genomics refers to a suite of genetic technologies that will contribute to a comprehensive

More information

ADVANCED STATISTICAL METHODS FOR GENE EXPRESSION DATA

ADVANCED STATISTICAL METHODS FOR GENE EXPRESSION DATA ADVANCED STATISTICAL METHODS FOR GENE EXPRESSION DATA Veera Baladandayuthapani & Kim-Anh Do University of Texas M.D. Anderson Cancer Center Houston, Texas, USA veera@mdanderson.org Course Website: http://odin.mdacc.tmc.edu/

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours

High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours Application Note Authors Paula Costa and Anniek De Witte Agilent Technologies, Inc. Santa Clara, CA USA Abstract As

More information

AP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants

AP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants What do you notice about these phrases? radar racecar Madam I m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? Chapter 20. Biotechnology: DNA Technology & enomics

More information

Preprocessing Affymetrix GeneChip Data. Affymetrix GeneChip Design. Terminology TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT

Preprocessing Affymetrix GeneChip Data. Affymetrix GeneChip Design. Terminology TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT Preprocessing Affymetrix GeneChip Data Credit for some of today s materials: Ben Bolstad, Leslie Cope, Laurent Gautier, Terry Speed and Zhijin Wu Affymetrix GeneChip Design 5 3 Reference sequence TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

Protocol. Nexterion Slide A+ MPX 16. DNA-application

Protocol. Nexterion Slide A+ MPX 16. DNA-application Seite: 1/12 1 Introduction...2 2 Storage and handling...3 3 General precautions...3 4 Reagents required...3 5 Equipment required...4 6 Array printing...4 7 Printing guidelines...5 8 DNA immobilization...6

More information

Introduction to microarrays. Overview The analysis process Limitations Extensions (NGS)

Introduction to microarrays. Overview The analysis process Limitations Extensions (NGS) Introduction to microarrays Overview The analysis process Limitations Extensions (NGS) Outline An overview (a review) of microarrays Experiments with microarrays The data analysis process Microarray limitations

More information

Biotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University

Biotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this

More information

Cancer Genetics Solutions

Cancer Genetics Solutions Cancer Genetics Solutions Cancer Genetics Solutions Pushing the Boundaries in Cancer Genetics Cancer is a formidable foe that presents significant challenges. The complexity of this disease can be daunting

More information

Target Enrichment Strategies for Next Generation Sequencing

Target Enrichment Strategies for Next Generation Sequencing Target Enrichment Strategies for Next Generation Sequencing Anuj Gupta, PhD Agilent Technologies, New Delhi Genotypic Conference, Sept 2014 NGS Timeline Information burst Nearly 30,000 human genomes sequenced

More information

Feature Selection of Gene Expression Data for Cancer Classification: A Review

Feature Selection of Gene Expression Data for Cancer Classification: A Review Available online at www.sciencedirect.com ScienceDirect Procedia Computer Science 50 (2015 ) 52 57 2nd International Symposium on Big Data and Cloud Computing (ISBCC 15) Feature Selection of Gene Expression

More information

Data Sheet. GeneChip Human Genome U133 Arrays

Data Sheet. GeneChip Human Genome U133 Arrays GeneChip Human Genome Arrays AFFYMETRIX PRODUCT FAMILY > ARRAYS > Data Sheet GeneChip Human Genome U133 Arrays The Most Comprehensive Coverage of the Human Genome in Two Flexible Formats: Single-array

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

BABELOMICS: Microarray Data Analysis

BABELOMICS: Microarray Data Analysis BABELOMICS: Microarray Data Analysis Madrid, 21 June 2010 Martina Marbà mmarba@cipf.es Bioinformatics and Genomics Department Centro de Investigación Príncipe Felipe (CIPF) (Valencia, Spain) DNA Microarrays

More information

Microarray Data Mining and Gene Regulatory Network Analysis

Microarray Data Mining and Gene Regulatory Network Analysis The University of Southern Mississippi The Aquila Digital Community Dissertations Spring 5-2011 Microarray Data Mining and Gene Regulatory Network Analysis Ying Li University of Southern Mississippi Follow

More information

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

Amino-allyl Dye Coupling Protocol

Amino-allyl Dye Coupling Protocol Amino-allyl Dye Coupling Protocol Joseph DeRisi, June 2001 Typically, fluorescently labeled cdna is generated by incorporation of dyeconjugated nucleotide analogs during the reverse transcription process.

More information

3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome

3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts

More information

Analysis of a Tiling Regulation Study in Partek Genomics Suite 6.6

Analysis of a Tiling Regulation Study in Partek Genomics Suite 6.6 Analysis of a Tiling Regulation Study in Partek Genomics Suite 6.6 The example data set used in this tutorial consists of 6 technical replicates from the same human cell line, 3 are SP1 treated, and 3

More information

Class Information. Introduction to Genome Biology and Microarray Technology. Biostatistics Rafael A. Irizarry. Lecture 1

Class Information. Introduction to Genome Biology and Microarray Technology. Biostatistics Rafael A. Irizarry. Lecture 1 This work is licensed under a Creative Commons ttribution-noncommercial-sharelike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this

More information

UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding

UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene

More information

DNA CHIPS- Technology and Utility

DNA CHIPS- Technology and Utility DNA CHIPS- Technology and Utility Yanal Alkuddsi Ph.D Student Dept. of Genetics and Plant Breeding University of Agricultural Sciences Dharwad, Karnataka, India, 580005 1.INTRODUCTION CONTENT 2.MICROARRAYS:

More information

Identifying Candidate Informative Genes for Biomarker Prediction of Liver Cancer

Identifying Candidate Informative Genes for Biomarker Prediction of Liver Cancer Identifying Candidate Informative Genes for Biomarker Prediction of Liver Cancer Nagwan M. Abdel Samee 1, Nahed H. Solouma 2, Mahmoud Elhefnawy 3, Abdalla S. Ahmed 4, Yasser M. Kadah 5 1 Computer Engineering

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What

More information

Philippe Hupé 1,2. The R User Conference 2009 Rennes

Philippe Hupé 1,2. The R User Conference 2009 Rennes A suite of R packages for the analysis of DNA copy number microarray experiments Application in cancerology Philippe Hupé 1,2 1 UMR144 Institut Curie, CNRS 2 U900 Institut Curie, INSERM, Mines Paris Tech

More information

Fusion Gene Analysis. ncounter Elements. Molecules That Count WHITE PAPER. v1.0 OCTOBER 2014 NanoString Technologies, Inc.

Fusion Gene Analysis. ncounter Elements. Molecules That Count WHITE PAPER. v1.0 OCTOBER 2014 NanoString Technologies, Inc. Fusion Gene Analysis NanoString Technologies, Inc. Fusion Gene Analysis ncounter Elements v1.0 OCTOBER 2014 NanoString Technologies, Inc., Seattle WA 98109 FOR RESEARCH USE ONLY. Not for use in diagnostic

More information

Mentor: Dr. Bino John

Mentor: Dr. Bino John MAT Shiksha Mantri Mentor: Dr. Bino John Model-based Analysis y of Tiling-arrays g y for ChIP-chip X. Shirley Liu et al., PNAS (2006) vol. 103 no. 33 12457 12462 Tiling Arrays Subtype of microarray chips

More information

Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist

Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

Regulation of eukaryotic transcription:

Regulation of eukaryotic transcription: Promoter definition by mass genome annotation data: in silico primer extension EMBNET course Bioinformatics of transcriptional regulation Jan 28 2008 Christoph Schmid Regulation of eukaryotic transcription:

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Exercise1 ArrayExpress Archive - High-throughput sequencing example

Exercise1 ArrayExpress Archive - High-throughput sequencing example ArrayExpress and Atlas practical: querying and exporting gene expression data at the EBI Gabriella Rustici gabry@ebi.ac.uk This practical will introduce you to the data content and query functionality

More information

Biology 252 Nucleic Acid Methods

Biology 252 Nucleic Acid Methods Fall 2015 Biology 252 Nucleic Acid Methods COURSE OUTLINE Prerequisites: One semester of college biology (BIO 101 or BIO 173) and one semester of college English (ENG 111); completion of CHM 111is recommended.

More information

Exploration and Analysis of DNA Microarray Data

Exploration and Analysis of DNA Microarray Data Exploration and Analysis of DNA Microarray Data Dhammika Amaratunga Senior Research Fellow in Nonclinical Biostatistics Johnson & Johnson Pharmaceutical Research & Development Javier Cabrera Associate

More information

Measuring transcriptomes with RNA-Seq

Measuring transcriptomes with RNA-Seq Measuring transcriptomes with RNA-Seq BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2017 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under CC BY-NC

More information

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Roche Molecular Biochemicals Technical Note No. LC 10/2000 Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

Agilent s Mx3000P and Mx3005P

Agilent s Mx3000P and Mx3005P Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded

More information

Introduction to genome biology

Introduction to genome biology Introduction to genome biology Lisa Stubbs We ve found most genes; but what about the rest of the genome? Genome size* 12 Mb 95 Mb 170 Mb 1500 Mb 2700 Mb 3200 Mb #coding genes ~7000 ~20000 ~14000 ~26000

More information

DNA Structure and Analysis. Chapter 4: Background

DNA Structure and Analysis. Chapter 4: Background DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com

More information

MicroRNA profiling directly from low amounts of plasma or serum using the Multiplex Circulating mirna Assay with Firefly particle technology

MicroRNA profiling directly from low amounts of plasma or serum using the Multiplex Circulating mirna Assay with Firefly particle technology Technical note MicroRNA profiling directly from low amounts of plasma or serum using the Multiplex Circulating mirna Assay with Firefly particle technology Abstract We introduce a new assay that enables

More information

T and B cell gene rearrangement October 17, Ram Savan

T and B cell gene rearrangement October 17, Ram Savan T and B cell gene rearrangement October 17, 2016 Ram Savan savanram@uw.edu 441 Lecture #9 Slide 1 of 28 Three lectures on antigen receptors Part 1 (Last Friday): Structural features of the BCR and TCR

More information

Optimization of a Microarray Probe Design Focusing on the Minimization of Cross-hybridization

Optimization of a Microarray Probe Design Focusing on the Minimization of Cross-hybridization Optimization of a Microarray Probe Design Focusing on the Minimization of Cross-hybridization F. Horn 1, H.-W. Nützmann 2, V. Schroeckh 2, R. Guthke 1, and C. Hummert 1 1 Research Group Systems Biology

More information

TIGR THE INSTITUTE FOR GENOMIC RESEARCH

TIGR THE INSTITUTE FOR GENOMIC RESEARCH Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,

More information

DNA Microarray Experiments: Biological and Technological Aspects

DNA Microarray Experiments: Biological and Technological Aspects DNA Microarray Experiments: Biological and Technological Aspects Danh V. Nguyen 1, A. Bulak Arpat 2, Naisyin Wang 1, and Raymond J. Carroll 1 1 Department of Statistics, Texas A&M University, College Station,

More information

Targeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales

Targeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales Targeted Sequencing Using Droplet-Based Microfluidics Keith Brown Director, Sales brownk@raindancetech.com Who we are: is a Provider of Microdroplet-based Solutions The Company s RainStorm TM Technology

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

Gene expression bioinformatics: Part 1. High-throughput quantitative genomics

Gene expression bioinformatics: Part 1. High-throughput quantitative genomics Gene expression bioinformatics: Part 1. High-throughput quantitative genomics September 25, 2017 Alvin T. Kho Boston Children's Hospital alvin_kho@hms.harvard.edu Created with Outline (Biology is the science

More information