T H E J O U R N A L O F C E L L B I O L O G Y

Size: px
Start display at page:

Download "T H E J O U R N A L O F C E L L B I O L O G Y"

Transcription

1 T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rainero et al., Figure S1. The expression of DGK- is reduced upon transfection of an sirna against DGK- in A2780, H1299, and MDA-MB-231 cells, DGK- is not required for the internalization of 5 1 or TfnR, and inhibition of v 3 or expression of mutant p53 did not affect the enzymatic activity or the localization of DGK-. (A C) sirna of DGK- in A2780, H1299, and MDA-MB-231 cells. A2780 (A), vector, and mutant p53 273H -expressing H1299 (B) and MDA-MB-231 (C) cells were transfected with nontargeting sirna (sirna control [si-con]), an sirna targeting DGK- (si-dgk ), or sirna targeting DGK- in combination with sirnaresistant DGK- (si-dgk /DGK (resc)). DGK- protein levels were analyzed by Western blotting, and -actin was used as a loading control. (D and E) DGK- is not required for internalization of 5 1 or TfnR. A2780 cells were transfected with a nontargeting sirna or an sirna targeting DGK-, and the internalization of 5 1 (D) or TfnR (E) was determined. Values are means ± SEM; n = 12 replicates in two independent experiments. (F and G) Assay of DGK- activity. (F) A2780 or vector and mutant p53 273H -expressing H1299 cells were transfected with myc DGK- (G) or left untransfected (F). Cells were treated as indicated with cradfv, 2.5 µm crgdfv, or 100 ng/ml EGF. Endogenous DGK- was immunoprecipitated with the anti DGK- antibody (F), or myc DGK- was immunoprecipitated with an antimyc antibody (G), and the activity of the lipid kinases was assayed in the immunoprecipitates. Data represent means ± SEM; n = 9 replicates in three independent experiments (G); n = 6 replicates in two independent experiments (F). *, P = 0.05; Mann Whitney test. (H) DGK- localization. A2780 cells were plated on CDM, treated with 2.5 µm crgdfv, fixed, and stained for DGK- and phalloidin to visualize F-actin. Bar, 10 µm. S1

2 Figure S2. DGK activity and RCP s C2 domain are not required for the interaction of RCP with 5 1. (A D) A2780 (A and D) or mutant p53 273H -expressing H1299 (B and C) cells were transfected with GFP-RCP (A, B, and D), GFP-RCP (D), or GFP control (A, B, and D), incubated with or without 2.5 µm crgdfv in the absence (DMSO) or presence of 10 µm R59022 for 30 min, and lysed in a buffer containing 0.15% Tween 20. GFP was immunoprecipitated (IP) from lysates by incubation with beads coupled to a monoclonal antibody recognizing GFP, and these immunoprecipitates were analyzed for the presence of 5 integrin by Western blotting. The loading of GFP and GFP-RCP was confirmed by immunoblotting with an anti-gfp antibody. In C, endogenous 5 was immunoprecipitated from lysates by incubation with beads coupled to a monoclonal antibody recognizing 5, and these immunoprecipitates were analyzed for the presence of RCP by Western blotting. S2

3 Figure S3. The effects of DGK- knockdown on speed and persistence of cell migration, the effects of Rho kinase inhibition on random migration induced by inhibition of v 3 or expression of mutant p53, and the role of other DGK isoforms in pseudopod elongation. (A and B) Effects of DGK- knockdown on speed and persistence of cell migration. A2780 (A), empty vector, and p53 273H -expressing H1299 (B) cells were transfected with nontargeting sirna (sirna control [si-con]), an sirna targeting DGK- (si-dgk ), or sirna targeting DGK- in combination with an sirna-resistant DGK- (si-dgk / DGK (resc)), and their migration into scratch wounds in the absence ( ) and presence of 2.5 µm crgdfv was recorded as for Fig. 2. The speed and persistence of cell migration were extracted from the trackplots, and data are represented as box and whisker plots (black lines show medians; whiskers: 5 95 percentile); n = 3 independent experiments. (C and D) Rho kinase activity is required for crgdfv- and p53 273H -induced random migration. A2780 (C), empty vector, and p53 273H -expressing H1299 (D) cells were grown to confluence, and their migration into scratch wounds in the absence ( ) and presence of 2.5 µm crgdfv with and without the Rho-associated protein kinase inhibitor (Y27632; 2 µm) or vehicle control (con) was recorded as for Fig. 2. The forward migration index was extracted from the trackplots, and data are represented as box and whisker plots (black lines show medians; whiskers: 5 95 percentile); n = 3 independent experiments. (E) Role of other DGK isoforms in pseudopod elongation. A2780 cells were transfected with a nontargeting sirna or sirnas targeting DGK-, -, -, -, and - (si-dgk, si-dgk, si-dgk, si-dgk, and si-dgk ) as indicated and plated on CDM, and pseudopod length was measured as for Fig. 3. DGK mrna levels were assessed by RT-PCR. Data are represented as box and whisker plots (black lines show medians; whiskers: 5 95 percentile); n = 4 replicates in two independent experiments. ***, P < ; Mann Whitney test. S3

4 Figure S4. The accumulation of RCP at the tip of pseudopods does not reflect increased cytoplasmic volume at these cellular extremities. (A) RCP accumulation at pseudopod tips does not reflect increased cytoplasmic volume at these cellular extremities. Empty vector and p53 273H -expressing H1299 cells were transfected with GFP-RCP in combination with mcherry, plated onto CDM, and imaged by confocal microscopy. Images were captured at one frame/second over a period of 60 s, and videos were generated from these. Single-section confocal image stills corresponding to individual frames from these videos are presented. Bar, 20 µm. The yellow arrows indicate the direction of migration, and the portion of the cell within the squares is presented in the bottom images. (B) The recovery of GFP after photobleaching is not affected by v 3 inhibition. A2780 cells were transfected with GFP and plated onto CDM, and photobleaching was performed. Recovery curves were generated using the FV10-ASW software, and the immobile fraction (percentage) was extracted from them. (C) sirna/rescue of RCP expression in A2780 cells. A2780 cells were transfected with nontargeting sirna (sirna control [si-con]), an sirna targeting RCP (si-rcp), or sirna RCP in combination with an sirna-resistant GFP-RCP WT (GFP-RCP WT (resc)) or an sirna-resistant GFP-RCP (GFP- RCP (resc)). RCP protein levels were determined by Western blotting. (D) DGK- is required for EGFR recycling induced by inhibition of v 3. The recycling of internalized EGFR1 was determined in A2780 cells transfected with a nontargeting sirna or an sirna targeting DGK- (si-dgk ). 36 nm crgdvn Me V was included during the recycling period. Values are means ± SEM of three independent experiments. si-con versus si-con+crgdfn Me V: **, P = ; ***, P = ; Mann Whitney test. si-con+crgdfn Me V versus si-dgk +crgdfnv: ###, P = ; Mann Whitney test. exp., exposure. S4

5 Figure S5. PLD activity is not required for RCP recruitment to pseudopod tips. (A) PLD activity is not required for RCP recruitment to pseudopod tips. A2780 cells were transfected with GFP-RCP and plated onto CDM in the presence or absence of 36 nm crgdfn Me V. The PLD inhibitor butan-1-ol (0.5%) or secondary alcohol control butan-2-ol (0.5%) was included as indicated, and GFP-RCP was imaged by confocal microscopy. Images were captured at one frame/ second over a period of 60 s, and videos were generated from these. Single-section confocal image stills corresponding to individual frames from these videos are presented. Bar, 20 µm. The arrows indicate the direction of migration, and the portion of the cell within the squares is presented in the bottom images. (B) FRAP of GFP-RCP in vesicular structures or cytoplasmic regions near pseudopod tips. A2780 or mutant p53-expressing H1299 cells were transfected with GFP-RCP and plated onto CDM, and photobleaching was performed with the laser aimed at either vesicular structures or diffuse cytoplasmic regions (as indicated) near the pseudopod tip. Fluorescence time-lapse videos were then collected, and representative stills from these are displayed. Recovery curves were generated using the FV10-ASW software, and the immobile fraction (percentage) was extracted from them the data corresponding to these videos are displayed in Fig. 6 (D and F). Bar, 10 μm. Arrows show direction of cell migration. The circles denote the photobleached area. The arrowheads indicate vesicular structures that recover from photobleaching. S5

6 Video 1. GFP-actin localization in A2780 cells transfected with a nontargeting sirna. A2780 cells were transfected with GFPactin in combination with a nontargeting sirna, and a time-lapse video was recorded using an inverted confocal microscope (FV1000). Frames were taken every second for 1 min. sicon, control sirna. Video 2. GFP-actin localization in A2780 cells treated with crgdfn Me V in the presence of a nontargeting sirna. A2780 cells were transfected with GFP-actin in combination with a nontargeting sirna and treated with 160 nm crgdfn Me V, and timelapse videos were recorded using an inverted confocal microscope (FV1000). Frames were taken every second for 1 min. sicon, control sirna. Video 3. GFP-actin localization in A2780 cells treated with crgdfn Me V in the presence an sirna against DGK-. A2780 cells were transfected with GFP-actin in combination with an sirna targeting DGK- and treated with crgdfn Me V, and a time-lapse video was recorded using an inverted confocal microscope (FV1000). Frames were taken every second for 1 min. Video 4. GFP-RCP localization in A2780 cells treated with crgdfv and transfected with a nontargeting sirna. A2780 cells were transfected with GFP-RCP in combination with a nontargeting sirna, plated onto CDM, and treated with 2.5 µm crgdfv, and time-lapse videos were recorded using an inverted confocal microscope (FV1000). Frames were taken every second for 1 min. Video 5. GFP-RCP localization in A2780 cells treated with crgdfv and transfected with an sirna against DGK-. A2780 cells were transfected with GFP-RCP in combination with an sirna targeting DGK- and plated onto CDM. Cells were treated with 2.5 µm crgdfv, and time-lapse videos were recorded using an inverted confocal microscope (FV1000). Frames were taken every second for 1 min. Video 6. GFP-RCP localization in p53 273H -expressing H1299 cells transfected with a nontargeting sirna. p53 273H -expressing H1299 cells were transfected with GFP-RCP in combination with a nontargeting sirna and plated onto CDM, and time-lapse videos were recorded using an inverted confocal microscope (FV1000). Frames were taken every second for 1 min. sicon, control sirna. Video 7. GFP-RCP localization in p53 273H -expressing H1299 cells transfected with an sirna against DGK-. p53 273H -expressing H1299 cells were transfected with GFP-RCP in combination with an sirna targeting DGK-. Cells were plated onto CDM, and time-lapse videos were recorded using an inverted confocal microscope (FV1000). Frames were taken every second for 1 min. S6

7 Video 8. The recovery from photobleaching of GFP-RCP in A2780 cells transfected with a nontargeting sirna or an sirna against DGK-. A2780 cells were transfected with GFP-RCP and a nontargeting si-rna (left) or an sirna targeting DGK- (right), plated onto CDM, and treated with 2.5 µm crgdfv. The areas indicated by the yellow circles were subjected to photobleaching as indicated (frame 4), and the recovery from photobleaching followed by time-lapse fluorescence microscopy was performed using an inverted confocal microscope (FV1000). Frames were captured every second. sicon, control sirna. Video 9. The localization of GFP-RCP in A2780. A2780 cells were transfected with GFP-RCP , plated onto CDM, and treated with crgdfv, and time-lapse videos were recorded using an inverted confocal microscope (FV1000). Frames were taken every second for 1 min. Video 10. The localization of GFP-RCP in p53 273H -expressing H1299 cells. p53 273H -expressing H1299 cells were transfected with GFP-RCP and plated onto CDM, and time-lapse videos were recorded using an inverted confocal microscope (FV1000). Frames were taken every second for 1 min. S7

JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Paul et al.,

JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Paul et al., Supplemental material JCB Paul et al., http://www.jcb.org/cgi/content/full/jcb.201502040/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Mutant p53-expressing cells display limited retrograde actin flow at

More information

Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr

Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr Supplemental figure legends Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr A, LβT2 cells were transfected with either scrambled or PEA-15 sirna. Cells were then

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1.

Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Percent of original fluorescence was plotted as a function of time following photobleaching

More information

Journal of Cell Science Supplementary Material

Journal of Cell Science Supplementary Material 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 0.038/ncb35 Supplementary Figure Effect of Merlin depletion on velocity correlation function and correlations lengths. (a) Representative images showing the sheet migration of MDCK monolayer at the

More information

Supplementary information. Supplementary Figures

Supplementary information. Supplementary Figures Supplementary information Supplementary Figures Supplementary Figure 1. A. i. HA-JMY expressing U2OS cells were treated with SAHA (6h). DAPI was used to visualise nuclei. ii. U2OS cells stably expressing

More information

Supplemental Data Supplementary Figure Legends and Scheme Figure S1.

Supplemental Data Supplementary Figure Legends and Scheme Figure S1. Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,

More information

Supplementary Fig.1 Luton

Supplementary Fig.1 Luton Supplementary Fig.1 Luton a 175 Brain Thymus Spleen Small Intestine Kidney Testis HeLa b 250 Lung Kidney MDCK c EFA6B si Control si Mismatch #637 #1564 #1770 83 62 47.5 175 IB: anti-efa6b #B1 130 66 Lysates

More information

Supplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17

Supplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17 Molecular Cell, Volume 65 Supplemental Information Pacer Mediates the Function of Class III PI3K and HOPS Complexes in Autophagosome Maturation by Engaging Stx17 Xiawei Cheng, Xiuling Ma, Xianming Ding,

More information

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid

More information

Confocal immunofluorescence microscopy

Confocal immunofluorescence microscopy Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,

More information

X2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP

X2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP FRET efficiency.7.6..4.3.2 X2-C/X1-Y X2-C/VCAM-Y.1 1 2 3 Ratio YFP/CFP Supplemental Data 1. Analysis of / heterodimers in live cells using FRET. FRET saturation curves were obtained using cells transiently

More information

Supplementary methods

Supplementary methods Supplementary methods Cell culture, infection, transfection, and RNA interference HEK293 cells and its derivatives were grown in DMEM supplemented with 10% FBS. Various constructs were introduced into

More information

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal

More information

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

SUPPLEMENTAL EXPERIMENTAL PROCEDURES SUPPLEMENTAL EXPERIMENTAL PROCEDURES Luciferase Assays Cells were seeded on 24well plates and grown to 7% confluency. Cells were then transfected with ng of reporter constructs and 1 ng of the renilla

More information

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying

More information

Supplement Figure 1. Plin5 Plin2 Plin1. KDEL-DSRed. Plin-YFP. Merge

Supplement Figure 1. Plin5 Plin2 Plin1. KDEL-DSRed. Plin-YFP. Merge Supplement Figure 1 Plin5 Plin2 Plin1 KDEL-DSRed Plin-YFP Merge Supplement Figure 2 A. Plin5-Ab MitoTracker Merge AML12 B. Plin5-YFP Cytochrome c-cfp merge Supplement Figure 3 Ad.GFP Ad.Plin5 Supplement

More information

Supplementary Figure Legend

Supplementary Figure Legend Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss

More information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Supplementary Figure 1. Characterization and high expression of Lnc-β-Catm in liver CSCs. (a) Heatmap of differently expressed lncrnas in Liver CSCs (CD13 + CD133 + ) and non-cscs (CD13 - CD133 - ) according

More information

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of

More information

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab. / 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice

More information

Protocol for induction of expression and cell lysate production

Protocol for induction of expression and cell lysate production Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected

More information

Supporting Information

Supporting Information Supporting Information Chakrabarty et al. 10.1073/pnas.1018001108 SI Materials and Methods Cell Lines. All cell lines were purchased from the American Type Culture Collection. Media and FBS were purchased

More information

over time using live cell microscopy. The time post infection is indicated in the lower left corner.

over time using live cell microscopy. The time post infection is indicated in the lower left corner. Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Movie 1 Description: Fusion of NBs. BSR cells were infected

More information

Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility

Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility Cell Chemical Biology, Volume 24 Supplemental Information A Versatile Tool for Live-Cell Imaging and Super-Resolution Nanoscopy Studies of HIV-1 Env Distribution and Mobility Volkan Sakin, Janina Hanne,

More information

Actin cap associated focal adhesions and their distinct role in cellular mechanosensing

Actin cap associated focal adhesions and their distinct role in cellular mechanosensing Actin cap associated focal adhesions and their distinct role in cellular mechanosensing Dong-Hwee Kim 1,2, Shyam B. Khatau 1,2, Yunfeng Feng 1,3, Sam Walcott 1,4, Sean X. Sun 1,2,4, Gregory D. Longmore

More information

GFP CCD2 GFP IP:GFP

GFP CCD2 GFP IP:GFP D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant

More information

Regulation of Acetylcholine Receptor Clustering by ADF/Cofilin- Directed Vesicular Trafficking

Regulation of Acetylcholine Receptor Clustering by ADF/Cofilin- Directed Vesicular Trafficking Regulation of Acetylcholine Receptor Clustering by ADF/Cofilin- Directed Vesicular Trafficking Chi Wai Lee, Jianzhong Han, James R. Bamburg, Liang Han, Rachel Lynn, and James Q. Zheng Supplementary Figures

More information

(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site.

(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site. SUPPLEMENTRY INFORMTION SUPPLEMENTL FIGURES Figure S1. () Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site. () Western blot of ligated and unligated sciatic

More information

TE5 KYSE510 TE7 KYSE70 KYSE140

TE5 KYSE510 TE7 KYSE70 KYSE140 TE5 KYSE5 TT KYSE7 KYSE4 Supplementary Figure. Hockey stick plots showing input normalized, rank ordered H3K7ac signals for the candidate SE-associated lncrnas in this study. Rpm Rpm Rpm Chip-seq H3K7ac

More information

Supplementary Figure legends. Supplementary Methods

Supplementary Figure legends. Supplementary Methods Supplementary Methods Transmission electron microscopy. For transmission electron microscopy (TEM), the cell populations were rinsed with 0.1 Sorensen s buffer (ph 7.5), fixed in 2.5% glutaraldehyde for

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

M X 500 µl. M X 1000 µl

M X 500 µl. M X 1000 µl GeneGlide TM sirna Transfection Reagent (Catalog # M1081-300, -500, -1000; Store at 4 C) I. Introduction: BioVision s GeneGlide TM sirna Transfection reagent is a cationic proprietary polymer/lipid formulation,

More information

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics

More information

Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA

Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Feng et al., http://www.jcb.org/cgi/content/full/jcb.201408079/dc1 Figure S1. A modest elevation of disulfide-bonded K14 in primary mouse

More information

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured

More information

Supplemental Material

Supplemental Material Supplemental Material 1 Figure S1. Phylogenetic analysis of Cep72 and Lrrc36, comparative localization of Cep72 and Lrrc36 and Cep72 antibody characterization (A) Phylogenetic alignment of Cep72 and Lrrc36

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and

More information

Hoffmann et al., http ://www.jcb.org /cgi /content /full /jcb /DC1

Hoffmann et al., http ://www.jcb.org /cgi /content /full /jcb /DC1 Supplemental material JCB Hoffmann et al., http ://www.jcb.org /cgi /content /full /jcb.201506071 /DC1 THE JOU RNAL OF CELL BIO LOGY Figure S1. TRA IP harbors a PCNA-binding PIP box required for its recruitment

More information

Supplementary Information

Supplementary Information Supplementary Information Live imaging reveals the dynamics and regulation of mitochondrial nucleoids during the cell cycle in Fucci2-HeLa cells Taeko Sasaki 1, Yoshikatsu Sato 2, Tetsuya Higashiyama 1,2,

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Kanaani et al., http://www.jcb.org/cgi/content/full/jcb.200912101/dc1 Figure S1. The K2 rabbit polyclonal antibody is specific for GAD67,

More information

Focus Application. Cell Migration. Featured Study: Inhibition of Cell Migration by Gene Silencing. xcelligence System Real-Time Cell Analyzer

Focus Application. Cell Migration. Featured Study: Inhibition of Cell Migration by Gene Silencing. xcelligence System Real-Time Cell Analyzer xcelligence System Real-Time Cell Analyzer Focus Application Cell Migration Featured Study: Inhibition of Cell Migration by Gene Silencing Markus Greiner and Richard Zimmermann Department of Medical Biochemistry

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL

by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL Supplementary Materials and methods Neuronal cultures and transfection The hippocampus was dissected from E8 rat embryos, dissociated, and neurons plated onto glass coverslips coated with poly-ornithine

More information

* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm)

* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm) I: p-p9rsk I: p9rsk I: C I: p-p9rsk I: p9rsk 5 (ka) 5 5 (min) Ang II ( nm) p-p9rsk (Ser8) p9rsk p-p9rsk (Ser8) p9rsk (h) Mannitol 5 mm -Glucose 5 mm p9rsk (Ser8) (arbitrary units) p-p9rsk (Ser8) (arbitrary

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary figures Supplementary Figure 1: Suv39h1, but not Suv39h2, promotes HP1α sumoylation in vivo. In vivo HP1α sumoylation assay. Top: experimental scheme. Middle: we

More information

Supplementary figures and tables Table of content

Supplementary figures and tables Table of content Supplementary figures: Supplementary figures and tables Table of content Figure S1: The minimal i model written with BIOCHAM reaction rules. Figure S2: Ordinary differential equation (ODE) set of the model.

More information

Supplemental Material Igreja and Izaurralde 1. CUP promotes deadenylation and inhibits decapping of mrna targets. Catia Igreja and Elisa Izaurralde

Supplemental Material Igreja and Izaurralde 1. CUP promotes deadenylation and inhibits decapping of mrna targets. Catia Igreja and Elisa Izaurralde Supplemental Material Igreja and Izaurralde 1 CUP promotes deadenylation and inhibits decapping of mrna targets Catia Igreja and Elisa Izaurralde Supplemental Materials and methods Functional assays and

More information

HCT116 SW48 Nutlin: p53

HCT116 SW48 Nutlin: p53 Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates

More information

IMMUNOPRECIPITATION TROUBLESHOOTING TIPS

IMMUNOPRECIPITATION TROUBLESHOOTING TIPS IMMUNOPRECIPITATION TROUBLESHOOTING TIPS Creative Diagnostics Abstract Immunoprecipitation (IP) is the technique of precipitating a protein antigen out of solution using an antibody that specifically binds

More information

Immunofluorescence images of different core histones and different histone exchange assay.

Immunofluorescence images of different core histones and different histone exchange assay. Molecular Cell, Volume 51 Supplemental Information Enhanced Chromatin Dynamics by FACT Promotes Transcriptional Restart after UV-Induced DNA Damage Christoffel Dinant, Giannis Ampatziadis-Michailidis,

More information

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary Figure 1 Effect of ROCK inhibition on lumen abnormality in MDCK cysts. (A) MDCK cells as indicated cultured in Matrigel were treated with and without Y27632 (10

More information

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- #1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals

More information

Online Supplementary Information

Online Supplementary Information Online Supplementary Information NLRP4 negatively regulates type I interferon signaling by targeting TBK1 for degradation via E3 ubiquitin ligase DTX4 Jun Cui 1,4,6,7, Yinyin Li 1,5,6,7, Liang Zhu 1, Dan

More information

Gene specific primers. Left border primer (638) ala3-4 (Salk_082157) Gene specific primers. Left border primer (1343)

Gene specific primers. Left border primer (638) ala3-4 (Salk_082157) Gene specific primers. Left border primer (1343) Supplemental Data. Poulsen et al. (2008) The Arabidopsis P4-ATPase pump ALA3 localizes to the Golgi and requires a β subunit to function in lipid translocation and secretory vesicle formation. A ala3-1

More information

The Arabidopsis Transcription Factor BES1 Is a Direct Substrate of MPK6 and Regulates Immunity

The Arabidopsis Transcription Factor BES1 Is a Direct Substrate of MPK6 and Regulates Immunity Supplemental Data The Arabidopsis Transcription Factor BES1 Is a Direct Substrate of MPK6 and Regulates Immunity Authors: Sining Kang, Fan Yang, Lin Li, Huamin Chen, She Chen and Jie Zhang The following

More information

42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2)

42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2) SUPPLEMENTAL DATA Supplementary Experimental Procedures Fluorescence Microscopy - A Zeiss Axiovert 200M microscope equipped with a Zeiss 100x Plan- Apochromat (1.40 NA) DIC objective and Hamamatsu Orca

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

Supplemental Information. Mitophagy Controls the Activities. of Tumor Suppressor p53. to Regulate Hepatic Cancer Stem Cells

Supplemental Information. Mitophagy Controls the Activities. of Tumor Suppressor p53. to Regulate Hepatic Cancer Stem Cells Molecular Cell, Volume 68 Supplemental Information Mitophagy Controls the Activities of Tumor Suppressor to Regulate Hepatic Cancer Stem Cells Kai Liu, Jiyoung Lee, Ja Yeon Kim, Linya Wang, Yongjun Tian,

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Design and sequence of system 1 for targeted demethylation.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Design and sequence of system 1 for targeted demethylation. Supplementary Figure 1 Design and sequence of system 1 for targeted demethylation. (a) Design of system 1 for targeted demethylation. TET1CD was fused to a catalytic inactive Cas9 nuclease (dcas9) and

More information

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),

More information

Supporting Information

Supporting Information Supporting Information Shao et al. 10.1073/pnas.1504837112 SI Materials and Methods Immunofluorescence and Immunoblotting. For immunofluorescence, cells were fixed with 4% paraformaldehyde and permeabilized

More information

Hossain_Supplemental Figure 1

Hossain_Supplemental Figure 1 Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT

More information

Supplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto

Supplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in

More information

Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines

Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines Further information can be found at: http://stke.sciencemag.org/sites/default/files/researcharticlerevmsinstructions_0.pdf.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8

More information

With the ibidi Culture-Insert 2 Well in a µ-dish 35 mm

With the ibidi Culture-Insert 2 Well in a µ-dish 35 mm Wound Healing Assay With the ibidi Culture-Insert 2 Well in a µ-dish 35 mm 1. General information Cell migration plays a central role in many complex physiological and pathological processes. The wound

More information

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2 Molecular Cell, Volume 65 Supplemental Information The TRAIL-Induced Cancer Secretome Promotes a Tumor-Supportive Immune Microenvironment via CCR2 Torsten Hartwig, Antonella Montinaro, Silvia von Karstedt,

More information

Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132

Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132 Neuron, Volume 65 Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132 Dieter Edbauer, Joel R. Neilson, Kelly A. Foster, Chi-Fong Wang, Daniel P. Seeburg, Matthew

More information

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline

More information

Supplementary Information

Supplementary Information Supplementary Information promotes cancer cell invasion and proliferation by receptor-mediated endocytosis-dependent and -independent mechanisms, respectively Kensaku Shojima, Akira Sato, Hideaki Hanaki,

More information

Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat

Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat pups at P6, P14, P22, P30 and adult (A) rats were subjected

More information

Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand

Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin

More information

Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana.

Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana. SUPPLEMENTARY FIGURES Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana. YFP:, :CFP, HA: and (A) and HA, CFP and YFPtagged and AVR1-CO39 (B) were expressed

More information

Supplemental Data. Sun et al. Plant Cell. (2012) /tpc FLS2 -cmyc -GFP FLS2 -HA. FLS2-FLAG FLS2 -HA BAK1-HA flg22 (10mM)

Supplemental Data. Sun et al. Plant Cell. (2012) /tpc FLS2 -cmyc -GFP FLS2 -HA. FLS2-FLAG FLS2 -HA BAK1-HA flg22 (10mM) Supplemental Data. Sun et al. Plant ell. ()..5/tpc..9599 A FLS-FLA FLS -HA BAK-HA flg (mm) - B FLS -cmyc -FP FLS -HA IP antibody cmyc FLA FP cmyc IP ; WB: α-ha IP; WB: α-ha IP: α-fla; WB: α-ha IP ; WB:

More information

Supporting Information

Supporting Information Supporting Information Signal mingle: Micropatterns of BMP-2 and fibronectin on soft biopolymeric films regulate myoblast shape and SMAD signaling. Vincent Fitzpatrick, Laure Fourel, Olivier Destaing,

More information

PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF

PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract

More information

Expanded View Figures

Expanded View Figures EMO Molecular Medicine nolactone inhibits NRG1-ER4 signaling Michael Wehr et al Expanded View Figures Figure EV1. co-culture assay based on the split TEV technique to monitor NRG1-ER4 signaling activity.

More information

T1: Pure spongia-13(16),14-dien-19-oic acid (T1) (514 mg) was obtained from a Spongia sp.

T1: Pure spongia-13(16),14-dien-19-oic acid (T1) (514 mg) was obtained from a Spongia sp. Supplementary Materials and Methods Synthesis of spongian diterpenoids T1: Pure spongia-13(16),14-dien-19-oic acid (T1) (514 mg) was obtained from a Spongia sp. (sample # 47612) as follows. 45 g dry weight

More information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

More information

SUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement

SUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement SUPPLEMENTAL MATERIAL Supplemental Methods Reagents Cumate solution was from System Biosciences. Human complement Cq and complement C-esterase inhibitor (C-INH) were from Calbiochem. C-INH (Berinert) for

More information

Analysis of receptor oligomerization by FRAP microscopy

Analysis of receptor oligomerization by FRAP microscopy TIGP CBMB Student Seminar Analysis of receptor oligomerization by FRAP microscopy Dorsch S, Klotz KN, Engelhardt S, Lohse MJ, Bünemann M Nat Methods. 2009 Mar;6(3):225 30. K. Vijayasarathy March 10 th

More information

Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer

Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer Author's response to reviews Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer Authors: Hannah Jörißen (hannah.joerissen@molbiotech.rwth-aachen.de)

More information

Mouse IFNAR1 ELISA Pair Set

Mouse IFNAR1 ELISA Pair Set Mouse IFNAR1 ELISA Pair Set Catalog Number : SEK50469 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in the General ELISA

More information

Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer

Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer containing 10% serum The data error bars indicate means

More information

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt

More information

SureSilencing sirna Array Technology Overview

SureSilencing sirna Array Technology Overview SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference

More information

Khaled_Fig. S MITF TYROSINASE R²= MITF PDE4D R²= Variance from mean mrna expression

Khaled_Fig. S MITF TYROSINASE R²= MITF PDE4D R²= Variance from mean mrna expression Khaled_Fig. S Variance from mean mrna expression.8 2 MITF.6 TYROSINASE.4 R²=.73.2.8.6.4.2.8.6.4.2.8.6.4.2 MALME3M SKMEL28 UACC257 MITF PDE4D R²=.63 4.5 5 MITF 3.5 4 PDE4B 2.5 3 R²=.2.5 2.5.8.6.4.2.8.6.4.2

More information

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative

More information

Nature Immunology: doi: /ni.3101

Nature Immunology: doi: /ni.3101 Supplementary Figure 1 Generation of Plvap / mice. (a) Schematic presentation of the targeting construct as well as the wild-type and targeted Plvap alleles]. PuroR, puromycin resistance. The location

More information

affects the development of newborn neurons Brain Mind Institute and School of Life Sciences, Ecole Polytechnique Fédérale de

affects the development of newborn neurons Brain Mind Institute and School of Life Sciences, Ecole Polytechnique Fédérale de Shedding of neurexin 3β ectodomain by ADAM10 releases a soluble fragment that affects the development of newborn neurons Erika Borcel* a, Magda Palczynska* a, Marine Krzisch b, Mitko Dimitrov a, Giorgio

More information

Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss

Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss SUPPLEMENTARY INFORMATION Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss Yunjong Lee, Senthilkumar S. Karuppagounder, Joo-Ho Shin, Yun-Il Lee, Han Seok Ko, Debbie Swing,

More information