Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
|
|
- Erick Tucker
- 6 years ago
- Views:
Transcription
1 Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic information from DNA to a ribosome Helps assemble amino acids in the correct order What is a gene? Colinearity: a direct correspondence between DNA sequence and amino acid sequence of a protein. So, a gene must be a stretch of nucleotides that codes for a protein. Figure
2 Figure 14.2 Heat Single stranded fragments Non Coding Regions of DNA look like loops DNA-DNA Cool DNA-RNA Introns Segments of DNA within a gene that do not code for amino acids Transcribed into RNA, and then removed by RNA processing Common in eukaryotic genes, rare in bacterial genes Number and size vary from gene to gene Colinearity?? Not Always! The presence of introns means that EUKARYOTIC genes are frequently NOT colinear with the proteins they encode. Figure 14.3 Code for polypeptides 2
3 Humans: Average Human Gene: 10 to 15 exons Encodes 3 or more alternatively spliced proteins Each amino acid in a protein is specified by a three nucleotide sequence in the mrna called a CODON. Three Primary Regions of Mature RNA: Figure 14.5 Three Primary Regions of Mature RNA: Figure 14.5 Involved in Ribosome Binding Involved in Ribosome Binding Codon: a sequence of three nucleotides that codes for a specific amino acid Codon: a sequence of three nucleotides that codes for a specific amino acid Pre-mRNA Processing Bacteria: Transcription and Translation occur simultaneously No time for RNA modification Foreshadowing: An mrna with several ribosomes attached. 3
4 Pre-mRNA Processing Eukaryotes Transcription in nucleus Translation in cytoplasm Plenty of opportunity for RNA modification prior to translation Eukaryotic Pre-mRNA Processing Addition of the 5 Cap A modified nucleotide and several methyl groups are added to the 5 end Facilitates binding of ribosome, increases RNA stability, influences intron removal Addition of the Poly(A) tail Confers stability on some mrnas Figure
5 RNA Splicing Removal of Introns 3 sequences required 5 Splice site (consensus sequence GU) 3 Splice site (consensus sequence AG) Branch point (Adenine 18 to 40 nucleotides upstream of 3 splice site) Splicing occurs in a large complex called the spliceosome A SPLICEOSOME is a structure consisting of several RNA molecules (snrnas) and many different proteins. Figure Figure Figure Figure snrnps: small ribonucleoprotien particles 5
6 Figure BRCA1 Normal protein: lower incidence of breast and ovarian cancer What if we had a mutation (Chapter 17) inside the intron? A mutation in an exon of BRCA1 is associated with increased cancer incidence. This mutation doesn t change the amino acid sequence, but affects intron splicing. Alternative Processing Pathways Figure 14.16a Alternative Splicing: Exons can be spliced together in different combinations: Produces different proteins from THE SAME GENE Multiple 3 Cleavage sites: Pre-mRNA can be cleaved at different sites: Produces mrnas of different lengths, and thus different proteins from THE SAME GENE We estimate that 40% to 60% of all human genes are alternatively spliced. Dscam Drosophila homologue of the human Down s syndrome adhesion molecule Alternative splicing leads to ~40,000 different mature transcripts 6
7 Figure 14.16b The Calcitonin Gene RNA editing Coding sequence of mrna is CHANGED AFTER TRANSCRIPTION. Resultant protein has an amino acid sequence different from that encoded in the DNA. Relies on GUIDE RNAs (grnas) RNA processing Summary 5 Cap Poly (A) tail Intron Splicing Alternative processing pathways Alternative Splice Variants Multiple 3 Cleavage sites RNA editing Figure
8 What is a gene? A DNA sequence that codes for an RNA molecule. Includes exons, introns, rrnas, trnas, Promoter? Terminator? Monday: trnas rrnas sirnas and RNA Interference RNAi and Fluffy 8
There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.
1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine
More informationTranscription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
More informationLecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points?
BCH 401G Lecture 37 Andres Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? RNA processing: Capping, polyadenylation, splicing. Why process mammalian
More informationThe Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More informationGene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
More informationTranscription. DNA to RNA
Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More informationChapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?
Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationGENETICS - CLUTCH CH.10 TRANSCRIPTION.
!! www.clutchprep.com CONCEPT: OVERVIEW OF TRANSCRIPTION Transcription is the process of using DNA as a template to RNA RNA polymerase is the enzyme that transcribes DNA - There are many different types
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationTranscription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.
Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally
More informationMolecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code
Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)
More informationGene function at the level of traits Gene function at the molecular level
Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines
More informationThe Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16
Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationTranscription and Post Transcript Modification
Transcription and Post Transcript Modification You Should Be Able To 1. Describe transcription. 2. Compare and contrast eukaryotic + prokaryotic transcription. 3. Explain mrna processing in eukaryotes.
More informationBIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationCH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
More informationFrom Gene to Protein. Chapter 17
From Gene to Protein Chapter 17 What you need to know: The key terms: gene expression, transcription, and translation. The major events of transcription. How eukaryotic cells modify RNA after transcription.
More informationTranscription steps. Transcription steps. Eukaryote RNA processing
Transcription steps Initiation at 5 end of gene binding of RNA polymerase to promoter unwinding of DNA Elongation addition of nucleotides to 3 end rules of base pairing requires Mg 2+ energy from NTP substrates
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationChapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.
Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions
More informationRNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013
RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein
More informationBIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.
!! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationChapter 6: Transcription and RNA Processing in Eukaryotes
3. Basic Genetics Plant Molecular Biology Chapter 6: Transcription and RNA Processing in Eukaryotes - Genetic organization in eukaryote - Transcription in eukaryote - - RNA processing in eukaryote - Translation
More informationLesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
More informationChapter 14: From DNA to Protein
Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in
More informationGene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
More information30 Gene expression: Transcription
30 Gene expression: Transcription Gene structure. o Exons coding region of DNA. o Introns non-coding region of DNA. o Introns are interspersed between exons of a single gene. o Promoter region helps enzymes
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationThe Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work
Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via
More informationBiotechnology Unit 3: DNA to Proteins. From DNA to RNA
From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of
More informationUnit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression
Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,
More informationChapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationWednesday, November 22, 17. Exons and Introns
Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed
More informationA. Incorrect! This feature does help with it suitability as genetic material.
College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix
More informationCHapter 14. From DNA to Protein
CHapter 14 From DNA to Protein How? DNA to RNA to Protein to Trait Types of RNA 1. Messenger RNA: carries protein code or transcript 2. Ribosomal RNA: part of ribosomes 3. Transfer RNA: delivers amino
More informationEukaryotic Gene Structure
Eukaryotic Gene Structure Terminology Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Gene Basic physical and
More informationComputational Biology I LSM5191 (2003/4)
Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination
More informationKey Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
More informationDNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.
DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program
More informationChapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein)
Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) I. Review A. Cells copy their DNA (in S phase of Interphase)-Why? Prepare for Cell Division (Mitosis & Cytokinesis) Genes
More informationCh. 10 From DNA to Protein. AP Biology
Ch. 10 From DNA to Protein Protein Synthesis Metabolism and Gene Expression n Inheritance of metabolic diseases suggests that genes coded for enzymes n Diseases (phenotypes) caused by non-functional gene
More informationCh. 10 Notes DNA: Transcription and Translation
Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that
More informationBis2A 12.0 Transcription *
OpenStax-CNX module: m56068 1 Bis2A 12.0 Transcription * Mitch Singer Based on Transcription by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationBiology A: Chapter 9 Annotating Notes Protein Synthesis
Name: Pd: Biology A: Chapter 9 Annotating Notes Protein Synthesis -As you read your textbook, please fill out these notes. -Read each paragraph state the big/main idea on the left side. -On the right side
More informationRegulation of bacterial gene expression
Regulation of bacterial gene expression Gene Expression Gene Expression: RNA and protein synthesis DNA ----------> RNA ----------> Protein transcription translation! DNA replication only occurs in cells
More informationTRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long
Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double
More informationChapter 17. From Gene to Protein
Chapter 17 From Gene to Protein Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific
More information6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA
6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome
More informationFrom Gene to Protein. How Genes Work
From Gene to Protein How Genes Work 2007-2008 The Central Dogma Flow of genetic information in a cell How do we move information from DNA to proteins? DNA RNA protein replication phenotype You! Step 1:
More informationHershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928)
Today: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Reviewing Mitosis/ Exploring the Function of Taxol Structure and Function of DNA! What do we learn about the
More informationChapters 31-32: Ribonucleic Acid (RNA)
Chapters 31-32: Ribonucleic Acid (RNA) Short segments from the transcription, processing and translation sections of each chapter Slide 1 RNA In comparison with DNA RNA utilizes uracil in place of thymine
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More informationFrom DNA to Protein. Chapter 14
From DNA to Protein Chapter 14 What do genes code for? How does DNA code for cells & bodies? How are cells and bodies made from the instructions in DNA? DNA proteins cells bodies The Central Dogma Flow
More informationAnalyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated:
From Gene to Protein Beadle and Tatum Analyzed Fungi Neurospora crassa mutants Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: Precursor Ornithine
More informationTranscription. By : Lucia Dhiantika Witasari M.Biotech., Apt
Transcription By : Lucia Dhiantika Witasari M.Biotech., Apt REGULATION OF GENE EXPRESSION 11/26/2010 2 RNA Messenger RNAs (mrnas) encode the amino acid sequence of one or more polypeptides specified by
More informationRNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More information7.2 Protein Synthesis. From DNA to Protein Animation
7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They
More informationCh Molecular Biology of the Gene
Ch. 12 - Molecular Biology of the Gene AP BIOLOGY CHAPTER GUIDE 1. In the middle of the unraveling the mysteries of DNA, researchers knew that genetic material must be able to. It must be stable so it
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley
More informationFigure A summary of spontaneous alterations likely to require DNA repair.
DNA Damage Figure 5-46. A summary of spontaneous alterations likely to require DNA repair. The sites on each nucleotide that are known to be modified by spontaneous oxidative damage (red arrows), hydrolytic
More informationHow to Use This Presentation
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationHello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
More information3'A C G A C C A G T A A A 5'
AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of
More informationThe Central Dogma. DNA makes RNA makes Proteins
The Central Dogma DNA makes RNA makes Proteins TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION OF
More informationBranches of Genetics
Branches of Genetics 1. Transmission genetics Classical genetics or Mendelian genetics 2. Molecular genetics chromosomes, DNA, regulation of gene expression recombinant DNA, biotechnology, bioinformatics,
More informationDNA & Protein Synthesis. The source and the process!
DNA & Protein Synthesis The source and the process! Agenda I. DNA and Genes II. Protein Synthesis III. The Genetic Code I. DNA & Genes: The beauty of DNA Remember: DNA is a macromolecule that stores information
More informationChapter 17. From Gene to Protein
Chapter 17 From Gene to Protein One Gene One Enzyme Hypothesis Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria Beadle
More informationChapter 17. From Gene to Protein. AP Biology
Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)
More informationTranscription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences
Transcription and Translation DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Protein Structure Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different
More informationMolecular Genetics Quiz #1 SBI4U K T/I A C TOTAL
Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct
More informationThe Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
More informationBig Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationSSA Signal Search Analysis II
SSA Signal Search Analysis II SSA other applications - translation In contrast to translation initiation in bacteria, translation initiation in eukaryotes is not guided by a Shine-Dalgarno like motif.
More informationRNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
More informationBiology 3201 Genetics Unit #5
Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process
More informationFrom Gene to Protein
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More informationFROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation
One Gene One Enzyme Hypothesis FROM GENE TO PROTEIN C H A P T E R 1 7 Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria
More informationMolecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.
Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions
More informationB. Incorrect! Centromeric DNA is largely heterochromatin, which is inactive DNA.
MCAT Biology - Problem Drill 06: Molecular Biology of Eukaryotes Question No. 1 of 10 1. Which type of DNA would have the highest level of expression? Question #01 (A) Heterochromatin. (B) Centromeric
More information