Figure S1. MUT-16 localization in L4 hermaphrodite, adult hermaphrodite, and adult male germlines. MUT-16 DAPI. Phillips et al. S-1. male.

Two classes of silencing RNAs move between Caenorhabditis elegans tissues.

Two classes of silencing RNAs move between Caenorhabditis elegans tissues. Antony M Jose, Giancarlo A Garcia, and Craig P Hunter. Supplementary Figures, Figure Legends, and Tables. Supplementary Figure

b number of motif occurrences

supplementary information DOI: 1.138/ncb194 a b number of motif occurrences number of motif occurrences number of motif occurrences I II III IV V X TTGGTCAGTGCA 3 8 23 4 13 239 TTGGTCAGTGCT 7 5 8 1 3 83

MUT-16 promotes formation of perinuclear Mutator foci required for RNA silencing in the C. elegans germline

MUT-16 promotes formation of perinuclear Mutator foci required for RNA silencing in the C. elegans germline Carolyn M. Phillips, Taiowa A. Montgomery, Peter C. Breen, and Gary Ruvkun 1 Department of Molecular

MUT-14 and SMUT-1 DEAD Box RNA Helicases Have Overlapping Roles in Germline RNAi and Endogenous sirna Formation

Current Biology 24, 839 844, April 14, 2014 ª2014 Elsevier Ltd All rights reserved http://dx.doi.org/10.1016/j.cub.2014.02.060 MUT-14 and DEAD Box RNA Helicases Have Overlapping Roles in Germline RNAi

mut-16 and other mutator-class genes modulate 22G and 26G sirna pathways in

Supplemental Information mut-16 and other mutator-class genes modulate 22G and 26G sirna pathways in Caenorhabditis elegans. Chi Zhang, Taiowa A. Montgomery, Harrison W. Gabel, Sylvia E. J. Fischer, Carolyn

Trasposable elements: Uses of P elements Problem set B at the end

Trasposable elements: Uses of P elements Problem set B at the end P-elements have revolutionized the way Drosophila geneticists conduct their research. Here, we will discuss just a few of the approaches

Dual sgrna-directed gene knockout using CRISPR/Cas9 technology in Caenorhabditis. elegans

Dual sgrna-directed gene knockout using CRISPR/Cas9 technology in Caenorhabditis elegans Xiangyang Chen 1, Fei Xu 1, Chengming Zhu 1, Jiaojiao Ji 1, Xufei Zhou 1, Xuezhu Feng 1*, and Shouhong Guang 1*

Heme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive

Supplemental Data Heme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive gene-2 Caiyong Chen 1, Tamika K. Samuel 1, Michael Krause 2, Harry A. Dailey 3, and Iqbal

mod-1::mcherry unc-47::gfp RME ser-4::gfp vm2 vm2 vm2 vm2 VNC

A mod-1::mcherry unc-47::gfp RME B ser-4::gfp vm2 vm2 VNC vm2 vm2 VN Figure S1 Further details of mod- 1 and ser- 4 reporter expression patterns. (A) Adult head region showing mod- 1::mCherry and unc-

Transgene-assisted genetic screen identifies rsd-6 and novel genes as key components

JVI Accepted Manuscript Posted Online 27 June 2018 J. Virol. doi:10.1128/jvi.00416-18 Copyright 2018 Long et al. This is an open-access article distributed under the terms of the Creative Commons Attribution

Supplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings.

Supplementary Figure 1 Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings. (left) Representative bright-field images of wild type (wt), heterozygous (het)

Mos1 insertion. MosTIC protocol-11/2006. repair template - Mos1 transposase expression - Mos1 excision - DSB formation. homolog arm.

MosTIC (Mos1 excision induced Transgene Instructed gene Conversion) Valérie Robert (vrobert@biologie.ens.fr) and Jean-Louis Bessereau (jlbesse@biologie.ens.fr) (November 2006) Introduction: MosTIC (Robert

SUPPLEMENTARY INFORMATION

Figure S1. lev-9 mutants are resistant to levamisole. The levamisole dose-response curves indicate that lev-9 mutants are partially resistant to levamisole similar to lev-10(kr26) mutants. unc-29(x29)

SUPPLEMENTARY INFORMATION

doi:10.1038/nature10810 Supplementary Fig. 1: Mutation of the loqs gene leads to shortened lifespan and adult-onset brain degeneration. a. Northern blot of control and loqs f00791 mutant flies. loqs f00791

Biol 432L Midterm Oct 6, 2008 Name: 1. Midterm 1, Answer Key Oct. 26, 2009

Biol 432L Midterm Oct 6, 2008 Name: 1 Midterm 1, Answer Key Oct. 26, 2009 Honor Pledge: I have neither given nor received any unauthorized help on this exam: Name Printed: Signature: 1a. (2 pts) Imagine

Sol narae (Sona) is a Drosophila ADAMTS involved in Wg signaling

Sol narae (Sona) is a Drosophila ADAMTS involved in Wg signaling Go-Woon Kim, Jong-Hoon Won, Ok-Kyung Lee, Sang-Soo Lee, Jeong-Hoon Han, Orkhon Tsogtbaatar, Sujin Nam, Yeon Kim, and Kyung-Ok Cho* Supplementary

An antibiotic selection marker for nematode transgenesis

nature methods An antibiotic selection marker for nematode transgenesis Rosina Giordano-Santini, Stuart Milstein, Nenad Svrzikapa, Domena Tu, Robert Johnsen, David Baillie, Marc Vidal & Denis Dupuy Supplementary

Supplemental Data. Borg et al. Plant Cell (2014) /tpc

Supplementary Figure 1 - Alignment of selected angiosperm DAZ1 and DAZ2 homologs Multiple sequence alignment of selected DAZ1 and DAZ2 homologs. A consensus sequence built using default parameters is shown

Repression of Germline RNAi Pathways in Somatic Cells by Retinoblastoma Pathway Chromatin Complexes

Repression of Germline RNAi Pathways in Somatic Cells by Retinoblastoma Pathway Chromatin Complexes The Harvard community has made this article openly available. Please share how this access benefits you.

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.

Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying

Xu et al., Supplementary Figures 1-7

Xu et al., Supplementary Figures 1-7 Supplementary Figure 1. PIPKI is required for ciliogenesis. (a) PIPKI localizes at the basal body of primary cilium. RPE-1 cells treated with two sirnas targeting to

PIWI Associated sirnas and pirnas Specifically Require the Caenorhabditis elegans HEN1 Ortholog henn-1

PIWI Associated sirnas and pirnas Specifically Require the Caenorhabditis elegans HEN1 Ortholog henn-1 Taiowa A. Montgomery, Young-Soo Rim, Chi Zhang, Robert H. Dowen, Carolyn M. Phillips, Sylvia E. J.

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature09937 a Name Position Primersets 1a 1b 2 3 4 b2 Phenotype Genotype b Primerset 1a D T C R I E 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 Donor (D)

The Silence of the Genes

The Silence of the Genes Initial Observation: Plant geneticists aim to turn pink petunia to purple by over-expression of chalcone synthetase wt wt + Chalcone synthetase cdna driven by cauliflower mosaic

Nature Biotechnology: doi: /nbt.4166

Supplementary Figure 1 Validation of correct targeting at targeted locus. (a) by immunofluorescence staining of 2C-HR-CRISPR microinjected embryos cultured to the blastocyst stage. Embryos were stained

RNA Helicase 1 interacts with an ABC RNAi Transporter: Genetic Interactions with haf-6

RNA Helicase 1 interacts with an ABC RNAi Transporter: Genetic Interactions with haf-6 By Laticia Rivera Bachelor of Science in Biochemistry and Molecular Biology Oklahoma State University Stillwater,

No, because expression of the P elements and hence transposase in suppressed in the F1.

Problem set B 1. A wild-type ry+ (rosy) gene was introduced into a ry mutant using P element-mediated gene transformation, and a strain containing a stable ry+ gene was established. If a transformed male

Nature Structural & Molecular Biology: doi: /nsmb.3308

Supplementary Figure 1 Analysis of CED-3 autoactivation and CED-4-induced CED-3 activation. (a) Repeat experiments of Fig. 1a. (b) Repeat experiments of Fig. 1b. (c) Quantitative analysis of three independent

Supplemental Figure legends Figure S1. (A) (B) (C) (D) Figure S2. Figure S3. (A-E) Figure S4. Figure S5. (A, C, E, G, I) (B, D, F, H, Figure S6.

Supplemental Figure legends Figure S1. Map-based cloning and complementation testing for ZOP1. (A) ZOP1 was mapped to a ~273-kb interval on Chromosome 1. In the interval, a single-nucleotide G to A substitution

University of Groningen

University of Groningen Mapping determinants of gene expression plasticity by genetical genomics in C-elegans Li, Yang; Gutteling, E.W.; Tijsterman, M.; Fu, Jingyuan; Riksen, J.A.G.; Prins, P.; Plasterk,

Supplementary Methods

Supplementary Methods MARCM-based forward genetic screen We used ethylmethane sulfonate (EMS) to mutagenize flies carrying FRT 2A and FRT 82B transgenes, which are sites for the FLP-mediated recombination

7.22 ANSWERS to Problem set #1

7.22 ANSWERS to Problem set #1 1. List whether the pairs marked by the arrows are orthologous or paralogous. α tubulin (mouse) α tubulin (fly) α tubulin (worm) α tubulin (yeast) paralogous Tubulin β tubulin

To investigate the heredity of the WFP gene, we selected plants that were homozygous

Supplementary information Supplementary Note ST-12 WFP allele is semi-dominant To investigate the heredity of the WFP gene, we selected plants that were homozygous for chromosome 1 of Nipponbare and heterozygous

Supporting Online Material for

www.sciencemag.org/cgi/content/full/1119481/dc1 Supporting Online Material for LIN-12/Notch Activation Leads to MicroRNA-Mediated Down-Regulation of Vav in C. elegans Andrew S. Yoo and Iva Greenwald* *To

Growth factor, augmenter of liver regeneration

Supplemental Table 1: Human and mouse PC1 sequence equivalencies Human Mouse Domain Clinical significance; Score* PolyPhen prediction; PSIC score difference C210G C210G WSC Highly likely pathogenic; 15

Supplementary Figure 1. Phenotype and genotype of cultured and transplanted S1 KCST (A) Brightfield and mcherry fluorescence images of the spheres

Supplementary Figure 1. Phenotype and genotype of cultured and transplanted S1 KCST (A) Brightfield and mcherry fluorescence images of the spheres generated from the CD133-positive cells infected with

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/8/404/ra120/dc1 Supplementary Materials for The subcellular localization and activity of cortactin is regulated by acetylation and interaction with Keap1 Akihiro

Biology 163 Laboratory in Genetics, Final Exam, Dec. 10, 2005

1 Biology 163 Laboratory in Genetics, Final Exam, Dec. 10, 2005 Honor Pledge: I have neither given nor received any unauthorized help on this exam: Name Printed: Signature: 1. (2 pts) If you see the following

Cambridge University Press

Figure 1.1. Model of RNAi pathway in C. elegans. Transmembrane protein SID-1 allows dsrna to enter the cell. In the cytoplasm,dsrna gets processed by DCR-1,existing in a complex with RDE-4,RDE-1 and DRH-1.

DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells

Development epress online publication date 30 January 2008 983 Development 135, 983-993 (2008) doi:10.1242/dev.015552 DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells Caroline

Mannen et al., http :// /cgi /content /full /jcb /DC1

Supplemental material JCB Mannen et al., http ://www.jcb.org /cgi /content /full /jcb.201601024 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Characterization of SNB components. (A) SNB localization of Venus-tagged

Heterochromatin Silencing

Heterochromatin Silencing Heterochromatin silencing Most DNA in eukaryotes consists of repetitive DNA, including retrotransposons, transposable elements. Packaged into a condensed form: Heterochromatin:

University of Groningen

University of Groningen Differential impact of the HEN1 homolog HENN-1 on 21U and 26G RNAs in the germline of Caenorhabditis elegans Kamminga, Leonie M; van Wolfswinkel, Josien C; Luteijn, Maartje J; Kaaij,

(a) Scheme depicting the strategy used to generate the ko and conditional alleles. (b) RT-PCR for

Supplementary Figure 1 Generation of Diaph3 ko mice. (a) Scheme depicting the strategy used to generate the ko and conditional alleles. (b) RT-PCR for different regions of Diaph3 mrna from WT, heterozygote

SAS6-like protein in Plasmodium indicates that conoid-associated apical complex proteins persist in invasive stages within the mosquito vector

SAS6-like protein in Plasmodium indicates that conoid-associated apical complex proteins persist in invasive stages within the mosquito vector Richard J. Wall 1,#, Magali Roques 1,+, Nicholas J. Katris

Supplemental Data. Cui et al. (2012). Plant Cell /tpc a b c d. Stem UBC32 ACTIN

A Root Stem Leaf Flower Silique Senescence leaf B a b c d UBC32 ACTIN C * Supplemental Figure 1. Expression Pattern and Protein Sequence of UBC32 Homologues in Yeast, Human, and Arabidopsis. (A) Expression

a) Stock 4: 252 flies total: 120 are P[w+]: 64 are CyO; 56 are TM3; all are females. 132 are w-: 68 are CyO; 64 are TM3; all are males.

Drosophila Problem Set 2018 1) You have created P element transformants of a construct that contains the mini-white gene, which confers an orange eye color in a homozygous white mutant background. For

RNAi mechanisms in Caenorhabditis elegans

FEBS Letters 579 (2005) 5932 5939 FEBS 29870 Minireview RNAi mechanisms in Caenorhabditis elegans Alla Grishok * Center for Cancer Research, MIT, E17-526, 40 Ames Street, Cambridge, MA 02139, USA Received

Watson BM Gene Capitolo 11

Watson BM Gene Capitolo 11 Le proteine della trasposizione ? target-site primed reverse transcription Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Trimeric structure for an

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm

Supplementary Data 1.

Supplementary Data 1. Evaluation of the effects of number of F2 progeny to be bulked (n) and average sequencing coverage (depth) of the genome (G) on the levels of false positive SNPs (SNP index = 1).

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?

1. Whether or not the shanks of chickens contains feathers is due to two independently assorting genes. Individuals have unfeathered shanks when they are homozygous for recessive genes at two loci; the

Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance

Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression

SUPPLEMENTARY INFORMATION

Materials and Methods Transgenic Plant Materials and DNA Constructs. VEX1::H2B-GFP, ACA3::H2B-GFP, KRP6::H2B-GFP, KRP6::mock21ts-GFP, KRP6::TE21ts- GFP and KRP6::miR161ts-GFP constructs were generated

Department of Physiology, Tokyo Women's Medical University School of Medicine, Tokyo, Japan 2

Supplementary Information Endomembrane-associated RSD-3 is important for RNAi induced by extracellular silencing RNA in both somatic and germ cells of Caenorhabditis elegans! Rieko Imae 1,4, Katsufumi

Bi Lecture 3 Loss-of-function (Ch. 4A) Monday, April 8, 13

Bi190-2013 Lecture 3 Loss-of-function (Ch. 4A) Infer Gene activity from type of allele Loss-of-Function alleles are Gold Standard If organism deficient in gene A fails to accomplish process B, then gene

Two classes of silencing RNAs move between Caenorhabditis elegans tissues

A r t i c l e s Two classes of silencing RNAs move between Caenorhabditis elegans tissues Antony M Jose 1,2, Giancarlo A Garcia 1 & Craig P Hunter 1 2011 Nature America, Inc. All rights reserved. Organism-wide

The RRPA knock-in allele was generated by homologous recombination in TC1 ES cells.

Supplemental Materials Materials & Methods Generation of RRPA and RAPA Knock-in Mice The RRPA knock-in allele was generated by homologous recombination in TC1 ES cells. Targeted ES clones in which the

Supplementary Data Supplementary Figures

Supplementary Data Supplementary Figures Supplementary Figure 1. Pi04314 is expressed during infection, each GFP-Pi04314 fusion is stable and myr GFP-Pi04314 is removed from the nucleus while NLS GFP-Pi04314

Characterization of a novel gene involved in border cell migration

Characterization of a novel gene involved in border cell migration Wei-Hao Li, He-Yen Chou and Li-Mei Pai Graduate Institute of Basic Medical Science Chang-Gung University, Tao-Yuan, Taiwan, R.O.C. Abstract

Figure S1. Verification of ihog Mutation by Protein Immunoblotting Figure S2. Verification of ihog and boi

Figure S1. Verification of ihog Mutation by Protein Immunoblotting Extracts from S2R+ cells, embryos, and adults were analyzed by immunoprecipitation and immunoblotting with anti-ihog antibody. The Ihog

Caenorhabditis elegans: The Heavyweight Champ of Gene Knockout Technology

Caenorhabditis elegans: The Heavyweight Champ of Gene Knockout Technology Rachel Pan The nematode (worm) Caenorhabditis elegans was the first multicellular organism to have its genome, or complete DNA

gypsy fold change in steady state RNA levels RnpS1 Acn mago tsu GFP armi sirna mediated depletion against indicated genes in OSCs

Hayashi_FigS1 fold change in steady state RNA levels 1000 100 10 1 gypsy GFP armi mago tsu Acn RnpS1 btz sirna mediated depletion against indicated genes in OSCs Supplementary Figure S1. The EJC is required

Supplementary Information

Supplementary Information MED18 interaction with distinct transcription factors regulates plant immunity, flowering time and responses to hormones Supplementary Figure 1. Diagram showing T-DNA insertion

SUPPORTING ONLINE MATERIAL

SUPPORTING ONLINE MATERIAL MATERIAL AND METHODS Fly stocks All Drosophila stocks were grown at 25 C on yeast-containing corn meal/molasses medium. The nanos (nos) alleles nos 18 and nos 53 have been previously

Two Classes of Silencing RNAs Move between Caenorhabditis elegans Tissues

Two Classes of Silencing RNAs Move between Caenorhabditis elegans Tissues The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation

Experimental Tools and Resources Available in Arabidopsis. Manish Raizada, University of Guelph, Canada

Experimental Tools and Resources Available in Arabidopsis Manish Raizada, University of Guelph, Canada Community website: The Arabidopsis Information Resource (TAIR) at http://www.arabidopsis.org Can order

Supplemental Information

Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure

Genome research in eukaryotes

Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics

Biology 4361 Developmental Biology Lecture 4. The Genetic Core of Development

Biology 4361 Developmental Biology Lecture 4. The Genetic Core of Development The only way to get from genotype to phenotype is through developmental processes. - Remember the analogy that the zygote contains

Supplemental Figure Legends:

Supplemental Figure Legends: Fig S1. GFP-ABRO1 localization. U2OS cells were infected with retrovirus expressing GFP- ABRO1. The cells were fixed with 3.6% formaldehyde and stained with antibodies against

Automated analysis of embryonic gene expression with cellular resolution in C. elegans

Automated analysis of embryonic gene expression with cellular resolution in C. elegans John Isaac Murray, Zhirong Bao, Thomas J Boyle, Max E Boeck, Barbara L Mericle, Thomas J Nicholas, Zhongying Zhao,

a) What is heteochromatin? highly condensed, inactive chromatin c) What is RNAi? Briefly explain how it works.

GENE 603 Exam II, Fall 2016 1A Research has shown that histone acetylation is triggered by neuronal activity in rat brains during fear conditioning and memory formation. a) What enzymes are involved in

Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95

Supplementary Information Regulation of transcription by the complex and MLL complex-associated Hao Jiang, Xiangdong Lu, Miho Shimada, Yali Dou, Zhanyun Tang, and Robert G. Roeder Input HeLa NE IP lot:

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit

Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline

Figure S1a. The modular dcas9 fusion system works efficiently to suppress and activate endogenous gene expression in C. elegans

Figure S1a. The modular dcas9 fusion system works efficiently to suppress and activate endogenous gene expression in C. elegans A, a normal wild-type hermaphrodite N2 is shown. B, a dpy-5-supressed F1

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?

Problem Set 5 answers 1. Whether or not the shanks of chickens contains feathers is due to two independently assorting genes. Individuals have unfeathered shanks when they are homozygous for recessive

Lecture 8: Transgenic Model Systems and RNAi

Lecture 8: Transgenic Model Systems and RNAi I. Model systems 1. Caenorhabditis elegans Caenorhabditis elegans is a microscopic (~1 mm) nematode (roundworm) that normally lives in soil. It has become one

To assess the localization of Citrine fusion proteins, we performed antibody staining to

Trinh et al 1 SUPPLEMENTAL MATERIAL FlipTraps recapitulate endogenous protein localization To assess the localization of Citrine fusion proteins, we performed antibody staining to compare the expression

Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity.

Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity. (A) Amino acid alignment of HDA5, HDA15 and HDA18. The blue line

University of Dundee. Published in: Scientific Reports. DOI: /srep Publication date: 2016

University of Dundee SAS6-like protein in Plasmodium indicates that conoid-associated apical complex proteins persist in invasive stages within the mosquito vector Wall, Richard J.; Roques, Magali; Katris,

Prof. Fahd M. Nasr. Faculty of Sciences Lebanese University Beirut, Lebanon.

Prof. Fahd M. Nasr Faculty of Sciences Lebanese University Beirut, Lebanon https://yeastwonderfulworld.wordpress.com/ Biol328 - B3212 Molecular Biotechnology Partial Exam Question I Explain the procedure

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43

Sperm cells are passive cargo of the pollen tube in plant fertilization

In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION VOLUME: 3 ARTICLE NUMBER: 17079 Sperm cells are passive cargo of the pollen tube in plant fertilization Jun Zhang 1, Qingpei

Lihua Julie Zhu. Integrated Analysis Of ChIP-seq/chip using ChIPpeakAnno and GeneNetworkBuilder

April 2008 Integrated Analysis Of ChIP-seq/chip using ChIPpeakAnno and GeneNetworkBuilder Lihua Julie Zhu Bioconductor Developer Meeting Zurich, Switzerland December 13th -14th 2012 Outline Introduction

A RRM1 H2AX DAPI. RRM1 H2AX DAPI Merge. Cont. sirna RRM1

A H2AX DAPI H2AX DAPI Merge Cont sirna Figure S1: Accumulation of RRM1 at DNA damage sites (A) HeLa cells were subjected to in situ detergent extraction without IR irradiation, and immunostained with the

Supplementary Figure 1. Chromosome 3 is devoid of the telomere-proximal subtelomeric

Supplementary Figure 1. Chromosome 3 is devoid of the telomere-proximal subtelomeric common sequences. (a) Schematic illustration of the telomere-proximal site of subtelomeres. The restriction map is based

Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin

Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin (WGA-Alexa555) was injected into the extracellular perivitteline

Two classes of genetic pathways I) Developmental/synthetic pathways II) Regulatory/binary switch pathways

Two classes of genetic pathways I) Developmental/synthetic pathways II) Regulatory/binary switch pathways I) Developmental pathways Synthesis and/or assembly of molecule(s), subcellular, cellular or multicellular

SUPPLEMENTARY INFORMATION

SULEMENTARY INFORMATION doi:10.1038/nature12117 Supplementary Discussion Although loss of leads to initiation of postembryonic development even under starvation conditions, ectopic overexpression of under

Enzyme that uses RNA as a template to synthesize a complementary DNA

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have

Biology 163 Laboratory in Genetics Midterm 2, Nov. 14, Honor Pledge: I have neither given nor received any unauthorized help on this exam:

1 Biology 163 Laboratory in Genetics Midterm 2, Nov. 14, 2005 Honor Pledge: I have neither given nor received any unauthorized help on this exam: Name Printed: ignature: 1. Normally you need to cross two

Lecture 2-3: Using Mutants to study Biological processes

Lecture 2-3: Using Mutants to study Biological processes Objectives: 1. Why use mutants? 2. How are mutants isolated? 3. What important genetic analyses must be done immediately after a genetic screen

DOI: 10.1038/ncb3259 A Ismail et al. Supplementary Figure 1 B 60000 45000 SSC 30000 15000 Live cells 0 0 15000 30000 45000 60000 FSC- PARR 60000 45000 PARR Width 30000 FSC- 15000 Single cells 0 0 15000

An H4K16 histone acetyltransferase mediates decondensation of the X chromosome in C. elegans males

DOI 10.1186/s13072-016-0097-x Epigenetics & Chromatin RESEARCH Open Access An H4K16 histone acetyltransferase mediates decondensation of the X chromosome in C. elegans males Alyssa C. Lau 1,2, Kevin P.

Biotechnology Explorer

Biotechnology Explorer C. elegans Behavior Kit Bioinformatics Supplement explorer.bio-rad.com Catalog #166-5120EDU This kit contains temperature-sensitive reagents. Open immediately and see individual

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb2880 Supplementary Figure 1 Sequence alignment of Deup1 and Cep63. The protein sequence alignment was generated by the Clustal X 2.0 multiple sequence alignment program using default parameters.

Fig. S1. Negative controls for in situ hybridization results using bam antisense probe. Fig. S2. Overexpression of either mir-275 or mir306

Fig. S1. Negative controls for in situ hybridization results using bam antisense probe. (A) In situ hybridization using bam sense probe in wild-type testis. (B) In situ hybridization using bam antisense

Biological Sciences 50 Practice Final Exam. Allocate your time wisely.

NAME: Fall 2005 TF: Biological Sciences 50 Practice Final Exam A. Be sure to write your name on the top of each of page of the examination. B. Write each answer only on the same page as the pertinent question.