SSA Signal Search Analysis II
|
|
- Annice Julie Phillips
- 6 years ago
- Views:
Transcription
1 SSA Signal Search Analysis II SSA other applications - translation In contrast to translation initiation in bacteria, translation initiation in eukaryotes is not guided by a Shine-Dalgarno like motif. In eukaryotes translation initiation is guided by the so-called Kozak-consensus sequence: This sequence on a mrna molecule is recognized by the ribosome as the translational start site, from which point a protein is coded by that mrna molecule. The ribosome requires this sequence, or a possible variation to initiate translation.
2 SSA other applications - translation The Kozak sequence is not to be confused with the ribosomal binding site (RBS). In vivo, this site is often not matched exactly on different mrnas and the amount of protein synthesized from a given mrna is dependent on the strength of the Kozak sequence. Some nucleotides in this sequence are more important than others: the AUG is essential since it is the actual initiation codon encoding a methionine amino acid at the N-terminus of the protein. SSA other applications - polya Polyadenylation occurs after transcription of DNA into RNA in the nucleus. After the polyadenylation signal has been transcribed, the mrna chain is cleaved through the action of an endonuclease complex associated with RNA polymerase. The cleavage site is characterized by the presence of the base sequence AAUAAA near the cleavage site. After the mrna has been cleaved, 50 to 250 adenine residues are added to the free 3' end at the cleavage site. This reaction is catalyzed by polyadenylate polymerase.
3 SSA other applications - splicing An intron usually contains a clear signal for splicing (e.g., the beta globin gene). In some cases (e.g., the sex lethal gene of fruit fly), a splicing signal may be masked by a regulatory protein, resulting in alternative splicing. In rare cases (e.g., HIV genes), a pre-mrna may contain several ambiguous splicing signals, resulting in a few alternatively spliced mrnas. SSA other applications - splicing Splicing signal Most introns start from the sequence GU and end with the sequence AG (in the 5' to 3' direction). They are referred to as the splice donor and splice acceptor site, respectively. In over 60% of cases, the exon sequence is (A/C)AG at the donor site, and G at the acceptor site.
4 SSA other applications - splicing The sequences at the two sites of the intron are not sufficient to signal the presence of an intron. Another important sequence is called the branch site located bases upstream of the acceptor site. The consensus sequence of the branch site is "CU(A/G)A(C/U)", where A is conserved in all genes. SSA parameters Search Parameters Window size and shift The fixed length (as determined by the 5' and 3' borders) sequences extracted from the data library are organised into a matrix of oligonucleotides. This matrix is divided into cross-sections or windows. Two parameters define this sub-division process: Window length - the number of bases into which the matrix is to be divided. Window displacement length - the number of bases by which the window is displaced rightwards with respect to the preceeding one.
5 SSA parameters Search mode This parameter presents the strand of DNA to be searched for. If a signal is specified bidirectional, in which case the complementary strands of the Window segments are also considered. Signal description The signals can be described in two different formats Consensus sequence - which indicate the predominant nucleotide at each position of the signal sequence. Weight matrix - a two dimensional table containing the frequency of each nucleotide at each position of the motif. For example see the default matrix for TATA box printed on the OPROF web site SSA parameters - SList Selection criteria: Five different Signal selection Criteria has to be provided by the user Occurrence frequency: This Criteria allows users to look for both over and under represented signal sequences in the data set. Selection mode: This parameter determines which subsequences will be considered. The parameters are: If "global maxima/minima" is specified unique global best fits are selected. If "local maxima.minima is specified each canditate motif that is not overlapped by an equal or better match is selected If "all" is specified all occurrences are processed St-dev cut-off: A Standard deviation for the signal frequencies of all the signals either over represented or under represented in the DNA sequence matrix is calculated and this parameter sets the cut-off for the standard deviation for the signals to be selected Sort list by: This criteria allows the user to sort the list of signals that over or under represented by either the position or by the standard deviation of the signals.
6 SSA parameters - SList Signal collection A Signal sequence collection is required to look at the over or under represented signals in the data set. The program offers three different possibility of choosing a signal sequence collection A complete signal sequence collection contains all possible sequence of a "signal sequence length A random signal sequence collection contains random number of signal sequences of specified number and length. If special option is specified then gapped oligonucleotides are used as signal sequences. Gapped oligonucleotides are signal sequences in which distinct positions are unspecified. These positions are represented by an additional character (hyphen or N) which plays the role of a wild card. # Min. of matches: This criteria could be used to search for imperfect occurences of signal sequences. SSA parameters - Cpr Parameters: range: -199/100; wsize: 10; wshift: 2;# of bases: 4 complete; 3
7 SSA parameters - Cpr Parameters: range: -199/100; wsize: 15; wshift: 2;# of bases: 4 complete; 3 SSA parameters - Cpr Parameters: range: -199/100; wsize: 20; wshift: 2;# of bases: 4 complete; 3
8 SSA parameters - Cpr Parameters: range: -199/100; wsize: 10; wshift: 2;# of bases: 6 complete; 3 SSA parameters - Cpr Parameters: range: -199/100; wsize: 10; wshift: 2;# of bases: 6 random; 3
9 SSA parameters - Cpr Parameters: range: -199/100; wsize: 10; wshift: 2;# of bases: 7 random; 3 SSA parameters - Cpr Parameters: range: -199/100; wsize: 10; wshift: 2;# of bases: 6 random; 2
10 SSA parameters - OProf Parameters: range: -199/100; wsize: 30; wshift: 5; 1 mismatch SSA parameters - OProf Parameters: range: -199/100; wsize: 30; wshift: 5; 0 mismatch
11 SSA parameters - OProf Parameters: range: -199/100; wsize: 30; wshift: 5; 2 mismatch SSA parameters - OProf Parameters: range: -199/100; wsize: 30; wshift: 3; 1 mismatch
12 SSA parameters - OProf Parameters: range: -199/100; wsize: 20; wshift: 5; 1 mismatch SSA parameters - OProf Parameters: range: -199/100; wsize: 40; wshift: 5; 1 mismatch
13 SSA parameters - OProf Parameters: range: -199/100; wsize: 50; wshift: 5; 1 mismatch SSA parameters - OProf Parameters: range: -199/100; wsize: 60; wshift: 5; 1 mismatch
Transcription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationComputational gene finding
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
More informationLecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points?
BCH 401G Lecture 37 Andres Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? RNA processing: Capping, polyadenylation, splicing. Why process mammalian
More informationTranscription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
More informationThe Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
More informationTranscription steps. Transcription steps. Eukaryote RNA processing
Transcription steps Initiation at 5 end of gene binding of RNA polymerase to promoter unwinding of DNA Elongation addition of nucleotides to 3 end rules of base pairing requires Mg 2+ energy from NTP substrates
More informationEukaryotic Gene Structure
Eukaryotic Gene Structure Terminology Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Gene Basic physical and
More information30 Gene expression: Transcription
30 Gene expression: Transcription Gene structure. o Exons coding region of DNA. o Introns non-coding region of DNA. o Introns are interspersed between exons of a single gene. o Promoter region helps enzymes
More informationThere are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.
1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine
More informationGene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
More informationComputational gene finding
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
More informationBiology 3201 Genetics Unit #5
Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More informationTranscription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.
Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally
More informationComputational gene finding. Devika Subramanian Comp 470
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) The biological context Lec 1 Lec 2 Lec 3 Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
More informationTranscription and Post Transcript Modification
Transcription and Post Transcript Modification You Should Be Able To 1. Describe transcription. 2. Compare and contrast eukaryotic + prokaryotic transcription. 3. Explain mrna processing in eukaryotes.
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationBIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.
!! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide
More informationCH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationYear III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
More informationTRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long
Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationLesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
More informationTranscription. DNA to RNA
Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy
More information6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA
6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome
More informationAnalyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated:
From Gene to Protein Beadle and Tatum Analyzed Fungi Neurospora crassa mutants Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: Precursor Ornithine
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationGene function at the level of traits Gene function at the molecular level
Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationFrom RNA To Protein
From RNA To Protein 22-11-2016 Introduction mrna Processing heterogeneous nuclear RNA (hnrna) RNA that comprises transcripts of nuclear genes made by RNA polymerase II; it has a wide size distribution
More informationAnnotating the Genome (H)
Annotating the Genome (H) Annotation principles (H1) What is annotation? In general: annotation = explanatory note* What could be useful as an annotation of a DNA sequence? an amino acid sequence? What
More informationHello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
More informationDNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
More informationBS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
More informationTranscription. By : Lucia Dhiantika Witasari M.Biotech., Apt
Transcription By : Lucia Dhiantika Witasari M.Biotech., Apt REGULATION OF GENE EXPRESSION 11/26/2010 2 RNA Messenger RNAs (mrnas) encode the amino acid sequence of one or more polypeptides specified by
More informationThe Structure of Proteins The Structure of Proteins. How Proteins are Made: Genetic Transcription, Translation, and Regulation
How Proteins are Made: Genetic, Translation, and Regulation PLAY The Structure of Proteins 14.1 The Structure of Proteins Proteins - polymer amino acids - monomers Linked together with peptide bonds A
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationSIBC504: TRANSCRIPTION & RNA PROCESSING Assistant Professor Dr. Chatchawan Srisawat
SIBC504: TRANSCRIPTION & RNA PROCESSING Assistant Professor Dr. Chatchawan Srisawat TRANSCRIPTION: AN OVERVIEW Transcription: the synthesis of a single-stranded RNA from a doublestranded DNA template.
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationMODULE 5: TRANSLATION
MODULE 5: TRANSLATION Lesson Plan: CARINA ENDRES HOWELL, LEOCADIA PALIULIS Title Translation Objectives Determine the codons for specific amino acids and identify reading frames by looking at the Base
More informationGENETICS - CLUTCH CH.10 TRANSCRIPTION.
!! www.clutchprep.com CONCEPT: OVERVIEW OF TRANSCRIPTION Transcription is the process of using DNA as a template to RNA RNA polymerase is the enzyme that transcribes DNA - There are many different types
More informationMolecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code
Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)
More informationRNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationThe 5' cap (red) is added before synthesis of the primary transcript is complete. A non coding sequence following the last exon is shown in orange.
RNA PROCESSING The 5' cap (red) is added before synthesis of the primary transcript is complete. A non coding sequence following the last exon is shown in orange. Splicing can occur either before or after
More informationCLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code
CLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code No. 1 of 10 1. Three types of RNA comprise the structural and functional core for protein synthesis, serving as a template
More informationSections 12.3, 13.1, 13.2
Sections 12.3, 13.1, 13.2 Background: Watson & Crick recognized that base pairing in the double helix allows DNA to be copied, or replicated Each strand in the double helix has all the information to remake
More informationProtein Synthesis 101
Protein Synthesis 101 What is DNA? - Blueprint of Life (has the instructions for making ) - Gene = a segment of DNA which determines a ( ) - - is wrapped around protein to form - Structure was discovered
More informationA. Incorrect! This feature does help with it suitability as genetic material.
College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix
More informationMOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1
AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS
More informationChapter 17. From Gene to Protein
Chapter 17 From Gene to Protein One Gene One Enzyme Hypothesis Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria Beadle
More information3'A C G A C C A G T A A A 5'
AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of
More informationFROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation
One Gene One Enzyme Hypothesis FROM GENE TO PROTEIN C H A P T E R 1 7 Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationKey Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationHershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928)
Today: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Reviewing Mitosis/ Exploring the Function of Taxol Structure and Function of DNA! What do we learn about the
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
More informationChapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.
Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions
More informationText Reference, Campbell v.8, chapter 17 PROTEIN SYNTHESIS
AP BIOLOGY Text Reference, Campbell v.8, chapter 17 ACTIVITY 1.22 NAME DATE HOUR PROTEIN SYNTHESIS GENETIC CODE PROTEIN SYNTHESIS OVERVIEW PROTEIN SYNTHESIS TRANSCRIPTION PROTEIN SYNTHESIS TRANSLATION
More informationFind this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site.
Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site. Still having trouble understanding the material? Check
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationRNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
More informationCh. 10 Notes DNA: Transcription and Translation
Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that
More informationFrom Gene to Protein
8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are
More information7.2 Protein Synthesis. From DNA to Protein Animation
7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They
More informationLecture 11. Initiation of RNA Pol II transcription. Transcription Initiation Complex
Lecture 11 *Eukaryotic Transcription Gene Organization RNA Processing 5 cap 3 polyadenylation splicing Translation Initiation of RNA Pol II transcription Consensus sequence of promoter TATA Transcription
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More informationChapter 2. An Introduction to Genes and Genomes
PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents
More informationUnit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression
Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More information5. Which of the following enzymes catalyze the attachment of an amino acid to trna in the formation of aminoacyl trna?
Sample Examination Questions for Exam 3 Material Biology 3300 / Dr. Jerald Hendrix Warning! These questions are posted solely to provide examples of past test questions. There is no guarantee that any
More informationGene Expression. Student:
Gene Expression Student: 1. A ribozyme is A. a section of the DNA that is expressed in the mrna. B. a self-splicing intron that acts like an enzyme. C. a complex made up of many ribosomes replicating the
More informationTranscription and Translation
Biology Name: Morales Date: Period: Transcription and Translation Directions: Read the following and answer the questions in complete sentences. DNA is the molecule of heredity it determines an organism
More informationChapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein)
Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) I. Review A. Cells copy their DNA (in S phase of Interphase)-Why? Prepare for Cell Division (Mitosis & Cytokinesis) Genes
More informationThe Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16
Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes
More informationThe Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationChapter 6: Transcription and RNA Processing in Eukaryotes
3. Basic Genetics Plant Molecular Biology Chapter 6: Transcription and RNA Processing in Eukaryotes - Genetic organization in eukaryote - Transcription in eukaryote - - RNA processing in eukaryote - Translation
More informationSection 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein?
Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Messenger RNA Carries Information for Protein Synthesis from the DNA to Ribosomes Ribosomes Consist
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationBis2A 12.0 Transcription *
OpenStax-CNX module: m56068 1 Bis2A 12.0 Transcription * Mitch Singer Based on Transcription by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License
More informationIB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark)
Name Date Period 1. What is the function of helicase? A. It forms bonds between DNA nucleotides. B. It adds new nucleotides to the DNA helix. C. It forms the DNA helix. D. It separates DNA strands. 2.
More informationBiotechnology Unit 3: DNA to Proteins. From DNA to RNA
From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of
More informationMolecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.
Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions
More informationBig Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
More informationAnalysis of Biological Sequences SPH
Analysis of Biological Sequences SPH 140.638 swheelan@jhmi.edu nuts and bolts meet Tuesdays & Thursdays, 3:30-4:50 no exam; grade derived from 3-4 homework assignments plus a final project (open book,
More informationStudent Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13
http://www.explorelearning.com Name: Period : Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13 Vocabulary: Define these terms in complete sentences on a separate piece of paper: amino
More informationRNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013
RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein
More informationB. Incorrect! Centromeric DNA is largely heterochromatin, which is inactive DNA.
MCAT Biology - Problem Drill 06: Molecular Biology of Eukaryotes Question No. 1 of 10 1. Which type of DNA would have the highest level of expression? Question #01 (A) Heterochromatin. (B) Centromeric
More information