Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility
|
|
- Cecily Thomas
- 6 years ago
- Views:
Transcription
1 Cell Chemical Biology, Volume 24 Supplemental Information A Versatile Tool for Live-Cell Imaging and Super-Resolution Nanoscopy Studies of HIV-1 Env Distribution and Mobility Volkan Sakin, Janina Hanne, Jessica Dunder, Maria Anders-Össwein, Vibor Laketa, Ivana Nikic, Hans-Georg Kräusslich, Edward A. Lemke, and Barbara Müller
2 Supplementary data Figure S1: Amber suppression in HEK293T cells using an optimized test construct. Extended data to main Figure 1. Cells were transfected with pmcherryegfp Y39TAG. Where indicated (+), ptrna pyl /pylrs AF was co-transfected and 250 µm BCN-Lys was added to the growth medium. At 40 h.p.t. cell lysates were harvested and analyzed by quantitative immunoblotting using polyclonal rabbit antiserum raised against recombinant egfp. Band intensities were quantitated; numbers given below the lanes indicate the proportion of full length protein band intensity determined relative to the total intensity of antibody reactive bands.
3 Figure S2: Quantitative comparison of Env (WT) and Env407 ncaa amounts on the plasma membrane by confocal microscopy. Extended data to main Figures 2 and 5. (A) The experiment was performed as in Figure 5C; cells were grown in the presence of BCN-Lys. Images were recorded by SDCM. Identical settings were used for recording of all images and image representation to allow for visual comparison of
4 staining intensities. Shown are three examples each for Env407 ncaa (rows 1-3) and Env(wt) (rows 4-6) expressing cells, representing the observed range of staining intensities on the plasma membrane on individual cells in the respective samples. Cyan, Hoechst staining; magenta, AlexaFluor488; yellow, H-Tet-Cy5. Scale bars: 10 m. (B) Quantification of the intensity of Env(wt) and Env407 ncaa immunostaining on the plasma membrane. Each dot represents a mean fluorescence intensity of the Alexa488 signal for all cells in a microscopic field of view; the magenta line shows the median fluorescence intensity for all fields analyzed. To measure the mean fluorescence intensity per field of view, the systematic camera offset (offset=2100) was subtracted, followed by automated segmentation of the Alexa488 signal using Niblack algorithm (radius = 10px, parameter 1 = 0, parameter 2 = -40) and FIJI image analysis software. Large unspecific clusters of Alexa488 not associated with cells were filtered out manually. A minimum of 20 images comprising >200 cells in total were analysed per condition. Statistical significance was assessed using a Mann- Whitney U-test (p-value < ).
5 Figure S3: Quantitative comparison of Env (WT) and Env407 ncaa amounts on the plasma membrane analyzed by flow cytometry. Extended data to main figure 2. HEK293T cells were co-transfected with pcdna3.1, penv(wt) or penv407 TAG together with ptrna pyl /pylrs AF and perf1 (E55D) in the presence or absence of 250 M BCN-Lys. At 40 h.p.t., cells were resuspended in PBS, fixed briefly (PFA, 10 min at RT) and immunostained using gp120 antibody 2G12 followed by AlexaFluor488- coupled secondary antibody. Cell-associated fluorescence was measured for
6 cells in each sample by flow cytometry using a BD FACSVerse TM instrument, and data were analyzed using FlowJo (FlowJo, LLC, USA) software. AlexaFluor488 staining was detected in the FITC-A channel. The figure shows dot plots from one representative experiment; the percentages and the mean fluorescence intensity (MFI) values of the gated populations are highlighted. Three independent experiments yielded mean MFI values of 7718+/-1564 and 5642+/-1745 for Env WT and Env 407 ncaa, respectively.
7 Figure S4: HIV-1 particles carrying engineered Env BCN-Lys retain single-round infectivity on TZM-bl cells (A) HEK293T cells were co-transfected with the proviral plasmid pnl4-3 Env-), the indicated Env TAG expression plasmids together with ptrna pyl /pylrs AF (+) or empty vector (-) as indicated and grown in the presence or absence of 250 µm BCN-Lys. At 40 h.p.t., virus particles were concentrated from the tissue culture supernatant by ultracentrifugation through a 20% (w/v) sucrose cushion. Relative infectivity was analyzed by titration on TZM-bl indicator cells as described in STAR methods. Values were normalized to the amount of CA protein determined by quantitative immunoblotting. The graph shows mean values and SEM from three independent experiments. (B-C) Immunoblot analysis of samples. At 40 h.p.t. cell lysates were harvested and viral particles were pelleted from the tissue culture supernatant by ultracentrifugation through a sucrose pellet. Immunoblot analysis of cell lysates (B) and virus particles (C) was performed using the indicated
8 polyclonal antisera. The volumes of cell lysate loaded in B were adjusted to account for different expression levels (variant samples 1-6: wt samples 7-10 = 2.5: 1). Numbers above the lanes refer to the experimental conditions shown in A. See main Figure 4 for an experiment carried out in the presence of erf1 (E55D)
9 Figure S5: Structures of non-canonical amino acids and tetrazinefunctionalized dyes used in this study. (A) Non-canonical amino acids: endo Bicyclo [6.1.0] nonyne-l-lysine (BCN-Lys), strained cyclooctyne-l-lysine (SCO-Lys) and axial trans-cyclooct-2-ene-l-lysine (TCO*-Lys). (B) Tetrazine-functionalized dyes: 3-(p-Benzylamino)-1,2,4,5-tetrazine-Cy5 (H-Tet-Cy5) and H-Tet-KK114 (Sednev MV et al., Bioconjug Chem 24: , 2013)
10 Figure S6: Click-labeling of Env407 ncaa variants analyzed by in-gel fluorescence. Complete images corresponding to the cropped images shown as main Figure 5A analyzed by in-gel fluorescence (A) and immunoblotting (B). Background observed by in-gel fluorescence was low, with exception of a band with an apparent molecular mass of ~48 kda. Immunoblot analysis (B) using polyclonal rat antiserum raised against recombinant PylRS and secondary antibody IRDye 680 rat IgG (red), together with polyclonal gp120 antibody and secondary antibody IRDye 800CW donkey rabbit IgG (green) suggested that the additional band observed by in-gel fluorescence corresponded to the overexpressed orthogonal PylRS, presumably released from dead cells, bound to Cy5-coupled ncaa.
11 Figure S7: Individual recovery curves of FRAP analysis of click-labeled Env at the plasma membrane. HEK293T cells were co-transfected with penv407 TAG, ptrna pyl /pylrs AF and perf1 (E55D) and grown in the presence of 250 M BCN-Lys. At 40 h.p.t. cells were labeled with 2 M H-Tet-Cy5 as described in STAR methods and live-cell SDCM imaging was performed. Initial movie sequences were recorded for 3 s, followed by photobleaching. Subsequently, fluorescence recovery was recorded for 10 s. The recovery curves show the fluorescence intensities recorded over time after photobleaching from five different cells. Fluorescence recovery data were fitted to a single exponential association equation (magenta curves). The halftimes and mobile fractions were calculated from the exponential fits. Main Figure 6B shows averaged data from these individual measurements.
12 Supplementary movie S1: Time lapse microscopy of the fluorescence recovery of click labeled HIV-1 Env. The full movie is for the same experiment described in main Figure 6A. The video is played with a rate of 20 frames/s.
over time using live cell microscopy. The time post infection is indicated in the lower left corner.
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Movie 1 Description: Fusion of NBs. BSR cells were infected
More informationFigure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse
Figure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse stabilin-1, or mouse stabilin-2 were immunoblotted using anti
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rainero et al., http://www.jcb.org/cgi/content/full/jcb.201109112/dc1 Figure S1. The expression of DGK- is reduced upon transfection
More informationNo wash 2 Washes 2 Days ** ** IgG-bead phagocytosis (%)
Supplementary Figures Supplementary Figure 1. No wash 2 Washes 2 Days Tat Control ** ** 2 4 6 8 IgG-bead phagocytosis (%) Supplementary Figure 1. Reversibility of phagocytosis inhibition by Tat. Human
More informationX2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP
FRET efficiency.7.6..4.3.2 X2-C/X1-Y X2-C/VCAM-Y.1 1 2 3 Ratio YFP/CFP Supplemental Data 1. Analysis of / heterodimers in live cells using FRET. FRET saturation curves were obtained using cells transiently
More informationSupplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1
Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 a His-ORMDL3 ~ 17 His-ORMDL3 GST-ORMDL3 - + - + IPTG GST-ORMDL3 ~ b Integrated Density (ORMDL3/ -actin) 0.4 0.3 0.2 0.1
More informationSupplementary Figure 1. Two activation pathways and four conformations of β 2 integrins. KIM127 (red) can specifically detect
Supplementary Figure 1 Two activation pathways and four conformations of β 2 integrins. KIM127 (red) can specifically detect integrin extension (E + ) and mab24 (green) can specifically detect headpiece-opening
More informationSarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
More informationVisualizing mechanical tension across membrane receptors with a fluorescent sensor
Nature Methods Visualizing mechanical tension across membrane receptors with a fluorescent sensor Daniel R. Stabley, Carol Jurchenko, Stephen S. Marshall, Khalid S. Salaita Supplementary Figure 1 Fabrication
More informationTo examine the silencing effects of Celsr3 shrna, we co transfected 293T cells with expression
Supplemental figures Supplemental Figure. 1. Silencing expression of Celsr3 by shrna. To examine the silencing effects of Celsr3 shrna, we co transfected 293T cells with expression plasmids for the shrna
More informationSupplementary Figure 1. Drawing of spinal cord open-book preparations and DiI tracing. Nature Neuroscience: doi: /nn.3893
Supplementary Figure 1 Drawing of spinal cord open-book preparations and DiI tracing. Supplementary Figure 2 In ovo electroporation of dominant-negative PlexinA1 in commissural neurons induces midline
More informationSupplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with
Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with concentration of 800nM) were incubated with 1mM dgtp for the indicated
More informationFigure legends for supplement
Figure legends for supplement Supplemental Figure 1 Characterization of purified and recombinant proteins Relevant fractions related the final stage of the purification protocol(bingham et al., 1998; Toba
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact
More informationColeman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
More informationDCLK-immunopositive. Bars, 100 µm for B, 50 µm for C.
Supplementary Figure S1. Characterization of rabbit polyclonal anti-dclk antibody. (A) Immunoblotting of COS7 cells transfected with DCLK1-GFP and DCLK2-GFP expression plasmids probed with anti-dclk antibody
More informationSupplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
More information(a) Immunoblotting to show the migration position of Flag-tagged MAVS
Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing
More informationJCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Hong et al.,
Supplemental material JCB Hong et al., http://www.jcb.org/cgi/content/full/jcb.201412127/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Analysis of purified proteins by SDS-PAGE and pull-down assays. (A) Coomassie-stained
More informationJCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Prospéri et al.,
Supplemental material JCB Prospéri et al., http://www.jcb.org/cgi/content/full/jcb.201501018/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Myo1b Tail interacts with YFP-EphB2 coated beads and genistein inhibits
More informationVERIFY Tagged Antigen. Validation Data
VERIFY Tagged Antigen Validation Data Antibody Validation Figure 1. Over-expression cell lysate for human STAT3 (NM_139276) was used to test 3 commercial antibodies. Antibody A shows strong antigen binding.
More informationNature Structural & Molecular Biology: doi: /nsmb.1583
Acetylation by GCN5 regulates CDC6 phosphorylation in the S-phase of the cell cycle Roberta Paolinelli 1,2, Ramiro Mendoza-Maldonado 2, Anna Cereseto 1 and Mauro Giacca 2 1 Molecular Biology Laboratory,
More informationSupplementary methods
Supplementary methods Cell culture, infection, transfection, and RNA interference HEK293 cells and its derivatives were grown in DMEM supplemented with 10% FBS. Various constructs were introduced into
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3363 Supplementary Figure 1 Several WNTs bind to the extracellular domains of PKD1. (a) HEK293T cells were co-transfected with indicated plasmids. Flag-tagged proteins were immunoprecipiated
More informationCytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of
Supplementary Information Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Syntaxin 1 and SNAP-25 in Neuron Survival Lisheng Peng, Huisheng Liu, Hongyu Ruan, William H. Tepp, William H. Stoothoff,
More informationPanx2 expression modulates neuronal differentiation SUPPLEMENTAL DATA. Figure Legends
Panx2 expression modulates neuronal differentiation SUPPLEMENTAL DATA Figure Legends Suppl. Fig. S1. Antigenic determinants of the Panx2 antibodies employed in this study. (A) Schematic of mouse Panx2
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Conserved arginines on the rim of Hfq catalyze base pair formation and exchange Subrata Panja and Sarah A. Woodson T.C. Jenkins Department of Biophysics, Johns Hopkins University,
More informationCleavage of tau by asparagine endopeptidase mediates the neurofibrillary pathology in
Supplementary information Cleavage of tau by asparagine endopeptidase mediates the neurofibrillary pathology in Alzheimer s disease Zhentao Zhang, Mingke Song, Xia Liu, Seong Su Kang, Il-Sun Kwon, Duc
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Moutin et al., http://www.jcb.org/cgi/content/full/jcb.201110101/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Tagged Homer1a and Homer are functional and display different
More informationSupplementary Information
Supplementary Information Supplementary Figure 1: Over-expression of CD300f in NIH3T3 cells enhances their capacity to phagocytize AC. (a) NIH3T3 cells were stably transduced by EV, CD300f WT or CD300f
More informationSupplementary Material
Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Feng et al., http://www.jcb.org/cgi/content/full/jcb.201408079/dc1 Figure S1. A modest elevation of disulfide-bonded K14 in primary mouse
More informationSupplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1.
Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Percent of original fluorescence was plotted as a function of time following photobleaching
More informationFast, three-dimensional super-resolution imaging of live cells
Nature Methods Fast, three-dimensional super-resolution imaging of live cells Sara A Jones, Sang-Hee Shim, Jiang He & Xiaowei Zhuang Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3
More informationSUPPLEMENTARY INFORMATION FILE
SUPPLEMENTARY INFORMATION FILE Existence of a microrna pathway in anucleate platelets Patricia Landry, Isabelle Plante, Dominique L. Ouellet, Marjorie P. Perron, Guy Rousseau & Patrick Provost 1. SUPPLEMENTARY
More informationSupplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides
Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides targeting RCP (SMARTPool (RCP) or two individual oligos (RCP#1
More informationGenome-wide CRISPR screen reveals novel host factors required for Staphylococcus aureus α-hemolysin-mediated toxicity
Genome-wide CRISPR screen reveals novel host factors required for Staphylococcus aureus α-hemolysin-mediated toxicity Sebastian Virreira Winter, Arturo Zychlinsky and Bart W. Bardoel Department of Cellular
More informationElectric Supplement Information
Electric Supplement Information Preparation of DNA-AuNPs Thiol-modified oligonucleotide (5 -Cy5- ATCTCGGCTCTGCTAGCGAAAAAAAAAA-(C3H6)-SH-3, 5 15.5 OD) was added to 13 nm citrate-stabilized AuNPs (~3 nmol
More informationSupplementary Information. A novel human endogenous retroviral protein inhibits cell-cell fusion. Supplementary Figures:
Supplementary Information A novel human endogenous retroviral protein inhibits cell-cell fusion Jun Sugimoto, Makiko Sugimoto, Helene Bernstein, Yoshihiro Jinno and Danny J. Schust Supplementary Figures:
More informationPhenotypic lentivirus screens to identify functional single domain antibodies
ARTICLE NUMBER: 16080 DOI: 10.1038/NMICROBIOL.2016.80 Phenotypic lentivirus screens to identify functional single domain antibodies Florian I. Schmidt, Leo Hanke, Benjamin Morin, Rebeccah Brewer, Vesna
More informationSupplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide,
Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, conjugated with either TAT or Myristic acid and biotin for
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Bays et al., http://www.jcb.org/cgi/content/full/jcb.201309092/dc1 Figure S1. Specificity of the phospho-y822 antibody. (A) Total cell
More informationSupplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.
Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Kanaani et al., http://www.jcb.org/cgi/content/full/jcb.200912101/dc1 Figure S1. The K2 rabbit polyclonal antibody is specific for GAD67,
More informationDirect Imaging of APP Proteolysis in Living Cells
Direct Imaging of APP Proteolysis in Living Cells Niccoló Parenti, Ambra Del Grosso, Claudia Antoni, Marco Cecchini, Renato Corradetti, Francesco S. Pavone, Martino Calamai Supplementary Information Supplementary
More informationCD93 and dystroglycan cooperation in human endothelial cell adhesion and migration
/, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing
More informationSUPPLEMENTARY INFORMATION. Tolerance of a knotted near infrared fluorescent protein to random circular permutation
SUPPLEMENTARY INFORMATION Tolerance of a knotted near infrared fluorescent protein to random circular permutation Naresh Pandey 1,3, Brianna E. Kuypers 2,4, Barbara Nassif 1, Emily E. Thomas 1,3, Razan
More informationSegments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
More informationAoki et al.,
JCB: SUPPLEMENTAL MATERIAL Aoki et al., http://www.jcb.org/cgi/content/full/jcb.200609017/dc1 Supplemental materials and methods Calculation of the raw number of translocated proteins First, the average
More informationBcl-2 family member Bcl-G is not a pro-apoptotic BH3-only protein
Bcl-2 family member Bcl-G is not a pro-apoptotic BH3-only protein Maybelline Giam 1,2, Toru Okamoto 1,2,3, Justine D. Mintern 1,2,4, Andreas Strasser 1,2 and Philippe Bouillet 1, 2 1 The Walter and Eliza
More informationPolyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous
Preparation and purification of polyclonal antibodies Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous injections of glutathione S-transferase-ARHGAP25-(509-619) (GST-coiled
More informationSUPPLEMENTARY INFORMATION
ARTICLE NUMBER: 0 DOI: 0.0/NMICROBIOL.0. The host protein CLUH participates in the subnuclear transport of influenza virus ribonucleoprotein complexes Tomomi Ando,, Seiya Yamayoshi, Yuriko Tomita,, Shinji
More informationCycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney
1 Supplementary text and data for: 2 3 4 5 Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney Authors: David A. D. Munro 1*, Peter Hohenstein 2, and Jamie A.
More informationSupplementary Figure 1 Autoaggregation of E. coli W3110 in presence of native
Supplementary Figure 1 Autoaggregation of E. coli W3110 in presence of native Ag43 phase variation depends on Ag43, motility, chemotaxis and AI-2 sensing. Cells were grown to OD600 of 0.6 at 37 C and aggregation
More informationSupplemental Table 1: Sequences of real time PCR primers. Primers were intronspanning
Symbol Accession Number Sense-primer (5-3 ) Antisense-primer (5-3 ) T a C ACTB NM_001101.3 CCAGAGGCGTACAGGGATAG CCAACCGCGAGAAGATGA 57 HSD3B2 NM_000198.3 CTTGGACAAGGCCTTCAGAC TCAAGTACAGTCAGCTTGGTCCT 60
More informationGrb2-Mediated Alteration in the Trafficking of AβPP: Insights from Grb2-AICD Interaction
Journal of Alzheimer s Disease 20 (2010) 1 9 1 IOS Press Supplementary Material Grb2-Mediated Alteration in the Trafficking of AβPP: Insights from Grb2-AICD Interaction Mithu Raychaudhuri and Debashis
More informationA) B) Ladder. Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical
A) B) Ladder C) r4 r4 Nt- -Ct 78 kda Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical calpains is shown. The protease core consists of
More informationBeta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand
SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin
More informationAdenoviral Expression Systems. Lentivirus is not the only choice for gene delivery. Adeno-X
Adenoviral Expression Systems Lentivirus is not the only choice for gene delivery 3 Adeno-X Why choose adenoviral gene delivery? Table I: Adenoviral vs. Lentiviral Gene Delivery Lentivirus Adenovirus Infects
More informationXu et al., Supplementary Figures 1-7
Xu et al., Supplementary Figures 1-7 Supplementary Figure 1. PIPKI is required for ciliogenesis. (a) PIPKI localizes at the basal body of primary cilium. RPE-1 cells treated with two sirnas targeting to
More informationSupplementary Figure 1. Effect of FRC-specific ablation of Myd88 on PP and mln organization.
Supplementary Figure 1 Effect of FRC-specific ablation of Myd88 on PP and mln organization. (a) PP numbers in 8 10 week old Cre-negative littermate (Ctrl) and Myd88-cKO mice (n = 11 mice; each dot represents
More information0.5% Triton X-100 for 5 min at room temperature. Fixed and permeabilized cells were
1 Supplementary Methods Immunohistochemistry EBC-1 cells were fixed in 4% paraformaldehyde for 15 min at room temperature, followed by 0.5% Triton X-100 for 5 min at room temperature. Fixed and permeabilized
More information- PDI5. - Actin A 300-UTR5. PDI5 lines WT. Arabidopsis Chromosome 1. PDI5 (At1g21750) SALK_ SALK_ SALK_015253
Supplemental Data. Ondzighi et al. (2008). Arabidopsis Protein Disulfide Isomerase-5 Inhibits ysteine Proteases During Trafficking to Vacuoles Prior to Programmed ell Death of the dothelium in Developing
More informationSupplementary Figure 1. Serial deletion mutants of BLITz.
Supplementary Figure 1 Serial deletion mutants of BLITz. (a) Design of TEVseq insertion into J -helix. C-terminal end of J -helix was serially deleted and replaced by TEVseq. TEV cleavage site is labeled
More informationSupplemental material and methods
Supplemental material and methods Antibodies: Primary antibodies used for these stainings were 174/2 1 (migg1 against PV-1), PAL-E 2 (migg2a; Abcam, Cambridge, UK), anti-nrp-1 (monoclonal migg2a or polyclonal
More informationSolutions to 7.02 Quiz II 10/27/05
Solutions to 7.02 Quiz II 10/27/05 Class Average = 83 Standard Deviation = 9 Range Grade % 87-100 A 43 74-86 B 39 55-73 C 17 > 54 D 1 Question 1 (56 points) While studying deep sea bacteria, you discover
More informationSupporting information
Supporting information Construction of strains and plasmids To create ptc67, a PCR product obtained with primers cc2570-162f (gcatgggcaagcttgaggacggcgtcatgt) and cc2570+512f (gaggccgtggtaccatagaggcgggcg),
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Craft et al., http://www.jcb.org/cgi/content/full/jcb.201409036/dc1 Figure S1. GFP -tubulin interacts with endogenous -tubulin. Ciliary
More informationSupplemental material
Supplemental material THE JOURNAL OF CELL BIOLOGY Gillespie et al., http://www.jcb.org/cgi/content/full/jcb.200907037/dc1 repressor complex induced by p38- Gillespie et al. Figure S1. Reduced fiber size
More informationPE11, a PE/PPE family protein of Mycobacterium tuberculosis is involved in cell wall remodeling and virulence
PE11, a PE/PPE family protein of Mycobacterium tuberculosis is involved in cell wall remodeling and virulence Parul Singh 1,2, Rameshwaram Nagender Rao 1, Jala Ram Chandra Reddy 3, R.B.N. Prasad 3, Sandeep
More informationmcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Details
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationOn-chip microbial culture for the specific detection of very low levels of bacteria. Supplementary Information
On-chip microbial culture for the specific detection of very low levels of bacteria Sihem Bouguelia, Yoann Roupioz, Sami Slimani, Laure Mondani, Guillermina Casabona, Claire Durmort, Thierry Vernet, Roberto
More informationAntibodies used in this study Figure S1. Akt expression in neutrophils from WT and individual Akt isoform knockout mice
ntibodies used in this study The anti β-actin monoclonal antibody (Sigma-ldrich, St. Louis, MO) was generated against a slightly modified human β-actin N-terminal peptide, c-sp-sp-sp-ile-la-la-leu-val-ile-
More informationSupplementary material to Alterations in the properties of the cell membrane due to glycosphingolipid accumulation in a model of Gaucher disease
Supplementary material to Alterations in the properties of the cell membrane due to glycosphingolipid accumulation in a model of Gaucher disease Gyula Batta, Lilla Soltész, Tamás Kovács, Tamás Bozó, Zoltán
More informationFigure S1 early log mid log late log stat.
Figure S1 early log mid log late log stat. C D E F Fig. S1. The chromosome-expressed EI localizes to the cell poles independent of the growth phase and growth media. MG1655 (ptsi-mcherry) cells, which
More information(phosphatase tensin) domain is shown in dark gray, the FH1 domain in black, and the
Supplemental Figure 1. Predicted Domain Organization of the AFH14 Protein. (A) Schematic representation of the predicted domain organization of AFH14. The PTEN (phosphatase tensin) domain is shown in dark
More informationRecruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells
SUPPLEMENTARY FIGURES Recruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells Niklas Engels, Lars Morten König, Christina Heemann, Johannes
More informationSupplemental Materials and Methods
Supplemental Materials and Methods In situ hybridization In situ hybridization analysis of HFE2 and genin mrna in rat liver tissues was performed as previously described (1). Briefly, the digoxigenin-labeled
More informationXiaoqing Zhang, Guo Zhang, Hai Zhang, Michael Karin, Hua Bai, and Dongsheng Cai
Cell, Volume 135 Supplemental Data Hypothalamic IKKβ/NF-κB and ER Stress Link Overnutrition to Energy Imbalance and Obesity Xiaoqing Zhang, Guo Zhang, Hai Zhang, Michael Karin, Hua Bai, and Dongsheng Cai
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationSupplementary Materials for
www.advances.sciencemag.org/cgi/content/full/1/7/e1500454/dc1 Supplementary Materials for CRISPR-Cas9 delivery to hard-to-transfect cells via membrane deformation Xin Han, Zongbin Liu, Myeong chan Jo,
More informationDevelop Better Assays for Every Human Protein
Develop Better Assays for Every Human Protein OriGene overview Application of transfected over-expression lysates Application of purified recombinant human proteins About OriGene Started in1996 with the
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Activation capacity of tettale-ad compared to tet trans-activator (ttas) using different teto variants. (A) HeLa cells were co-transfected with activation
More informationSupplementary Information. Human Antibody-Based Chemically Induced Dimerizers for Cell Therapeutic Applications
Supplementary Information Human Antibody-Based Chemically Induced Dimerizers for Cell Therapeutic Applications Zachary B Hill 1,4, Alexander J Martinko 1,2,4, Duy P Nguyen 1 & James A Wells *1,3 1 Department
More informationPHF20 is an effector protein of p53 double lysine methylation
SUPPLEMENTARY INFORMATION PHF20 is an effector protein of p53 double lysine methylation that stabilizes and activates p53 Gaofeng Cui 1, Sungman Park 2, Aimee I Badeaux 3, Donghwa Kim 2, Joseph Lee 1,
More informationSingle cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor
SUPPLEMENTARY INFORMATION Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor Anna Turetsky 1,a, Eunha Kim 1,a, Rainer H. Kohler 1, Miles A. Miller 1, Ralph Weissleder 1,2,
More informationSupplementary Information
Supplementary Information Figure S1. Transiently overexpressed ECFP-TIAF1/EYFP-TIAF1 causes apoptosis of Mv1Lu cells. Mv1Lu cells were transfected by electroporation with ECFP, EYFP, ECFP-TIAF1, EYFP-
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10016 Supplementary discussion on binding site density for protein complexes on the surface: The density of biotin sites on the chip is ~10 3 biotin-peg per µm 2. The biotin sites are
More informationSUPPORTING INFORMATION
Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 2015 Terbium-Based Time-Gated Förster Resonance Energy Transfer Imaging for Evaluating Protein-Protein
More information42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2)
SUPPLEMENTAL DATA Supplementary Experimental Procedures Fluorescence Microscopy - A Zeiss Axiovert 200M microscope equipped with a Zeiss 100x Plan- Apochromat (1.40 NA) DIC objective and Hamamatsu Orca
More informationRer1 and calnexin regulate endoplasmic reticulum retention of a peripheral myelin protein 22 mutant that causes type 1A Charcot-Marie-Tooth disease
Rer1 and calnexin regulate endoplasmic reticulum retention of a peripheral myelin protein mutant that causes type 1A Charcot-Marie-Tooth disease Taichi Hara, Yukiko Hashimoto, Tomoko Akuzawa, Rika Hirai,
More information*Corresponding author. Tel: ;
1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland
More informationp53 increases MHC class I expression by upregulating the endoplasmic reticulum aminopeptidase ERAP1
Supplementary Information p53 increases MHC class I expression by upregulating the endoplasmic reticulum aminopeptidase ERAP1 Bei Wang 1, Dandan Niu 1, Liyun Lai 1, & Ee Chee Ren 1,2 1 Singapore Immunology
More informationFig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
More information11/19/2013. Janine Zankl FACS Core Facility 13. November Cellular Parameters. Cellular Parameters. Monocytes. Granulocytes.
DEPARTEMENT BIOZENTRUM Janine Zankl FACS Core Facility 13. November 2013 Cellular Parameters Granulocytes Monocytes Basophils Neutrophils Lymphocytes Eosinophils Cellular Parameters 1 What Is Flow Cytometry?
More informationa. Increased active HPSE (50 kda) protein expression upon infection with multiple herpes viruses: bovine
Fold change vs uninfeced MOI 0.1 MOI 1 MOI 0.1 MOI 1 MOI 0.001 MOI 0.01 Fold change vs uninfected a 6 4 2 50 kda HPSE * ** * * BHV PRV HSV-2 333 ** * 0 - + + - + + - + + b 50 kda HPSE 3 2 ** *** mock inf
More informationH3K36me3 polyclonal antibody
H3K36me3 polyclonal antibody Cat. No. C15410192 Type: Polyclonal ChIP-grade/ChIP-seq grade Source: Rabbit Lot #: A1845P Size: 50 µg/32 µl Concentration: 1.6 μg/μl Specificity: Human, mouse, Arabidopsis,
More information