Chronic hepatitis C virus (HCV) infection remains a. Development of Robust Hepatitis C Virus Genotype 4 Subgenomic Replicons

Size: px
Start display at page:

Download "Chronic hepatitis C virus (HCV) infection remains a. Development of Robust Hepatitis C Virus Genotype 4 Subgenomic Replicons"

Transcription

1 GASTROENTEROLOGY 2013;144:59 61 Development of Robust Hepatitis C Virus Genotype 4 Subgenomic Replicons BETTY PENG, 1 MEI YU, 1 SIMIN XU, 1 YU JEN LEE, 1 YANG TIAN, 1 HUILING YANG, 1 KATIE CHAN, 1 HONGMEI MO, 1 JOHN MCHUTCHISON, 2 WILLIAM DELANEY IV, 1 and GUOFENG CHENG 1 BRIEF REPORTS 1 Biology Department and 2 Clinical Research, Gilead Sciences, Foster City, California See Covering the Cover synopsis on page 1; see editorial on page 13. Despite the prevalence of hepatitis C virus genotype 4, no replicon system is available for study of the genotype. To facilitate discovery and development of reagents against this virus, we synthesized and transcribed a genotype 4a subgenomic replicon and transfected Huh7-Lunet cells with it, which yielded very few colonies. However, when we used a new Huh- 7 derived cell line, colony formation increased 70- fold. We identified multiple adaptive mutations in the virus s nonstructural 3 or 4A proteins that allowed the cells to maintain stable, genotype 4a luciferase-encoding replicons. Several classes of hepatitis C virus inhibitors had different antiviral effects on genotypes 4a vs 1b. The genotype 4a replicon system we created will aid in the development of treatment regimens for all genotypes of hepatitis C virus. Keywords: Pan-Genotypic; Q34R; Cured Huh-7 Cell Line; GS-5885; GS Chronic hepatitis C virus (HCV) infection remains a significant global health burden, with an estimated 170 million people infected worldwide. Although genotype (GT) 1 is generally predominant worldwide, GT4 is prevalent in the Middle East and many African countries, and is being observed increasingly in central and northern Europe. 1 3 GT4 represents 93% of HCV infections in Egypt, and 5% 15% of infections in several European countries. 1 Despite its prevalence, the current standard of care has limited efficacy or is not approved (eg, telaprevir or boceprevir) for GT4 patients. 4 Clearly, there is a need for additional therapies for GT4 patients. However, no GT4 replicons have been available to facilitate antiviral discovery. HCV replicons are self-replicating HCV RNA sequences that have served as essential tools for molecular virology studies and drug discovery. 5,6 To date, replicons have only been established for genotypes 1a, 1b, and 2a. 5,7,8 Here we report on the development of the first GT4a replicon that efficiently replicates in vitro. To establish a subgenomic GT4a replicon, the consensus sequence of the GT4a ED43 strain, based on the ED43 infectious clone (GenBank accession # GU814266), 9 was constructed as described previously by Lohmann et al. 5 In addition, the nonstructural protein (NS) 5A mutation S232I (or S2204I), previously shown to enhance GT1 replication, was incorporated (Figure 1A). 8 In vitro transcribed replicon RNA was electroporated into Huh-7 Lunet, 51C, and 1C cells and selected with Geneticin (G418). In Lunet cells, stable replicon colonies were selected at very low frequency, 0.05 colony-forming unit (CFU)/ g RNA. In 51C cells, 10 stable colonies were selected at an improved frequency of 0.3 CFU/ g RNA. Strikingly, in 1C, a cell line generated by curing a GT1a replicon clone derived from 51C cells and highly permissive to GT1a replicon replication, GT4a replicon colonies were readily selected and colony-formation efficiency was improved 70-fold compared with Lunet cells. NS5A mutation S232I was important to the selection of stable replicon colonies because no colony survived in the absence of S232I in 1C cells (Figure 1B). Twelve GT4a replicon colonies isolated from 1C cells were expanded, and the remaining colonies were pooled together. High levels of HCV replicon RNA were detected in all selected replicon cells (Supplementary Figure 1). In consistency, Western blot analyses readily detected NS5A protein in all replicon cells and an immunohistochemical analysis of the GT4a replicon pool indicated strong staining for NS5A in the perinuclear region (Supplementary Figure 1). In addition, 1 g total cellular RNA of the GT4a replicon pool yielded hundreds of colonies in Lunet cells (Supplementary Figure 2). Together, these results confirmed that the selected colonies harbored replicating GT4a replicons. These replicons were subsequently sequenced and multiple amino acid changes were identified (Supplementary Table 1). NS3 helicase mutations of T343K or T343R were observed in 4 clones, A200E in 2 clones, and T511R in 1 clone together with L179P in NS5A. The remaining 5 clones had mutations in NS4A protein. Four had either Q34K or Q34R and the final clone had E52V. To investigate whether emerging mutations enhanced replication, NS4A Q34R mutation was introduced into the GT4a neomycin (neo) construct and validated to enhance colony-formation efficiency almost 3000-fold (Figure 1B). All emerging singlet mutations were then individually introduced into a GT4a Renilla luciferase-neo construct to facilitate the quantification of replicon replication (Figure 1C). Abbreviations used in this paper: GT, genotype; HCV, hepatitis C virus; NS3, nonstructural protein 3; neo, neomycin by the AGA Institute /$

2 60 PENG ET AL GASTROENTEROLOGY Vol. 144, No. 1 BRIEF REPORTS Figure 1. NS3 and NS4A mutations were selected to enhance GT4a replicon replication. (A) GT4a ED43 strain replicons encode a neomycin phosphotransferase gene (neo) or a Renilla luciferase (Rluc)-neo fusion reporter., NS5A S232I mutation. (B) Ten-microgram GT4a replicon RNA as indicated was in vitro transcribed and electroporated into 1C cells. Forty-eight hours after seeding, medium was replaced with complete Dulbecco s modified Eagle medium supplemented with 0.5 mg/ml G418 and refreshed twice per week. (C) Individual mutations were introduced into the ED43 Rluc-neo construct by site-directed mutagenesis, respectively. All replicon RNAs were transfected into 1C cells and 10,000 transfected cells were plated into wells in a 96-well plate without G418. At indicated times, cells were analyzed for luciferase activity. Dotted line indicates the background relative light units (RLU) value. Data represent mean of 2 independent experiments with error bars. Replicons encoding any emerging mutation actively replicated as evidenced by significant increases in luciferase signal within h of transfection. In contrast, the parental replicons without the mutations did not show any signal increase, similar to the replication-defective polymerase GND mutant. Interestingly, lack of NS5A mutation S232I abolished the replicon RNA replication, suggesting it is critical for the GT4a replicon adaptation. The adaptive functions of these emerging mutations were also confirmed in the replicon colony formation assays (Supplementary Figure 3 and Supplementary Table 2). In addition, all adaptive replicons showed enhanced RNA replication in Lunet cells, although at a level lower than in 1C cells (Supplementary Figure 4 and Supplementary Table 2). These results suggest that all emerging mutations are GT4a adaptive mutations with T343R in NS3 helicase, and Q34R in NS4A being the most effective, which are comparable to adapted GT1a Renilla luciferase-neo replicon, but weaker than GT1b replicon. We next sought to establish cell lines stably replicating luciferase-encoding replicons for antiviral assays. Although the parental Renilla luciferase-neo replicon failed to yield any colonies after G418 selection, a Q34R mutant replicon significantly improved colony-formation efficiency (Supplementary Figure 2). A stable cell line (clone- 23) was selected for an antiviral study of 6 different classes of HCV inhibitors. EC 50 values against both GT1b and GT4a replicons were successfully generated using a 384- well antiviral assay measuring luciferase activity (Table 1).

3 January 2013 GENERATION OF GENOTYPE 4A HCV REPLICONS 61 Table 1. Antiviral Activities of HCV Inhibitors Against GT1b and GT4a Replicons Inhibitor classes Compounds GT1b RLucNeo EC 50 (nm) GT4a RlucNeo EC 50 (nm) GT4a/1b EC 50 ratio NS3 protease Telaprevir Boceprevir GS ITMN TMC NS4A ACH NS5A GS BMS NS5B Nuc GS CMeA NS5B non-nuc GS MK GS Filibuvir A HCV Host target CsA Interferon alfa (IU/mL) BRIEF REPORTS NOTE. Data represent a mean of at least 2 independent experiments with standard deviations. CsA, cyclosporine A; Rluc, Renilla luciferase. Of the 6 classes, non-nucleoside NS5B polymerase inhibitors exhibited the greatest deviation in activity between genotypes. Many inhibitors did not have measurable activity against GT4a ( 4.44 M). Most NS3 protease inhibitors had similar potency, but telaprevir (VX-950) demonstrated approximately 4-fold less susceptibility to GT4a compared with GT1b. This result is in agreement with clinical trial data showing that telaprevir had significantly less efficacy in GT4 HCV-infected patients compared with GT1. 11 Inhibitors targeting the NS5B active site and host factors had similar potency against both GT1b and GT4a, consistent with previous pan-genotypic results. 4,12 Both NS5A inhibitors remained potent against GT4a. Overall, these results demonstrate the utility of this novel GT4a replicon cell line for antiviral drug discovery. In summary, we report the isolation of the first GT4a replicon that efficiently replicates in vitro. Using a novel permissive cell line, stable GT4a colonies were readily identified, confirming that cellular factors play a critical role in HCV replication in cell culture. 13 The 1C permissive cell line might facilitate efforts to establish replicons from other genotypes. Multiple adaptive mutations in NS3 or NS4A were demonstrated to enhance GT4a replicon replication. The localization of these mutations suggest that they may be involved in protein protein interactions, such as modulating NS3/4A protease activity. 14 Although the article was under revision, a functional GT4a replicon was independently reported with a diverse set of adaptive mutations. 15 These adaptive mutations permitted the establishment of cells stably replicating luciferase-encoding GT4a replicons. These novel cell lines have allowed us to efficiently profile the antiviral activity of multiple classes of HCV inhibitors, with results consistent with previous clinical observations. 4,12 Overall, this novel GT4a replicon will serve as a valuable tool for antiviral drug discovery and development. In conjunction with existing replicons, it will aid the development of pan-genotypic HCV regimens for the treatment of HCV worldwide. Supplementary Material Note: To access the supplementary material accompanying this article, visit the online version of Gastroenterology at and at dx.doi: /j.gastro References 1. Cornberg M, et al. Liver Int 2011;31(Suppl 2): Sievert W, et al. Liver Int 2011;31(Suppl 2): Lavanchy D, et al. Clin Microbiol Infect 2011;17: Ghany MG, et al. Hepatology 2009;49: Lohmann V, et al. Science 1999;285: Bartenschlager R, et al. J Hepatol 2005;43: Kato T, et al. Gastroenterology 2003;125: Blight KJ, et al. J Virol 2003;77: Gottwein JM, et al. J Virol 2010;84: Robinson M, et al. AAC 2010;54: Benhamou Y, et al. the 61st AASLD Hassanein T, et al. HEPDart Sumpter R, et al. J Virol 2005;79: Yao N, et al. Structure 1999;7: Saeed M, et al. AAC 2012; Epub ahead of print. Received February 2, Accepted September 17, Reprint requests Address requests for reprints to: Guofeng Cheng, PhD, Gilead Sciences, 333 Lakeside Drive, Foster City, CA Guofeng.cheng@gilead.com; fax: (650) Acknowledgments We are grateful to Amy Corsa for her suggestions on designing the replicon constructs. Conflicts of interest The authors disclose the following: All of the authors are stockholders and employees of Gilead Sciences. This article contains information describing the in vitro activity of Gilead compounds currently in development as treatments for HCV.

4 61.e1 PENG ET AL GASTROENTEROLOGY Vol. 144, No. 1 Supplementary Materials and Methods Cell Culture The following HCV permissive cell lines were used during these studies: Huh7-Lunet, 51C, and 1C. Huh7- Lunet was obtained from ReBLikon GmbH (Mainz, Germany). 1 The derivation of 51C cells, and stable genotype 1a H77 and genotype 1b Con-1 Renilla luciferase (Rluc)- neo replicon cells were described previously. 2 1C cells were derived by curing a GS-5885 resistant genotype 1a replicon clone derived from 51C cells. The 1C cells have been intensively validated for a complete cure and no surviving colonies have been observed after G418 treatment. All cell lines were propagated as described previously. 2 Replicon cell lines were selected and maintained with 0.5 mg/ml G418 (Geneticin; Invitrogen, Carlsbad, CA). Construction of Plasmids Encoding Genotype 4a HCV Subgenomic Replicons A plasmid (pgt4aed43sg) encoding a subgenomic genotype 4a replicon based on the ED43 infectious clone (GenBank accession # GU814266) 3 was prepared by DNA synthesis and cloning (Genescript, Piscataway, NJ). The synthesized replicon incorporated the following elements from 5= to 3= (Figure 1): (1) the ED43 5=UTR, extending to the first 48 nucleotides of core, (2) a linker 5=-GGC GCG CCA-3= that introduces the AscI restriction site (underlined), (3) the neo gene, (4) a linker 5 -GGC CGG CCG CGG CCG CAA-3 that introduces FseI and Not I restriction sites (underlined), (5) the encephalomyocarditis virus (EMCV) IRES, (6) a linker 5=-ACG CGT ATG-3= that introduces the MluI restriction site (underlined) and an ATG start codon, (7) the NS3 NS5B polyprotein region of ED43 including an NS5A adaptive mutation (S232I), and (8) the 3=UTR of ED43. Construction of Plasmids Encoding Genotype 4a HCV Rluc Subgenomic Replicons The plasmid (pgt4aed43rlucsg) encoding a subgenomic replicon that incorporated the humanized Rluc reporter gene was generated as follows: The pgt4aed43sg plasmid described here was cut using AscI and MluI restriction enzymes (to remove the neo gene) and gel purified using a commercial kit (Qiagen, Valencia, CA). A gene fragment encoding the humanized Rluc gene fused with the neo gene along with the EMCV region from pjfh1 (Toray, Japan), were polymerase chain reaction (PCR) amplified by using Accuprime super mix I (Invitrogen) with the following primers from the phrlucneosg2a plasmid described here: 2aRlucNeoAscI- For: 5=-AAC ACC AAC GGC GCG CCA ATG GCT TCC AAG GTG TAC-3= (AscI site is introduced by the primer and is underlined), 2aEMCVIRESMluIRev: 5=-TGG GCA TAA GCA GTG ATG GGA GCC ATA CGC GTA TCG 3= (MluI site underlined). The subsequent PCR fragment was cut with AscI and MluI and gel purified using a commercial kit (Qiagen). The vector and insert pieces were ligated using LigaFast Rapid DNA Ligation System per manufacturer s protocol (Promega, Madison, WI). The resulting vector, pgt4aed43rlucsg was sequenced to confirm the correct orientation and sequence of the hrluc- Neo. The phrlucneosg2a plasmid was constructed by replacing the Luc-Neo fragment in the plasmid plucneosg2a with the hrluc-neo gene amplified from the plasmid hrluc-neo Flexi(R) (Promega) as described previously. 2,4 RNA Transcription and Transfection and Selection of Stable Replicon Cell Lines RNA transcription and transfection was performed as described previously. 2 Forty-eight hours after plating the transfected cells, medium was replaced with complete Dulbecco s modified Eagle medium supplemented with 0.5 mg/ml G418, which was refreshed twice per week. Cell clones were isolated after approximately 3 weeks of G418 selection, expanded, and cryopreserved at early passages. Genotypic Analysis and Quantification of HCV RNA HCV RNA isolation, reverse transcription (RT)- PCR, and sequencing were performed by TACGen (Hayward, CA). Otherwise HCV replicon cellular RNA was extracted and purified using an RNeasy kit (Qiagen) according to manufacturer s protocol. RT-PCR was performed using the SuperScript III first-strand synthesis system (Invitrogen), followed by amplification of PCR products using the high-fidelity PCR polymerase (Invitrogen). PCR products were sequenced by TACGen (Hayward). HCV RNA copy numbers were determined using HCV RNA real-time RT-PCR assay supplied by EraGen Biosciences (Madison, WI). HCV RNA amounts were normalized by glyceraldehyde-3-phosphate dehydrogenase copy numbers that were determined by following the glyceraldehyde-3-phosphate dehydrogenase real-time RT- PCR assay protocol recommended by the manufacturer (Qiagen). Replicon Antiviral Assays Replicon cells were seeded in 384-well plates at a density of 2000 cells/well in 90 L Dulbecco s modified Eagle medium culture medium excluding G418. Cells were treated with 3-fold serial drug dilutions with 10 different concentrations, and replicon antiviral activities were determined by assaying luciferase activity as markers for replicon levels as described previously. 2 Antiviral Compounds VX-950 (telaprevir), boceprevir, ITMN-191, and 2-C-methyl adenosine (2-CMeA) were purchased from Acme Bioscience (Belmont, CA). Interferon alfa and cyclosporine A were purchased from Sigma-Aldrich (St

5 January 2013 GENERATION OF GENOTYPE 4A HCV REPLICONS 61.e2 Louis, MO). An Abbott palm site I benzothiadiazine NS5B polymerase inhibitor (A ) was synthesized by ChemALong Laboratories (Lemont, IL). The Wyeth HCV NS5B site palm site II inhibitor HCV-796 was synthesized by Curragh Chemistries (Cleveland, OH). Gilead compounds GS-5885, GS-9190, GS-9451, GS-9669, and GS-7977; Achillion NS4A inhibitor ACH-806, Tibotec protease inhibitor TMC-435; Merck NS5B thumb site I inhibitor MK-3281; Pfizer NS5B thumb site II inhibitor Filibuvir; and the Bristol-Myers Squibb NS5A inhibitor (BMS ) were synthesized by Gilead Sciences. Supplementary References 1. Friebe P, et al. J Virol 2005;79: Robinson M, et al. Antimicrob Agents Chemother 2010;54: Gottwein JM, et al. J Virol 2010;84: Cheng G, et al. Antimicrob Agents Chemother 2011;55:

6 61.e3 PENG ET AL GASTROENTEROLOGY Vol. 144, No. 1 A 10 8 B HCV RNA Copies per µg Cellular RNA 64kd 50kd GT4a-1 GT4a-2 GT4a-3 GT4a-4 GT4a-5 GT4a-6 GT4a-7 GT4a-8 GT4a-9 GT4a-10 GT4a-11 GT4a-12 GT4a Pool GT1a H77 Replicon Clones Selected GT4a clones pool GT1b Bip NS5A C GT4a replicon cells 1C cells Supplementary Figure 1. (A) Intracellular HCV replicon RNA expression level. Selected genotype 4a replicon cell lines were measured for their intracellular HCV replicon RNA level by using HCV-specific real-time RT quantitative PCR (RT-QPCR), normalized by cellular glyceraldehydes-3- phosphate dehydrogenase (GAPDH) level as described in the Supplementary Material and Methods. Genotype 1a H77 Rluc-neo stable replicon cells were included as a reference. (B) NS5A expression in selected replicon cells. The selected replicon cell lines were pelleted and completely lysed in sodium dodecyl sulfate loading buffer. The Western blot was analyzed with primary anti-ns5a antibody (clone 9E10; Apath, Brooklyn, NY), which was co-stained with anti-bip antibody as a loading control. The staining was analyzed by Odyssey Imaging (LI-COR, Lincoln, NE). (C) NS5A immunostaining of the selected replicon cells. The genotype 4a replicon cell pool was stained with the same primary anti-ns5a antibody as above (red) and Hoechst (blue, indicating nuclei). 1C cells were stained as a negative control.

7 January 2013 GENERATION OF GENOTYPE 4A HCV REPLICONS 61.e4 In vitro transcribed GT4a RNA 16 µg Total RNA from GT4a replicon clone 1 µg 16 µg Supplementary Figure 2. Efficient colony formation of stable GT4a replicon clones. Total cellular RNA was extracted from the GT4a replicon pool cell line and then electroporated into Huh-7 Lunet cells at the indicated amounts. The efficiency of colony formation was determined as described in the Supplementary Materials and Methods. In vitro transcribed parental GT4a replicon RNA was transfected in parallel as a control. Supplementary Table 1. Mutations Identified in Genotype 4a Stable Replicon Cell Lines Mutations No. of occurrence Nucleotide positions a Nucleotide mutations Replicon clone NS3 A200E /2436 C to G #7, #8 and pool NS3 T343K /2865 C to A #1, #3, and #11 NS3 T343R /2865 C to G #6 NS3 T511R /3369 C to G #10 NS5A L179P 6792/5211 T to C NS4A Q34K /3830 C to A #2, #4 and pool NS4A Q34R /3831 A to G #9, #12 and pool NS4A E52V /3885 A to T #5 a The nucleotide positions were presented in both ED43 full-length virus genome/rlu-neo subgenomic replicon.

8 61.e5 PENG ET AL GASTROENTEROLOGY Vol. 144, No. 1 Supplementary Figure 3. Selected NS3 or NS4A mutations enhance GT4a Rluc-neo replicon colony formation. All GT4a replicon constructs were prepared by introducing indicated mutations into wild-type GT4a Rluc-neo replicon plasmid using site-directed mutagenesis. Ten micrograms each GT4a replicon RNA was in vitro transcribed and electroporated into 1C cells. Forty-eight hours after seeding in 150-cm dishes, medium was replaced with complete Dulbecco s modified Eagle medium supplemented with 0.5 mg/ml G418 and refreshed twice per week. After 3 weeks of G418 selection, cells were stained with 0.05% crystal violet. GT1a H77 Rluc-neo replicon was included as a reference. The colony-formation efficiency (CFU/ g RNA) was determined and the data are summarized in Supplementary Table 2. Supplementary Table 2. Stable Colony Formation and Transient Replication Efficiency of HCV Replicons in 1C and Lunet Cells Replicons CFU/ g RNA in 1C cells CFU/ g RNA in lunet Replication in 1C (144hvs4h) a Replication in lunet (144hvs4h) a GT4aNeo wt ND ND GT4aNeo wt NS5A S232I ND ND GT4aNeo wt NS5A S232I NS4A Q34R ND ND GT4aRlucNeo wt NS5A S232I 0.05 ND 0.02 b 0.1 GT4aRlucNeo wt NS4A Q34R 0.41 ND 0.06 b 0.2 GT4aRlucNeo wt NS5A S232I NS4A Q34R GT4aRlucNeo wt NS5A S232I NS4A Q34K 121 ND GT4aRlucNeo wt NS5A S232I NS4A E52V 21 ND GT4aRlucNeo wt NS5A S232I NS3 A200E 43 ND GT4aRlucNeo wt NS5A S232I NS3 T343R 299 ND GT4aRlucNeo wt NS5A S232I NS3 T343K 39 ND GT4aRlucNeo wt NS5A S232I NS5B GND b 0.23 GT1aRlucNeo H77 NS5A S232I NS3 P470L GT1bRlucNeo Con-1 NS3 E176G, T254I NS4B K135T 10, c ND, not determined; Rluc, Renilla luciferase; wt, wild-type. a The values represent the ratio of Rluc signal of 144 h (day 6) to 4 h post transfection. b The value could be overestimated because their Rluc signals at day 6 post transfection were essentially at the background level. c The value was derived from previous studies, not in parallel experiments.

9 January 2013 GENERATION OF GENOTYPE 4A HCV REPLICONS 61.e6 Supplementary Figure 4. 1C cells are more permissive to GT4a replicon replication than Lunet cells. GT4a replicon RNA was in vitro transcribed and electroporated into 1C and Lunet cells. Forty-eight hours after seeding, medium was replaced with complete Dulbecco s modified Eagle medium supplemented with 0.5 mg/ml G418 and refreshed twice per week. After 3 weeks of G418 selection, cells were stained with 0.05% crystal violet. Colony-formation efficiency (CFU/ g RNA) was determined and the data are summarized in Supplementary Table 2.

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Inhibition of Hepatitis C Virus Replication by GS-6620, A Potent C-Nucleoside Monophosphate Prodrug

Inhibition of Hepatitis C Virus Replication by GS-6620, A Potent C-Nucleoside Monophosphate Prodrug Inhibition of Hepatitis C Virus Replication by, A Potent C-Nucleoside Monophosphate Prodrug Running Title: In Vitro Pharmacology of Authors: Joy Y. Feng et al. Supplementary Information Table S1. RNA primer

More information

Allele-Specific Real-Time PCR System for Detection of Subpopulations of Genotype 1a and 1b Hepatitis C NS5B Y448H Mutant Viruses in Clinical Samples

Allele-Specific Real-Time PCR System for Detection of Subpopulations of Genotype 1a and 1b Hepatitis C NS5B Y448H Mutant Viruses in Clinical Samples JOURNAL OF CLINICAL MICROBIOLOGY, Sept. 2011, p. 3168 3174 Vol. 49, No. 9 0095-1137/11/$12.00 doi:10.1128/jcm.00274-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Allele-Specific

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane

More information

Supplementary Information

Supplementary Information Supplementary Information Generation of plasmid constructs The replicon-containing vector used to produce the constructs in this study, pfk5.1neo FAK (from which the [FA]neo replicon is produced), contains

More information

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC

More information

An engineered tryptophan zipper-type peptide as a molecular recognition scaffold

An engineered tryptophan zipper-type peptide as a molecular recognition scaffold SUPPLEMENTARY MATERIAL An engineered tryptophan zipper-type peptide as a molecular recognition scaffold Zihao Cheng and Robert E. Campbell* Supplementary Methods Library construction for FRET-based screening

More information

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006 Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supporting Information for Expanding the Genetic

More information

Allosteric inhibitors of the NS3 protease from the hepatitis C virus with a new action mechanism

Allosteric inhibitors of the NS3 protease from the hepatitis C virus with a new action mechanism Jornada 2-2012: Zaragoza Allosteric inhibitors of the NS3 protease from the hepatitis C virus with a new action mechanism Zaragoza, 6 de junio de 2012 Content 1. The Research Group 2. The Product a) Target

More information

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples

More information

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain

More information

PCR analysis was performed to show the presence and the integrity of the var1csa and var-

PCR analysis was performed to show the presence and the integrity of the var1csa and var- Supplementary information: Methods: Table S1: Primer Name Nucleotide sequence (5-3 ) DBL3-F tcc ccg cgg agt gaa aca tca tgt gac tg DBL3-R gac tag ttt ctt tca ata aat cac tcg c DBL5-F cgc cct agg tgc ttc

More information

Genotype and Subtype Profiling of PSI-7977 as a. Nucleotide Inhibitor of Hepatitis C Virus. Running title: PSI-7977 as a Nucleotide Inhibitor of HCV

Genotype and Subtype Profiling of PSI-7977 as a. Nucleotide Inhibitor of Hepatitis C Virus. Running title: PSI-7977 as a Nucleotide Inhibitor of HCV AAC Accepts, published online ahead of print on 19 March 2012 Antimicrob. Agents Chemother. doi:10.1128/aac.00054-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6

More information

Novel Hepatitis C Virus Reporter Replicon Cell Lines Enable Efficient Antiviral Screening against Genotype 1a

Novel Hepatitis C Virus Reporter Replicon Cell Lines Enable Efficient Antiviral Screening against Genotype 1a ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Aug. 2010, p. 3099 3106 Vol. 54, No. 8 0066-4804/10/$12.00 doi:10.1128/aac.00289-10 Copyright 2010, American Society for Microbiology. All Rights Reserved. Novel

More information

Supplemental Data Supplemental Figure 1.

Supplemental Data Supplemental Figure 1. Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)

More information

Novel HCV Reporter Replicon Cell Lines Enable Efficient. Antiviral Screening against Genotype 1a

Novel HCV Reporter Replicon Cell Lines Enable Efficient. Antiviral Screening against Genotype 1a AAC Accepts, published online ahead of print on 1 June 0 Antimicrob. Agents Chemother. doi:./aac.00- Copyright 0, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

Novel HCV Reporter Replicon Cell Lines Enable Efficient. Antiviral Screening against Genotype 1a

Novel HCV Reporter Replicon Cell Lines Enable Efficient. Antiviral Screening against Genotype 1a AAC Accepts, published online ahead of print on 1 June 0 Antimicrob. Agents Chemother. doi:./aac.00- Copyright 0, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

SUPPLEMENTARY MATERIAL AND METHODS

SUPPLEMENTARY MATERIAL AND METHODS SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,

More information

Hes6. PPARα. PPARγ HNF4 CD36

Hes6. PPARα. PPARγ HNF4 CD36 SUPPLEMENTARY INFORMATION Supplementary Table Positions and Sequences of ChIP primers -63 AGGTCACTGCCA -79 AGGTCTGCTGTG Hes6-0067 GGGCAaAGTTCA ACOT -395 GGGGCAgAGTTCA PPARα -309 GGCTCAaAGTTCAaGTTCA CPTa

More information

Cat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1

Cat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 Product Name: Kit Component TA PCR Cloning Kit (ptakn-2) Cat. # Product Size DS130 TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 2 Ligation Buffer

More information

Overexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%)

Overexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%) SUPPLEMENTARY TABLES Table S1. Alteration of ZNF322A protein expression levels in relation to clinicopathological parameters in 123 Asian and 74 Caucasian lung cancer patients. Asian patients Caucasian

More information

Supplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C

Supplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C Supplementary Table 1: Oligonucleotides and Plasmids 913954 5'- GCT CTA GAG AAC TTG AAG TAC AGA CTG C 913955 5'- CCC AAG CTT ACA GTG TGG CCA TTC TGC TG 223396 5'- CGA CGC GTA CAG TGT GGC CAT TCT GCT G

More information

Design. Construction. Characterization

Design. Construction. Characterization Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication

More information

Project 07/111 Final Report October 31, Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines

Project 07/111 Final Report October 31, Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines Project 07/111 Final Report October 31, 2007. Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines Project Leader: Dr Douglas C. Hodgins (519-824-4120 Ex 54758, fax 519-824-5930)

More information

Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis

Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis 1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons

More information

SUPPLEMENTARY MATERIALS AND METHODS. E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1)

SUPPLEMENTARY MATERIALS AND METHODS. E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1) SUPPLEMENTARY MATERIALS AND METHODS E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1) dinb::kan (lab stock) derivative was used as wild-type. MG1655 alka tag dinb (2) is

More information

Arabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB

Arabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Arabidopsis actin depolymerizing factor mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Files in this Data Supplement: Supplemental Table S1 Supplemental Table

More information

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt

More information

UNIVERSITY OF SOUTH ALABAMA COLLEGE OF MEDICINE, MOBILE, AL. In general:

UNIVERSITY OF SOUTH ALABAMA COLLEGE OF MEDICINE, MOBILE, AL. In general: HCV Retreatment of DAA Failures JORGE L. HERRERA, MD, MACG UNIVERSITY OF SOUTH ALABAMA COLLEGE OF MEDICINE, MOBILE, AL DAA Drug Classes NS3/4 (protease) inhibitors Telaprevir, boceprevir, simeprevir, paritaprevir

More information

Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of

Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated

More information

Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were

Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were 1 Supplemental methods 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 21 22 23 Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were monitored by quantitative reverse-transcription

More information

Development of Positive Control for Hepatitis B Virus

Development of Positive Control for Hepatitis B Virus Human Journals Research Article December 2015 Vol.:2, Issue:2 All rights are reserved by Saurabh Bandhavkar et al. Development of Positive Control for Hepatitis B Virus Keywords: Hepatitis B virus, pbluescript,

More information

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC

More information

Regulation of enzyme synthesis

Regulation of enzyme synthesis Regulation of enzyme synthesis The lac operon is an example of an inducible operon - it is normally off, but when a molecule called an inducer is present, the operon turns on. The trp operon is an example

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation

More information

Gene synthesis by circular assembly amplification

Gene synthesis by circular assembly amplification Gene synthesis by circular assembly amplification Duhee Bang & George M Church Supplementary figures and text: Supplementary Figure 1. Dpo4 gene (1.05kb) construction by various methods. Supplementary

More information

Supplemental material

Supplemental material Supplemental material Diversity of O-antigen repeat-unit structures can account for the substantial sequence variation of Wzx translocases Yaoqin Hong and Peter R. Reeves School of Molecular Bioscience,

More information

Transcriptional regulation of IFN-l genes in Hepatitis C virus-infected hepatocytes via IRF-3 IRF-7 NF- B complex

Transcriptional regulation of IFN-l genes in Hepatitis C virus-infected hepatocytes via IRF-3 IRF-7 NF- B complex POSTER PRESENTATION Transcriptional regulation of IFN-l genes in Hepatitis C virus-infected hepatocytes via IRF-3 IRF-7 NF- B complex Hai-Chon Lee *, Je-In Youn, Kyungwha Lee, Hwanyul Yong, Seung-Yong

More information

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and

More information

Supplemental Material Igreja and Izaurralde 1. CUP promotes deadenylation and inhibits decapping of mrna targets. Catia Igreja and Elisa Izaurralde

Supplemental Material Igreja and Izaurralde 1. CUP promotes deadenylation and inhibits decapping of mrna targets. Catia Igreja and Elisa Izaurralde Supplemental Material Igreja and Izaurralde 1 CUP promotes deadenylation and inhibits decapping of mrna targets Catia Igreja and Elisa Izaurralde Supplemental Materials and methods Functional assays and

More information

SUPPLEMENTARY INFORMATION. Material and methods

SUPPLEMENTARY INFORMATION. Material and methods SUPPLEMENTARY INFORMATION Material and methods Cell culture Human hepatocellular carcinoma (HepG) cells and human embryonic kidney (HEK)93 cells were grown in Dulbecco s modified Eagle s medium (Invitrogen

More information

Materials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below).

Materials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below). Protein Synthesis Instructions The purpose of today s lab is to: Understand how a cell manufactures proteins from amino acids, using information stored in the genetic code. Assemble models of four very

More information

Original article Development of a chimeric replicon system for phenotypic analysis of NS3 protease sequences from HCV clinical isolates

Original article Development of a chimeric replicon system for phenotypic analysis of NS3 protease sequences from HCV clinical isolates Antiviral Therapy 211; 16:75 718 (doi: 1.3851/IMP1825) Original article Development of a chimeric replicon system for phenotypic analysis of NS3 protease sequences from HCV clinical isolates Amy K Sheaffer

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION ARTICLE NUMBER: 16045 Highly heterogeneous mutation rates in the hepatitis C virus genome Ron Geller, Úrsula Estada, Joan B. Peris, Iván Andreu, Juan-Vicente Bou, Raquel Garijo, José M. Cuevas, Rosario

More information

Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system

Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system Dr. Tim Welsink Molecular Biology Transient Gene Expression OUTLINE Short

More information

Table S1. Bacterial strains (Related to Results and Experimental Procedures)

Table S1. Bacterial strains (Related to Results and Experimental Procedures) Table S1. Bacterial strains (Related to Results and Experimental Procedures) Strain number Relevant genotype Source or reference 1045 AB1157 Graham Walker (Donnelly and Walker, 1989) 2458 3084 (MG1655)

More information

HCV Genotype Primer Kit

HCV Genotype Primer Kit Instruction Manual for HCV Genotype Primer Kit HCV Genotype Determination Kit for Research Purpose Thoroughly read this instruction manual before use of this kit Background Study of nucleotide sequence

More information

Disease and selection in the human genome 3

Disease and selection in the human genome 3 Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon

More information

Supplemental Materials and Methods

Supplemental Materials and Methods Supplemental Materials and Methods Antibodies: Anti-SRF (cat# Sc-335) and anti-igf1r (sc-712) (Santa Cruz Biotech), and anti- ADAM-10 (14-6211) were from e-bioscience, anti-ku70 (cat# MS-329-P) (Labvision),

More information

Supplementary Figure 1A A404 Cells +/- Retinoic Acid

Supplementary Figure 1A A404 Cells +/- Retinoic Acid Supplementary Figure 1A A44 Cells +/- Retinoic Acid 1 1 H3 Lys4 di-methylation SM-actin VEC cfos (-) RA (+) RA 14 1 1 8 6 4 H3 Lys79 di-methylation SM-actin VEC cfos (-) RA (+) RA Supplementary Figure

More information

NS5 MTases. Recombinant wild type and mutant E218A MTase domain of WNV NS5

NS5 MTases. Recombinant wild type and mutant E218A MTase domain of WNV NS5 doi:10.1038/nature09489 Supplementary Figure 1. Methylation pattern of wild type and mutant WNV NS5 MTases. Recombinant wild type and mutant E218A MTase domain of WNV NS5 (N-terminal 300 amino acids) were

More information

Multiplexing Genome-scale Engineering

Multiplexing Genome-scale Engineering Multiplexing Genome-scale Engineering Harris Wang, Ph.D. Department of Systems Biology Department of Pathology & Cell Biology http://wanglab.c2b2.columbia.edu Rise of Genomics An Expanding Toolbox Esvelt

More information

Supplementary

Supplementary Supplementary information Supplementary Material and Methods Plasmid construction The transposable element vectors for inducible expression of RFP-FUS wt and EGFP-FUS R521C and EGFP-FUS P525L were derived

More information

Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR

Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR 1 The problem We wish to clone a yet unknown gene from a known

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Fig. 1 Characterization of GSCs. a. Immunostaining of primary GSC spheres from GSC lines. Nestin (neural progenitor marker, red), TLX (green). Merged images of nestin,

More information

PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells

PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells Supplementary Information for: PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells Ju Hye Jang 1, Hyun Kim 2, Mi Jung Jang 2, Ju Hyun Cho 1,2,* 1 Research Institute

More information

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα

More information

Chronic hepatitis C virus (HCV) infection is

Chronic hepatitis C virus (HCV) infection is Impact of a Baseline Polymorphism on the Emergence of Resistance to the Hepatitis C Virus Nonstructural Protein 5A Replication Complex, BMS-790052 Jin-Hua Sun, 1 Donald R. O Boyle II, 1 Yan Zhang, 1 Chunfu

More information

used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies were

used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies were 1 Supplemental Methods Reagents and chemicals: TGFβ was a generous gift from Genzyme Inc. (Cambridge, MA) and was used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure a T m ( C) Seq. '-3' uguuugugguaacagugugaggu L 62 AttGtcAcaCtcC L2 6 ccattgtcacactcc L3 66 attgtcacactcc 7 ccattgtcacactcca L 73 ccattgtcacactcc L6 74 AttGTcaCaCtCC L7 7 attgtcacactcc

More information

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction

More information

Expression of Recombinant Proteins

Expression of Recombinant Proteins Expression of Recombinant Proteins Uses of Cloned Genes sequencing reagents (eg, probes) protein production insufficient natural quantities modify/mutagenesis library screening Expression Vector Features

More information

Samatasvir (IDX719), a Potent Pan-Genotypic NS5A Inhibitor, for the Treatment of Hepatitis C Virus (HCV) Infection

Samatasvir (IDX719), a Potent Pan-Genotypic NS5A Inhibitor, for the Treatment of Hepatitis C Virus (HCV) Infection Samatasvir (IDX719), a Potent Pan-Genotypic NS5A Inhibitor, for the Treatment of Hepatitis C Virus (HCV) Infection Douglas Mayers, MD December 11, 2013 1 Idenix: Advancing All-Oral, Pan-Genotypic Combination

More information

RPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification.

RPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification. RPA-AB RPA-C (a) (b) (c) (d) (e) (f) Supplemental Figure S: SDS-PAGE stained with Coomassie Blue after protein purification. (a) RPA; (b) RPA-AB; (c) RPA-CDE; (d) RPA-CDE core; (e) RPA-DE; and (f) RPA-C

More information

ΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3

ΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3 Supplemental Fig. S1 ΔPDD1 x wild type ΔPDD1 x ΔPDD1 70 kd Pdd1 50 kd 37 kd Pdd3 Supplemental Fig. S1. ΔPDD1 strains express no detectable Pdd1 protein. Western blot analysis of whole-protein extracts

More information

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53 Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -

More information

Legends for supplementary figures 1-3

Legends for supplementary figures 1-3 High throughput resistance profiling of Plasmodium falciparum infections based on custom dual indexing and Illumina next generation sequencing-technology Sidsel Nag 1,2 *, Marlene D. Dalgaard 3, Poul-Erik

More information

Mitochondrial Biogenesis Assay after 5-day Treatment in PC-3 Cells Yili Xu and Joy Y. Feng *

Mitochondrial Biogenesis Assay after 5-day Treatment in PC-3 Cells Yili Xu and Joy Y. Feng * Mitochondrial Biogenesis Assay after 5-day Treatment in PC-3 Cells Yili Xu and Joy Y. Feng * Department of Biology, Gilead Sciences, Foster City, USA *For correspondence: Joy.Feng@gilead.com [Abstract]

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed

More information

SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer

SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves

More information

ORFs and genes. Please sit in row K or forward

ORFs and genes. Please sit in row K or forward ORFs and genes Please sit in row K or forward https://www.flickr.com/photos/teseum/3231682806/in/photostream/ Question: why do some strains of Vibrio cause cholera and others don t? Methods Mechanisms

More information

RNA purification, reverse transcription and qpcr: Intracellular RNA was

RNA purification, reverse transcription and qpcr: Intracellular RNA was Supplementary methods RNA purification, reverse transcription and qpcr: Intracellular RNA was extracted using Extract-All (Eurobio), extracellular RNA was extracted from 150 µl of supernatant using NucleoSpin

More information

Viral and Cellular Determinants of Hepatitis C Virus RNA Replication in Cell Culture

Viral and Cellular Determinants of Hepatitis C Virus RNA Replication in Cell Culture Viral and Cellular Determinants of Hepatitis C Virus RNA Replication in Cell Culture Volker Lohmann, Sandra Hoffmann, Ulrike Herian, Francois Penin and Ralf Bartenschlager J. Virol. 2003, 77(5):3007. DOI:

More information

Lecture 22: Molecular techniques DNA cloning and DNA libraries

Lecture 22: Molecular techniques DNA cloning and DNA libraries Lecture 22: Molecular techniques DNA cloning and DNA libraries DNA cloning: general strategy -> to prepare large quantities of identical DNA Vector + DNA fragment Recombinant DNA (any piece of DNA derived

More information

Supplementary Information. Construction of Lasso Peptide Fusion Proteins

Supplementary Information. Construction of Lasso Peptide Fusion Proteins Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and

More information

DAA Drug Classes. HCV Retreatment of DAA Failures. In general:

DAA Drug Classes. HCV Retreatment of DAA Failures. In general: HCV Retreatment of DAA Failures JORGE L. HERRERA M.D., MACG UNIVERSITY OF SOUTH ALABAMA COLLEGE OF MEDICINE, MOBILE, AL DAA Drug Classes NS3/4 (protease) inhibitors Telaprevir, boceprevir, simeprevir,

More information

Dierks Supplementary Fig. S1

Dierks Supplementary Fig. S1 Dierks Supplementary Fig. S1 ITK SYK PH TH K42R wt K42R (kinase deficient) R29C E42K Y323F R29C E42K Y323F (reduced phospholipid binding) (enhanced phospholipid binding) (reduced Cbl binding) E42K Y323F

More information

Occurrence of viruses in apple and pear orchards in Latvia.

Occurrence of viruses in apple and pear orchards in Latvia. INTERNATIONAL SCIENTIFIC CONFERENCE Sustainable Fruit Growing: From Plant to Product Occurrence of viruses in apple and pear orchards in Latvia. Neda P pola, Anna K le, Inga Moro ko Bi evska. The economically

More information

Protocol for amplification of measles sequencing window (N-450)

Protocol for amplification of measles sequencing window (N-450) Annex 7.1 Protocol for amplification of measles sequencing window (N-450) NOTE: This document is intended to provide basic test method details and is not an SOP. Laboratories need to develop their own

More information

Engineering D66N mutant using quick change site directed mutagenesis. Harkewal Singh 09/01/2010

Engineering D66N mutant using quick change site directed mutagenesis. Harkewal Singh 09/01/2010 Engineering D66N mutant using quick change site directed mutagenesis Harkewal Singh 09/01/2010 1 1- What is quick change site directed mutagenesis? 2- An overview of the kit contents. 3- A brief information

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 6 Relative levels of ma3 RNA 5 4 3 2 1 LN MG SG PG Spl Thy ma3 ß actin Lymph node Mammary gland Prostate gland Salivary gland Spleen Thymus MMTV target tissues Fig. S1: MMTV target tissues express ma3.

More information

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm

More information

New DAAs - PIs, NS5a Inhibitors, Pol.-Inhibitors (Nucs and Non-Nucs): Promises and Problems

New DAAs - PIs, NS5a Inhibitors, Pol.-Inhibitors (Nucs and Non-Nucs): Promises and Problems New DAAs - PIs, NS5a Inhibitors, Pol.-Inhibitors (Nucs and Non-Nucs): Promises and Problems Heiner Wedemeyer Hannover Medical School Germany 1 Disclosures Honoraria for consulting or speaking (last 5 years):

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

No. Sponsor Protocol # Protocol Title: Status

No. Sponsor Protocol # Protocol Title: Status Research Specialists of Texas List of Ongoing Studies No. Sponsor Protocol # Protocol Title: Status 1 Abbott M12-114 2 Hoffman-La Roche, Inc. 598-505 3 Bristol Myers S AI444-038 4 Bristol Myers S AI444-052

More information

Human Cell-Free Protein Expression System

Human Cell-Free Protein Expression System Cat. # 3281 For Research Use Human Cell-Free Protein Expression System Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 4 IV. Storage...

More information

An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues

An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues Yoshikazu Nishiguchi 1*, Koichi Kitamura 1, Naoko Watanabe 2, Anna Kozaki 3, Hayato Otani

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Ca 2+ /calmodulin Regulates Salicylic Acid-mediated Plant Immunity Liqun Du, Gul S. Ali, Kayla A. Simons, Jingguo Hou, Tianbao Yang, A.S.N. Reddy and B. W. Poovaiah * *To whom correspondence should be

More information

The poly(a) tail blocks RDR6 from converting self mrnas into substrates for gene silencing

The poly(a) tail blocks RDR6 from converting self mrnas into substrates for gene silencing In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION VOLUME: 3 ARTICLE NUMBER: 17036 The poly(a) tail blocks RDR6 from converting self mrnas into substrates for gene silencing

More information

7.012 Problem Set 5. Question 1

7.012 Problem Set 5. Question 1 Name Section 7.012 Problem Set 5 Question 1 While studying the problem of infertility, you attempt to isolate a hypothetical rabbit gene that accounts for the prolific reproduction of rabbits. After much

More information

Experimental genetics - I

Experimental genetics - I Experimental genetics - I Examples of diseases with genetic-links Hemophilia (complete loss or altered form of factor VIII): bleeding disorder Duchenne muscular dystrophy (altered form of dystrophin) muscle

More information

2

2 1 2 3 4 5 6 7 Supplemental Table 1. Magnaporthe oryzae strains generated in this study. Strain background Genotype Strain name Description Guy-11 H1:RFP H1:RFP Strain expressing Histone H1- encoding gene

More information

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics

More information

Directed Evolution Methods for Protein Engineering

Directed Evolution Methods for Protein Engineering Directed Evolution Methods for Protein Engineering XXX Biosciences, Life Sciences Solutions, Geneart AG, Regensburg, Germany The world leader in serving science 1 Directed Evolution 2 Random mutagenesis

More information

Blimp-1/PRDM1 rabbit monoclonal antibody (C14A4) was purchased from Cell Signaling

Blimp-1/PRDM1 rabbit monoclonal antibody (C14A4) was purchased from Cell Signaling 1 2 3 4 5 6 7 8 9 10 11 Supplementary Methods Antibodies Blimp-1/PRDM1 rabbit monoclonal antibody (C14A4) was purchased from Cell Signaling (Danvers, MA) and used at 1:1000 to detect the total PRDM1 protein

More information

Supplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination

Supplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination Supplemental Information Molecular Cell, Volume 42 Human Senataxin Resolves RNA/DNA Hybrids Formed at Transcriptional Pause Sites to Promote Xrn2-Dependent Termination Konstantina Skourti-Stathaki, Nicholas

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.

More information

Structure-based discovery and development of natural products as Type II JAK2 inhibitors for the treatment of hepatitis C

Structure-based discovery and development of natural products as Type II JAK2 inhibitors for the treatment of hepatitis C RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Structure-based discovery and development of natural products as Type II JAK2 inhibitors for the treatment of hepatitis C EDL Ma *, CH Leung, P Chiu,

More information