SUPPLEMENTARY INFORMATION

Transcription

1 Ca 2+ /calmodulin Regulates Salicylic Acid-mediated Plant Immunity Liqun Du, Gul S. Ali, Kayla A. Simons, Jingguo Hou, Tianbao Yang, A.S.N. Reddy and B. W. Poovaiah * *To whom correspondence should be addressed. Poovaiah@wsu.edu Supplementary table 1: list of primers for characterizing Arabidopsis mutants Gene mutant line L primer R primer Salk_ GAACTACTGAACATTTTCTAGAAGTTACTCAC TGTTTGGGCAAACAGAAGTTC AtSR1 Salk_ TTCAGCCCAGTTCATGAATTAG CCATCCATGTCCCTCCTAGA PAD4 Salk_ TCATTCCGCGTCTTTTGTATC CAAAGATCTCCTCTGGGGATC EDS5 Salk_ ATGGGAACTCACGTTTTAGCC TCTCCACCGTGTATGGACTC ICS1 Salk_ ACTTATTTTCTGGCCCACAAAAC CACTTTACGAATTTCTGCAATGG 1

2 Supplementary Figure 1 Supplemental Figure 1. Schematic illustration of AtSR1/CaMTA3 and its complementation constructs. A. Endogenous AtSR1, T-DNA insert in Salk_001152(atsr1-1) and Salk_ (atsr1-2) lines, primers used for checking T-DNA insert, knockout status, and RT-PCR are indicated, AtSR1-L: GAACTACTGAACATTTTCTAGAAGTTACTCAC, AtSR1-R: TGTTTGGGCAAACAGAAGTTC, LBa1 sequence was previously described 1, P1: CCATCCATGTCCCTCCTAGA, P2: TCCATTGATTCCCAAACCTG, P3: TTCAGCCCAGTTCATGAATTAG. B. Complementation constructs of AtSR1/CaMTA3 and its mutants. The CaMBD is enlarged, nucleotide and amino acid sequences of wild-type CaMBD are in blue, the mutated positions are in red and underlined, deleted parts are joined with a bent line. The first mutation I909V (M1) does not disrupt the conserved secondary structure of the AtSR1 CaMBD. The second mutation K907E (M2) drastically alters the surface static charge of its CaM-binding helix. The third mutation (M3) Δ is a deletion of the whole CaMBD from aa 900 to 922 of AtSR

3 Supplemental Figure 2 A B 7 weeks PCR1 PCR2 AtSR1 probed rrna WT atsr1-1 WT atsr1-1 C D E P1+P2 P1+P3 CYC WT atsr1-2 WT atsr1-2 Supplemental Figure 2. Phenotypic and genotypic comparison of wild-type and atsr1 mutants. A. Molecular characterization demonstrating the genotype of WT and atsr1-1. PCR1: DNA amplified with AtSR1 specific primer AtSR1-R and T-DNA specific primer Lba1; PCR2: DNA amplified with AtSR1 specific primer AtSR1-L and AtSR1-R (see Fig. S1a for primer sequences). AtSR1 probed: Northern blot shows the expression of AtSR1 gene in both WT and atsr1-1 knockout mutant, EtBR stained rrna was used as loading control (rrna). B. Phenotypic comparison. 7-week-old WT and atsr1-1 mutant plants grown at C with 12 hr photoperiod C and D. Phenotypic comparison. Five-week-old WT (C) and atsr1-2 mutant (D) plants grown at C with a 12-hr photoperiod. E. Genotype of atsr1-2 was confirmed by RT PCR with AtSR1-specific primers (see Table 1). AtSR1 transcript was shown to be absent in the atsr1-2 mutant by RT-PCR using two pairs of primers: one on either side of the insertion and one downstream of the insertion (Fig. S1a). Expression of cyclophilin (At4g38740) was used as loading control. 3

4 Supplemental Figure 3 Supplemental Figure 3: A. Staining of similar age leaves from uninfected WT, atsr1-1 and WT inoculated with a 10 5 CFU ml -1 suspension of Pseudomonas syringae pv tomato carrying AvrRpt2 with 3,3`-diaaminobenzidine (DAB) reveals accumulation of H 2 O 2 in atsr1 and WT inoculated with Pst AvrRpt2. B. Quantification of DAB stains per 2.5 mm 2. Each bar is the average of at least four leaves. Error bars represent SD. 4

5 Supplemental Figure 4 * Supplemental Figure 4. Functional complementation and overexpression of AtSR1. All the plants used in these experiments were grown at C with 12 hr photoperiod. A. 5-week-old plants of wild-type (WT), atsr1-1 mutant (atsr1-1), atsr1-1 complemented with wild-type AtSR1 gene (cw), and two overexpression (OE) lines of AtSR1 gene with different transgene expression levels (OE1 and OE2). B. Molecular characterization demonstrating the genotype of the plant lines listed in A. PCR1, PCR2: see legend of Fig. S2A. atsr1-1 is marked as atsr1 in all panels hereafter. α-flag: 20 µg of total protein from each sample was used in the Western blot detected with anti-flag M2 monoclonal antibody (Sigma). C. PR1 expression in plant lines as listed in A. D. Growth comparison in terms of fresh weight measured at five weeks, compared plant lines are the same as listed in A. E. Disease Resistance Test. Pst. DC3000 ( OD600) was infiltrated into the rosette leaves, and the cfu was measured 3 days after infiltration. Data are expressed as mean ± s.d (n=4, *p<0.045 by T-test). 5

6 Supplemental Figure 5 Pathogen Induced Free SA ng/g fresh tissue WT atsr hpi(hours past inoculation) Supplemental Figure 5. Pathogen induced SA accumulation in WT and atsr1-1(atsr1) grown at C. Leaves of 5-week-old plants grown at C with 12 hr photoperiod were infiltrated with Pst. DC3000 at OD 600 = Infected leaves were collected at the indicated times after inoculation and used for free SA quantitation. Each result is expressed as mean ± s.d.(n=4) 6

7 Supplemental Figure 6 Supplemental Figure 6. Epistasis analysis of AtSR1 and key SA signaling components. A. Expression of key SA signaling and synthetic genes in wild-type (WT) and atsr1-1 (atsr1, hereafter). Identical blots were hybridized to PAD4, EDS1, EDS5 and ICS1 probes, EB stained rrna was used as loading control (rrna). B. Northern blots showing lossof-function mutation in pad4 and ics1 knockout backgrounds. RNA samples were prepared from 5-week-old plants. Genotypes are marked beneath and probes to the right of the panel. EB stained rrna was used as loading control (rrna). C. Impact of SA signaling and synthesis mutants on disease resistance of atsr1. Pst. DC3000 (OD ) was infiltrated into the leaves of 5-week-old plants grown at C, and the cfu was measured 3 days after infiltration. The results of 4 replicates were averaged. Genotypes are marked beneath the panel. D. PR1 expression in compared plants. RNA samples were prepared from 5-week-old plants grown at C, and the RNA blot was hybridized to PR1 probe. EB stained rrna was used as loading control (rrna). Genotypes are marked beneath the panel. E. Comparison of plant growth. 5-week-old plants grown at C. Genotypes are marked beneath the panel. 7

8 Supplemental Figure 7 B AtSR6 + EDS1P AtSR6 +eds1p EDS1P ABF1 + EDS1P ABF1 +eds1p Supplemental Figure 7. Schematic illustration of EDS1 structure and interaction of transcription factors with EDS1 promoter A. EDS1 promoter structure. Position of starter codon ATG and position of CGCG box is illustrated. B. Example of Possible TFs Binding ACGCGT box. There are other TFs in the Arabidopsis genome which might bind to ACGCGT motif in EDS1 promoter. Possible candidates include other AtSR homologs, ABFs (ABRE binding factor) which recognize ACGCGT-like motif 2. AtSR6 and ABF1 was selected for testing. EDS1 promoter fragment (EDS1P, GTAAAAGTCGAATGTGACGCGTCTTGCCGAAC) or a mutated version with its ACGCGT changed to ACCCGT (eds1p) was labeled as probe, recombinant AtSR6 contains a CG-1 DNA-binding domain, ABF1 (ABRE binding factor 1) is a full-length recombinant protein. C. Regulatory model of EDS1 promoter. Negative regulator (- ), AtSR1, competes for the CGCG box with unidentified TF(s), a positive regulator (+), required for the normal function of EDS1 promoter. In WT, because of the balanced action of AtSR1 and the unknown TF, EDS1 is slightly expressed (upper panel). In the absence of AtSR1, the repression of AtSR1 is removed, and EDS1 expression is activated (middle panel). When the CGCG box was mutated, the promoter lost its response to positive, as well as negative regulation because the critical unknown TF could no longer bind to EDS1 promoter (lower panel). 8

9 Supplemental Figure 8 A B C PAD4 EDS1 EDS5 ICS1 PR1 rrna WT atsr1-1 M326-a M326-b M326-c M327 Supplemental Figure 8. Independent T1 plants carrying EDS1 promoter in atsr1-1 background. A. 6-week-old atsr1-1 plants carrying EDS1P::Luc construct(pdl326). B. 6-weekold atsr1-1 plants carrying eds1p::luc construct (pdl327). C. Northern analysis of independent rescued M326 lines probed with PAD4, EDS1 EDS5, ICS1 or PR1. EtBR stained rrna was used as a control. References 1. Alonso, J.M. et al. Genome-Wide Insertional Mutagenesis of Arabidopsis thaliana. Science 301, (2003). 2. Choi, H.-i., Hong, J.-h., Ha, J.-o., Kang, J.-y. & Kim, S.Y. ABFs, a Family of ABAresponsive Element Binding Factors. Journal of Biological Chemistry 275, (2000). 9