Optimization of site-specific RNase H cutting of 1037 nt renilla luciferase mrna. The digestion

Size: px
Start display at page:

Download "Optimization of site-specific RNase H cutting of 1037 nt renilla luciferase mrna. The digestion"

Transcription

1 SUPPLEMENTARY FIGURE 1. Optimization of site-specific RNase H cutting of 1037 nt renilla luciferase mrna. The digestion mixture was incubated at 37 C for 0 to 120 minutes. The cutting was nearly complete in minutes. 1

2 SUPPLEMENTARY FIGURE 2. Pre-ligation complex formation between a 40 nt DNA splint (1x molar) and two 20 nt RNA oligonucleotides (1x and 1.2x molar) in different buffer and annealing conditions. The sequences of the DNA splint and RNA oligonucleotides mimick the firefly luciferase mrna sequence at the ligation site defined in Figure 2A. The gel is native PAGE. Lane 1: the DNA splint; lane 2: the two RNA oligonucleotides; lane 3: pre-ligation complex formation by incubation in water at room temperature; lanes 4-10: pre-ligation complex formation by annealing in H 2 O (lane 4), TE (lane 5), TE + 200mM NaCl (lane 6), TE + 75mM LiCl (lane 7), TE + 45% formamide (lane 8), T4 RNA ligase 2 buffer (lane 9), and T4 DNA ligase buffer (lane 10). The pre-ligation complex formation was complete and stable in all tested conditions. 2

3 SUPPLEMENTARY FIGURE 3. Titration of DNA splint molar ratio for the pre-ligation complex formation between 92 nt and 295 nt RNA substrates and a 60 nt DNA splint (upper panel) or a 40 nt DNA splint (lower panel). The 92 nt and 295 nt RNA substrates were at 5:1 (upper panel) or 1:1 (lower panel) molar ratio. Both gels were native PAGE. In both cases, the highest efficiency of pre-ligation complex formation was obtained at around 1 molar ratio of DNA splint. Overall, the extent of preligation complex formation was rather limited for these long RNAs, in contrast to the complete annealing observed for oligonucleotides shown in Supplementary Figure 2. 3

4 SUPPLEMENTARY FIGURE 4. Annealing and ligation of 92 nt and 295 nt RNA fragments using a 60nt DNA splint in different buffer conditions. The RNA fragments and DNA splint were at equimolar ratio. The highest ligation efficiency of approximately 38% was observed for T4 RNA ligase 2 buffer. 4

5 SUPPLEMENTARY FIGURE 5. Cooling speed during annealing does not affect the ligation efficiency of 92 nt and 295 nt RNA fragments, as shown by denaturing PAGE. For annealing, all annealing mixtures were heated to 85 C for 30 seconds, and cooled from 85 C to 4 C with the specified cooling speed. 5

6 SUPPLEMENTARY FIGURE 6. GMP incorporation efficiency during in vitro transcription characteried by XRN-1 digestion. A 295 nt RNA with mono-phosphate group at the 5 end was made by in vitro transcription reaction supplemented with 20 excess of GMP over GTP. XRN-1 (1U/μg) digestion of this RNA (upper gel) is 95% complete after 60 minutes of incubation (lane 4), indicating efficient GMP incorporation at the 5 end. As a control, triphosphorylated RNA (lower gel) is not affected by XRN-1. 6

7 SUPPLEMENTARY FIGURE 7. Ligation of the 1.9 kb firefly luciferase mrna using a 40 nt long DNA splint and different combinations of DNA proximal disruptors. The experiment was identical to Figure 4, except that a 40 nt (vs. 60 nt) long DNA splint was used here for ligation. 7

8 SUPPLEMENTARY FIGURE 8. Quantification (lower right panel) of acrylamide-urea gel (SYBR Green II and Cy5 channels, left panels) for the single-step three-part ligation (upper right panel) for assembling the 1.9 kb firefly luciferase mrna. Additional information is shown in Figure 5 and Table 1. 8

9 SUPPLEMENTARY TABLE 1. Oligonucleotides used for ProDAL of kb-long RNAs. PCR primers for generating DNA templates for in vitro T7 transcription DNA splints used for ligation RNA insert DNA proximal disruptors used for ligation Oligonucleotides used for RNase H cutting Identity and purpose forward for 574 nt firefly fragment reverse for 574 nt firefly fragment forward for 1313 nt firefly fragment reverse for 1313 nt firefly fragment 40 nt splint for firefly * 60 nt splint for firefly 60 nt splint for firefly * 60 nt splint for renilla * 80 nt splint for firefly with 20 nt RNA insert 80 nt splint for firefly with 20 nt Cy5 RNA insert 20 nt Cy5 RNA insert 20 nt RNA insert L1** for firefly R1** for firefly L2** for firefly R2** for firefly L1 for firefly R1 for firefly L2 for firefly R2 for firefly L1 for renilla R1 for renilla L2 for renilla R2 for renilla renilla firefly firefly Sequence CAAGGAATGGTGCATGCTAA CCTTTTTGGAAACGAACACCAC GCCTACCGTGGTTAATACGACTCACTATAGGTTGCAAAAAATTTTG CGAATTCATGCATTTTTTTTTTT GTTCAAAATTTTTTGCAACCCCTTTTTGGAAACGAACACC TTTTTTGCACGTTCAAAATTTTTTGCAACCCCTTTTTGGAAACGAACACCACGGTAGGCT TTAGGCAGACCAGTAGATCCAGAGGAGTTCATGATCAGTGCAATTGTCTTGTCCCTATCG ATAGCTATAATGAAATGCCAAACAAGCACCCCAATCATGGCCGACAAAAATGATCTTCTT TTTTTTGCACGTTCAAAATTTTTTGCAACCAACTTCAACTTAATACCACACCTTTTTGGAAA CGAACACCACGGTAGGCT TTTTTTGCACGTTCAAAATTTTTTGCAACCTTTGTTGTTGTTGAGTTGTGTCCTTTTTGGAAA CGAACACCACGGTAGGCT ph-acacaacu /icy5/caacaacaacaaa ph-ugugguauua AGUUGAAGUU GCCCATACTGTTGAGCAATTCACGTTCATTATAAATGTCGTTCGCGGGCGCAACTGCAAC CGACTGAAATCCCTGGTAATCCGTTTTAGAATCCATGATAATAATTTTTTGGATGATTGG GGCATAAAGAATTGAAGAGAGTTTTCACTGCATACGACGATTCTGTGATTTGTATTCAGC TTGTCTTGTCCCTATCGAAGGACTCTGGCACAAAATCGTATTCATTAAAACCGGGAGGTA GCACAAAATCGTATTCATTAAAACCGGGAGGTAGATGAGATGTGACGAACGTGTACATCG ATTGCCAAAAATAGGATCTCTGGCATGCGAGAATCTCACGCAGGCAGTTCTATGAGGCAG CTGGTAATCCGTTTTAGAATCCATGATAATAATTTTTTGGATGATTGGGAGCTTTTTTTG GTGTAGTAAACATTCCAAAACCGTGATGGAATGGAACAACACTTAAAATCGCAGTATCCG AGAAGTTCAAACCATGCAGTAAGATATTTGTAATGATCAAGTAACCTATAAGAACCATTA CATCCCATGATTCAATCACATCTACTACACTTTCAGCGTGAACTATTGCTTTGATCTTAT CTGATTTGCCCATACCAATAAGGTCTGGTATAATACACCGCGCTACTGGCTCAATATGTG TTCTCCAAAACCATTTTTTCTCCTTCTTCAGATTTGATCAACGCAATATCTTCTTCAATA mcmamcmcccaamumcmamu mamamcmcccttmumumumg mgmumumcatgamumcmamg *,, and ligation sites are defined as in Figure 2. ** L1, R1, L2, R2 are defined as in Figure 4A.

XactEdit Cas9 Nuclease with NLS User Manual

XactEdit Cas9 Nuclease with NLS User Manual XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Product Name : Simple mirna Detection Kit

Product Name : Simple mirna Detection Kit Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components

More information

Torsional Constraints of DNA Substrates Impact Cas9 Cleavage

Torsional Constraints of DNA Substrates Impact Cas9 Cleavage Supporting Information Torsional Constraints of DNA Substrates Impact Cas9 Cleavage Michael H. Räz, Kumi Hidaka, Shana J. Sturla, Hiroshi Sugiyama, *,, and Masayuki Endo *, Institute for Integrated Cell-Material

More information

CircLigase II ssdna Ligase

CircLigase II ssdna Ligase Cat. Nos. CL9021K and CL9025K Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 298 12/2012 1 EPILIT298

More information

Polymerase chain reaction

Polymerase chain reaction Core course BMS361N Genetic Engineering Polymerase chain reaction Prof. Narkunaraja Shanmugam Dept. Of Biomedical Science School of Basic Medical Sciences Bharathidasan University The polymerase chain

More information

CircLigase ssdna Ligase

CircLigase ssdna Ligase Cat. Nos. CL4111K and CL4115K Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 222 10/2012 1 EPILIT222

More information

The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity

The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega

More information

Genetics and Genomics in Medicine Chapter 3. Questions & Answers

Genetics and Genomics in Medicine Chapter 3. Questions & Answers Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical

More information

BIOO RESEARCH PRODUCTS. ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205

BIOO RESEARCH PRODUCTS. ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205 BIOO RESEARCH PRODUCTS ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205 BIOO Scientific Corp. 2010 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure Overview... 2 Kit

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Quant One Step RT-PCR Kit

Quant One Step RT-PCR Kit 1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant

More information

Preparing Samples for Analysis of Small RNA

Preparing Samples for Analysis of Small RNA Preparing Samples for Analysis of Small RNA Topics 3 Introduction 4 Kit Contents and Equipment Checklist 6 Isolate Small RNA by Denaturing PAGE Gel 9 Ligate 5' RNA Adapters 12 Ligate 3' RNA Adapters 15

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

Conversion of plasmids into Gateway compatible cloning

Conversion of plasmids into Gateway compatible cloning Conversion of plasmids into Gateway compatible cloning Rafael Martinez 14072011 Overview: 1. Select the right Gateway cassette (A, B or C). 2. Design primers to amplify the right Gateway cassette from

More information

Enzymatic assembly of DNA molecules up to several hundred kilobases

Enzymatic assembly of DNA molecules up to several hundred kilobases nature methods Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & Hamilton O Smith Supplementary figures

More information

2 march 06 Seminar on RT-PCR. About Real-time PCR. Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire

2 march 06 Seminar on RT-PCR. About Real-time PCR. Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire 2 march 06 Seminar on RT-PCR About Real-time PCR Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire Target DNA PCR Applications: Gene Plasmide, phage Diagnostic

More information

RIBOPROBE GEMINI SYSTEM TRANSCRIPTION OF CLONED DNA

RIBOPROBE GEMINI SYSTEM TRANSCRIPTION OF CLONED DNA RIBOPROBE GEMINI SYSTEM TRANSCRIPTION OF CLONED DNA The protocols listed below are a modification of Melton, D.A., et al. (1984) Nucl. Acids Res. 12,7035-7056. REAGENTS 1. 5x transcription buffer 200 mm

More information

Basic Protocol (v. 2.0, May, 2003)

Basic Protocol (v. 2.0, May, 2003) Basic Protocol (v. 2.0, May, 2003) Preparation of RNA:DNA Handles For the two handles (called A and B), you will need the following oligos: Product 1 : Name=B_reverse : Synthesis=1 umole : Purification=HPLC

More information

Recombinant DNA Technology

Recombinant DNA Technology History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists

More information

Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in. Zebrafish Embryos 1

Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in. Zebrafish Embryos 1 Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in Zebrafish Embryos 1 1. In vitro synthesis of capped Cas9 mrna The full length of humanized Cas9 cdnas with double NLS were cloned into pxt7

More information

Cloning small RNAs for Solexa Sequencing version 2.0 by Nelson Lau Page 1 of 5 (Modified from Solexa sequencing protocol from Bartel lab)

Cloning small RNAs for Solexa Sequencing version 2.0 by Nelson Lau Page 1 of 5 (Modified from Solexa sequencing protocol from Bartel lab) Cloning small RNAs for Solexa Sequencing version 2.0 by Nelson Lau 09162008 Page 1 of 5 General Cloning Protocol: Gel-purification 1. Pour 1mm thick, urea denaturing 10% or 15% polyacrylamide gels, with

More information

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain

More information

Fast-Link DNA Ligation Kits

Fast-Link DNA Ligation Kits Cat. Nos. LK11025, LK0750H, and LK6201H The provide reagents optimized for the construction of recombinant vectors in a short time. Ligation reactions require incubation for as little as 5 minutes at room

More information

HiScribe. T7 Quick High Yield RNA Synthesis Kit RNA ENZYMES & GENE ANALYSIS. Instruction Manual NEB #S1560S. NEB #E2050S 50 reactions Version 2.

HiScribe. T7 Quick High Yield RNA Synthesis Kit RNA ENZYMES & GENE ANALYSIS. Instruction Manual NEB #S1560S. NEB #E2050S 50 reactions Version 2. RNA ENZYMES & GENE ANALYSIS HiScribe T7 Quick High Yield RNA Synthesis Kit Instruction Manual NEB #E2050S 50 reactions Version 2.1 1/17 NEB #S1560S be INSPIRED drive DISCOVERY stay GENUINE This product

More information

MeDIP-seq library construction protocol v2 Costello Lab June Notes:

MeDIP-seq library construction protocol v2 Costello Lab June Notes: MeDIP-seq library construction protocol v2 Costello Lab June 2010 Notes: A. For all Qiagen gel extraction steps (Qiaquick and MinElute), melt gel slice at 37º C instead of 50º (see Quail et al 2008 Nature

More information

AmpliScribe T7-Flash Transcription Kit

AmpliScribe T7-Flash Transcription Kit AmpliScribe T7-Flash Transcription Kit Cat. Nos. ASF3257 and ASF3507 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA191E AmpliScribe T7-Flash Transcription Kit 12/2016 1 1. Introduction

More information

Molecular Genetics II - Genetic Engineering Course (Supplementary notes)

Molecular Genetics II - Genetic Engineering Course (Supplementary notes) 1 von 12 21.02.2015 15:13 Molecular Genetics II - Genetic Engineering Course (Supplementary notes) Figures showing examples of cdna synthesis (currently 11 figures) cdna is a DNA copy synthesized from

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany RNA ligands that distinguish metabolite-induced conformations in the TPP riboswitch Günter Mayer, Marie-Sophie L. Raddatz, Julia D. Grunwald,

More information

SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit

SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit Agenda SOLiD Total RNAseq Kit Overview Kit Configurations Barcoding Kit Introduction New Small RNA and WT Workflow Small RNA Workflow Step-by-step Workflow

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

RP RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O

RP RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O www.smobio.com Product Information Reverse Transcription Kit II RP1400 100 RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O ExcelRT series 100 μl 500 μl 100

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Clontech Laboratories, Inc. Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 631438, 631439 & 631440 (042114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra

More information

Microarray Protocol for Agilent Inkjet-Deposited Presynthesized Oligo Arrays Aminoallyl Method AfCS Procedure Protocol PP Version 1, 10/20/03

Microarray Protocol for Agilent Inkjet-Deposited Presynthesized Oligo Arrays Aminoallyl Method AfCS Procedure Protocol PP Version 1, 10/20/03 Microarray Protocol for Agilent Inkjet-Deposited Presynthesized Oligo Arrays AfCS Procedure Protocol PP00000184 Version 1, 10/20/03 The following procedure details the preparation of fluorescently labeled

More information

Sensitivity vs Specificity

Sensitivity vs Specificity Viral Detection Animal Inoculation Culturing the Virus Definitive Length of time Serology Detecting antibodies to the infectious agent Detecting Viral Proteins Western Blot ELISA Detecting the Viral Genome

More information

Basic lab techniques

Basic lab techniques Basic lab techniques Sandrine Dudoit Bioconductor short course Summer 2002 Copyright 2002, all rights reserved Lab techniques Basic lab techniques for nucleic acids Hybridization. Cut: restriction enzymes.

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Supplementary Data. Santiago Grijalvo and Ramón Eritja *

Supplementary Data. Santiago Grijalvo and Ramón Eritja * Supplementary Data Synthesis and in vitro Inhibition Properties of Oligonucleotide Conjugates Carrying Amphipathic Proline-rich Peptide Derivatives of the Sweet Arrow Peptide (SAP) Santiago Grijalvo and

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

DNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli

DNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli Supplementary Information DNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli Geraldine Fulcrand 1,2, Samantha Dages 1,2, Xiaoduo Zhi 1,2, Prem Chapagain

More information

Fatchiyah

Fatchiyah Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing

More information

3'-Full RACE Core Set

3'-Full RACE Core Set Table of Contents Description... 2 Principle... 4 Preparation of RNA Sample... 5 Note... 5 Protocol 1. General Protocol... 6 2. Application example... 8 Also available from Takara PCR related products

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Supplementary Fig. 1. Characteristics of transcription elongation by YonO. a. YonO forms a saltstable EC. Immobilized ECs were washed with

Supplementary Fig. 1. Characteristics of transcription elongation by YonO. a. YonO forms a saltstable EC. Immobilized ECs were washed with Supplementary Fig. 1. Characteristics of transcription elongation by YonO. a. YonO forms a saltstable EC. Immobilized ECs were washed with transcription buffer with or without a high salt concentration

More information

Lecture 18. PCR Technology. Growing PCR Industry

Lecture 18. PCR Technology. Growing PCR Industry Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex

More information

Quant Reverse Transcriptase

Quant Reverse Transcriptase 1. Quant Reverse Transcriptase For first-strand cdna synthesis and two-step RT-PCR www.tiangen.com RT080530 Kit Contents Quant Reverse Transcriptase Contents Cat. no. ER103 ER103-02 25 rxns ER103-03 50

More information

PureSpin DNA Clean Up Kit

PureSpin DNA Clean Up Kit PureSpin DNA Clean Up Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin DNA Clean Up Kit, Micro Columns w/out Caps (Kit Size) OD2080 (50 Preps.) OD2080-2 (200 Preps.) Storage

More information

Cloning Small RNAs for Sequencing with 454 Technology

Cloning Small RNAs for Sequencing with 454 Technology Cloning Small RNAs for Sequencing with 454 Technology Protocol provided by Dr. Greg Hannon, Cold Spring Harbor Laboratory 1. RNA preparation 1. Total RNA is isolated from tissue or cells with TRIZOL followed

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 26 69451 Weinheim, Germany A new homogenous assay for studying mira maturation Brian Patrick Davies and Christoph Arenz General Information For MALDI-TF measurements a

More information

Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing

Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing Before You Begin This document describes methods for generating barcoded PCR products

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11726 Supplementary Figure 1 SRP RNA constructs used in single molecule experiments. a, Secondary structure of wildtype E. coli SRP RNA, which forms an elongated hairpin structure capped

More information

Functional vs Organismal views of Ecology. One organism: Population genetics Many organisms: Ecology No organisms: Ecosystems

Functional vs Organismal views of Ecology. One organism: Population genetics Many organisms: Ecology No organisms: Ecosystems Functional vs Organismal views of Ecology One organism: Population genetics Many organisms: Ecology No organisms: Ecosystems The trade-off between precision and relevance Another trade-off exists: resolution

More information

HiScribe. T7 ARCA mrna Kit (with tailing) RNA ENZYMES & GENE ANALYSIS. Instruction Manual. NEB #E2060S 20 reactions Version /16 NEB #S1560S

HiScribe. T7 ARCA mrna Kit (with tailing) RNA ENZYMES & GENE ANALYSIS. Instruction Manual. NEB #E2060S 20 reactions Version /16 NEB #S1560S RNA ENZYMES & GENE ANALYSIS HiScribe T7 ARCA mrna Kit (with tailing) Instruction Manual NEB #E2060S 20 reactions Version 1.1 10/16 NEB #S1560S be INSPIRED drive DISCOVERY stay GENUINE This product is intended

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background PCR Amplify= Polymerase Chain Reaction (PCR) Invented in 1984 Applications Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off

More information

Vector Linearization. igem TU/e 2015 Biomedical Engineering

Vector Linearization. igem TU/e 2015 Biomedical Engineering igem TU/e 2015 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +31 50 247 55 59 2015.igem.org/Team:TU_Eindhoven Vector

More information

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9

More information

Human TNF qpcr primer pair

Human TNF qpcr primer pair Shipping and Storage information Catalog No. Amount Reaction number of 25-μl volume Shipping and Storage Package tube 2 nmol 200 lyophilized powder 1 Information of the target gene and primers Species

More information

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries

More information

AmpliScribe T 7 Aminoallyl-RNA Transcription Kit

AmpliScribe T 7 Aminoallyl-RNA Transcription Kit Cat. No. AA50125 The AmpliScribe T7 Aminoallyl-RNA Transcription Kit enables high-yield production of aminoallyl-labeled RNA. The kit utilizes Epicentre s high yielding AmpliScribe T7-Flash in vitro transcription

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Common General Cloning Strategy Target DNA from donor organism extracted, cut with restriction endonuclease and ligated into a cloning vector cut with compatible restriction

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction Amplify your insert or verify its presence 3H Taq platinum PCR mix primers Ultrapure Water PCR tubes PCR machine A. Insert amplification For insert amplification, use the Taq

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

For Research Use Only Ver

For Research Use Only Ver Page 0 INSTRUCTION MANUAL RNA Clean & Concentrator -5 Catalog Nos. R1013 & R1014 (supplied with DNase I) R1015 & R1016 Highlights Quick, 5 minute recovery of ultra pure RNA ( 17 nt) from enzymatic reactions,

More information

Plasmid Subcloning using low melt ligation

Plasmid Subcloning using low melt ligation Design Considerations Plasmid Subcloning using low melt ligation General 1) We much prefer directional cloning (since it usually works better and takes less time) and we have found that with the help of

More information

Purification of DNA Oligonucleotides

Purification of DNA Oligonucleotides Purification of DNA Oligonucleotides Polyacrylamide gel: In a beaker, add 30 ml 30% acrylamide solution (To make this solution, add 29 g acrylamide to 1 g bis-acrylamide, bring to 100 ml with dh 2 O) 31.5

More information

Chapter 3. Enzyme manipulation of DNA and RNA

Chapter 3. Enzyme manipulation of DNA and RNA Chapter 3 Enzyme manipulation of DNA and RNA To measure incorporation of radioactivity (to see if the probe is good or not for hybridization) Acid precipitation method: - Add sonicated salmon sperm DNA

More information

small RNA Cloning Kit

small RNA Cloning Kit Cat. # RR065 For Research Use small RNA Cloning Kit Product Manual Table of Contents I. Description... 3 II. Components... 4 III. Materials Required but not Provided... 5 IV. Storage... 6 V. Precautions

More information

Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...

Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol... Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA).

Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA). 175 Appendix III Chapter 4 Methods General. Unless otherwise noted, reagents were purchased from the commercial suppliers Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further

More information

RNA Clean-Up and Concentration Kit Product # 23600, 43200

RNA Clean-Up and Concentration Kit Product # 23600, 43200 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com RNA Clean-Up and Concentration Kit Product # 23600, 43200 Product

More information

RNA-templated DNA origami structures

RNA-templated DNA origami structures Electronic Supplementary Information RNA-templated DNA origami structures Masayuki Endo,* a,c Seigi Yamamoto, b Koichi Tatsumi, b Tomoko Emura, b Kumi Hidaka, b and Hiroshi Sugiyama* a,b,c a Institute

More information

Reverse Transcriptase Reverse Transcriptase 100 µl 5X RT Buffer 0.1 M DTT 500 µl Storage -20 C for 24 months

Reverse Transcriptase Reverse Transcriptase 100 µl 5X RT Buffer 0.1 M DTT 500 µl Storage -20 C for 24 months www.smobio.com Product Information Reverse Transcriptase ExcelRT series RP1000 20,000 units Reverse Transcriptase 100 µl 5X RT Buffer 1 ml 0.1 M DTT 500 µl Storage -20 C for 24 months Description The ExcelRT

More information

FMF NIRCA PROTOCOL STEP 1.

FMF NIRCA PROTOCOL STEP 1. FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are

More information

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques

More information

Procedure & Checklist - Preparing Asymmetric SMRTbell Templates

Procedure & Checklist - Preparing Asymmetric SMRTbell Templates Procedure & Checklist - Preparing Asymmetric SMRTbell Templates Before You Begin In this procedure, PCR products are generated using two rounds of amplification. The first round uses target specific primers

More information

Problem Set 8. Answer Key

Problem Set 8. Answer Key MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no

More information

SuperReal PreMix Plus (SYBR Green)

SuperReal PreMix Plus (SYBR Green) SuperReal PreMix Plus (SYBR Green) For fast, quantitative, real-time PCR using SYBR Green www.tiangen.com/en QP120627 SuperReal PreMix Plus (SYBR Green) Cat. no. FP205 Kit Contents Contents 2 SuperReal

More information

Functional Genomics Research Stream. Research Meetings: November 2 & 3, 2009 Next Generation Sequencing

Functional Genomics Research Stream. Research Meetings: November 2 & 3, 2009 Next Generation Sequencing Functional Genomics Research Stream Research Meetings: November 2 & 3, 2009 Next Generation Sequencing Current Issues Research Meetings: Meet with me this Thursday or Friday. (bring laboratory notebook

More information

DuraScribe T7 Transcription Kit

DuraScribe T7 Transcription Kit DuraScribe T7 Transcription Kit Cat. Nos. DS010910 and DS010925 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA170E DuraScribe T7 Transcription Kit 7/2017 1 1. Introduction The

More information

MonsterScript Reverse Transcriptase

MonsterScript Reverse Transcriptase MonsterScript Reverse Transcriptase Cat. Nos. MSTA5110, and MSTA5124 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com

More information

Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for :

Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : Transformation Insertion of DNA of interest Amplification Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : DNA Sequence. Understand relatedness of genes and

More information

Description...1 Components...1 Storage... 1 Technical Information...1 Protocol...2 Examples using the kit...4 Troubleshooting...

Description...1 Components...1 Storage... 1 Technical Information...1 Protocol...2 Examples using the kit...4 Troubleshooting... QuickClean II Gel Extraction Kit Cat. No. L00418 Technical Manual No. TM0594 Version: 03042011 I II III IV V VI VII VIII Description......1 Components.....1 Storage.... 1 Technical Information....1 Protocol.....2

More information

Laboratory #7 PCR PCR

Laboratory #7 PCR PCR 1 Laboratory #7 Polymerase chain reaction () is DNA replication in a test tube. In vitro enzymatic amplification of a specific segment of DNA. Many Applications. direct cloning from DNA or cdna. Mutagenesis

More information

Stratagene QPCR Mouse Reference Total RNA

Stratagene QPCR Mouse Reference Total RNA Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision B Research Use Only. Not for Use in Diagnostic Procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

ProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2.

ProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2. DNA AMPLIFICATION & PCR ProtoScript First Strand cdna Synthesis Kit Instruction Manual NEB #E6300S/L 30/150 reactions Version 2.2 11/16 be INSPIRED drive DISCOVERY stay GENUINE This product is intended

More information

2.5. Equipment and materials supplied by user PCR based template preparation Influence of temperature on in vitro EGFP synthesis 11

2.5. Equipment and materials supplied by user PCR based template preparation Influence of temperature on in vitro EGFP synthesis 11 Manual 15 Reactions LEXSY in vitro Translation Cell-free protein expression kit based on Leishmania tarentolae for PCR-based template generation Cat. No. EGE-2010-15 FOR RESEARCH USE ONLY. NOT INTENDED

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Intracellular receptors specify complex patterns of gene expression that are cell and gene

Intracellular receptors specify complex patterns of gene expression that are cell and gene SUPPLEMENTAL RESULTS AND DISCUSSION Some HPr-1AR ARE-containing Genes Are Unresponsive to Androgen Intracellular receptors specify complex patterns of gene expression that are cell and gene specific. For

More information

PrimeScript 1st strand cdna Synthesis Kit

PrimeScript 1st strand cdna Synthesis Kit Cat. # 6110A For Research Use PrimeScript 1st strand cdna Synthesis Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 3 IV. Storage...

More information

HeLaScribe Nuclear Extract in vitro Transcription System INSTRUCTIONS FOR USE OF PRODUCTS E3110, E3091 AND E3092.

HeLaScribe Nuclear Extract in vitro Transcription System INSTRUCTIONS FOR USE OF PRODUCTS E3110, E3091 AND E3092. Technical Bulletin HeLaScribe Nuclear Extract in vitro Transcription System INSTRUCTIONS FOR USE OF PRODUCTS E3110, E3091 AND E3092. PRINTED IN USA. Revised 5/09 HeLaScribe Nuclear Extract in vitro Transcription

More information

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Roche Molecular Biochemicals Technical Note No. LC 10/2000 Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce

More information

Instructions for Use Life Science Kits & Assays

Instructions for Use Life Science Kits & Assays Instructions for Use Life Science Kits & Assays Product specifications 1 Product specifications The innumix Standard PCR MasterMix contains all reagents required for routine high throughput PCR amplifications

More information

II First Strand cdna Synthesis Kit

II First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR ProtoScript II First Strand cdna Synthesis Kit Instruction Manual NEB #E6560S/L 30/150 reactions Version 1.5 12/17 be INSPIRED drive DISCOVERY stay GENUINE This product is intended

More information

Why adapter ligation? Ligases. Oligonucleotide ligases. Definition of ligase

Why adapter ligation? Ligases. Oligonucleotide ligases. Definition of ligase Why adapter ligation? Ligases Introduction to s in general, and RA 1 / RA 2, truncated in particular mira bacterial mra -P unknown sequence 3 -H -PPP unknown sequence 3 -H 3 adapter LIGASE catalyzed known

More information

SunScript One Step RT-PCR Kit

SunScript One Step RT-PCR Kit SunScript ONE STEP R T-PCR KIT HANDBOOK SunScript One Step RT-PCR Kit INDEX Legal... 4 Intended use... 4 Kit contents... 5 Shipping and storage... 5 Handling... 6 Quality control... 6 Reagents and equipment...

More information