RNA metabolism. DNA dependent synthesis of RNA RNA processing RNA dependent synthesis of RNA and DNA.

Transcription

1 RNA metabolism DNA dependent synthesis of RNA RNA processing RNA dependent synthesis of RNA and DNA

2 DNA dependent synthesis of RNA : production of an RNA molecule transcribes from a DNA template, so that process called Transcription RNA polymerase (DNA-dependent RNA polymerase) RNA polymerase requires DNA template, all four ribonucleotide 5 -triphophate as precursor of nucleotide units of RNA, and Mg 2+ but not require a primer to initiate synthesis. (NMP)n + NTP RNA RNA polymerase (NMP) n+1 + PPi Lengthened RNA RNA polymerase in E. coli is a large, complex enzyme with five core subunits ( 2 ) and a sixth subunit, sigma subunit, ( ) which bind directly to specific binding site on DNA. These six subunits called RNA polymerase holoenzyme

3 Which strand of DNA act as a template for transcription? Template strand 3 ---> 5 = antisense strand = Non-coding stand Non template strand = sense strand = Coding strand

4 Transcription in E.coli Initiation step Elongation step Termination step 5 3 Coding strand Template strand TGTTGACA -35 region Promoter TATAAT -10 region Transcription start site 3 RNA +1 5 RNA synthesis begins at Promoter Promoter locate between -70 and +30 which contain two short consensus sequences centered about positions -10 (TATAAT : Pribnow box) -35 (TTGACA) from transcriptional start site. Promoter is important interaction site for 70 subunit of RNA polymerase holoenzyme. The sigma subunit conveys promoter specificity to RNA polymerase; that is, it is responsible for telling RNA polymerase where to bind Variation in the consensus sequence affect the efficiency of RNA polymerase binding and transcription initiation

5 Initiation step 5 3 Coding strand Template strand 5 3 Rifampicin bind to sigma factor Elongation step actinomycin D intercalate in between G C pairing 5 3

6 Termination step Rho ( ) dependent Rho protein consists of 6 unit or hexamer. It will bind to growing RNA from 5 end and moving itself to termination site on 3 end. Once RNA polymerase reach to termination site. It can not go on and them stop the process of transcription because Rho protein are ATP-dependemt RNA-DNA helicases which catalyze by separation between RNA and DNA complex

7 Termination step Rho ( ) independent At 3 end of growing RNA contains sequence with high G and C (G-C rich region) about nuclotides G-C rich region can form loop called Hairpin structure Following G-C rich region have also special sequence which contain repeating of Uracil Once RNA polymerase reach to Hairpin structure and poly U. It can not go on and them stop the process of transcription. It lead to break the complex of RNA polymerase and newly RNA-DNA.

8 RNA polymerase Transcription in Eukaryote RNA polymerase I (Pol I) > pre ribosomal RNA (rrna) RNA polymerase II (Pol II) > mesenger RNA (mrna) and microrna (mirna) RNA polymerase III (Pol III) > transfer RNA (trna) and 5s rrna mrna Transcription Initiation step Elongation step Termination step Transcription start site 5 3 Enhancer sequnece -5,000 Upstream promoter Core promoter TATAAAA (TATA box) -30 region Coding strand Inr Template strand +1 RNA 3 5 In eukaryotes, the "core" promoter for a gene transcribed by RNA pol II is most often found immediately upstream (5 ) of the start site of the gene which have a TATA box (consensus sequence TATTAA) 25 to 35 bases upstream of the initiation site Eukaryotic RNA polymerases use a number of essential cofactors (collectively called general transcription factors), and one of these, TATA binding protein (TBP), recognizes the TATA box and ensures that the correct start site is used.

9 mrna Transcription Initiation step Enhancer sequences control gene activation by binding with activator proteins and altering the 3-D structure of the DNA to help "attract" RNA pol II, thus regulating transcription Because eukaryotic DNA is tightly packaged as chromatin, transcription also requires a number of specialized proteins that help make the coding strand accessible.

10 A COMPREHENSIVE MODEL OF REGULATION OF RNA POLYMERASE II TRANSCRIPTION: Although they are cis-acting, the enhancers and silencers can be strung out across kilobases (thousands of base pairs) of DNA upstream. Some signals can even be downstream of the coding gene, or even found within introns (!) How can this be possible? Long regions of the DNA can loop over to enable the regulatory connections.

11 Post transcriptional RNA processing of mrna RNA processing (primary transcript ----> Mature RNA) Adding 5 Cap (Methylgaunine) Adding 3 poly (A) tail ( bp) RNA splicing Posttranscriptional modifications apparently protect eukaryotic mrna molecules from degradation and to give them longer lifetimes than bacterial mrna In prokaryote, trna has gone through on this processes.

12 5 Cap (7-methyguanosine) GTP is added in at 5 end of primary transcript with 5-5 triphosphate linkage at early transcription RNA GTP is subsequently methylated at N7 position of purine ring of guanine to form 7-methylguanosine 5 5 triphosphate linkage RNA 5 Cap help to protect mrna from ribonuclease and also help binds to specific cap binding complex for promoting binding between mrna and ribosome in initiation step of translation

13 3 Poly (A) tail Poly A tail is added by multistep process On primary transcript contain cleavage site which is 5 AAUAAA3, nucleotide on the 5 side Cleavage generate 3 hydroxy group by endonuclease. It produce end of mrna which A residues are immediately added by Polyadenylate polymerase 3 poly A tail help to protect mrna from enzymatic s destruction

14 RNA splicing Both Intron (Non coding sequence) and Exon (coding sequence) are transcribed from DNA into RNA

15 Types of Intron Group I introns are found in some nuclear rrnas, mrna and trna. Group II intron are generally found in the primary transcripts of mitochondria or chloroplast mrna. Group I and II are self-splicing meaning no protein enzyme to catalyze in splicing processes. Group I introns Group II introns

16 Transesterification reaction RNA catalyzes the splicing intron. 3 OH of Guanosine molecule acts as nucleophile which subsequently break phosphodiester bond 16

17 Group III or Spliceosomal introns found in nuclear mrna primary transcript in Eukaryote AG GU YNYYRAY AG G RNA sequence begins with the dinucleotide GU at its 5 end, and another ends with AG at its 3 end. These consensus sequences are known to be critical, because changing one of the conserved nucleotides results in inhibition of splicing. Spliceosomal intron also contain important sequence which is Branch point sequence located anywhere from 18 to 40 nucleotides upstream from the 3 end of an intron. The branch point always contains an adenine, but it is otherwise loosely conserved. A typical sequence is YNYYRAY, where Y indicates a pyrimidine, N denotes any nucleotide, R denotes any purine

18 Spliceosome Splicing occurs in several steps and is catalyzed by Spliceosome which contain small nuclear ribonucleoproteins (snrnps, commonly pronounced "snurps") snrnp U1, U2, U4, U5. U6 BBP = Branch point binding protein U2AF = Helper protein Each snrnps contain eukaryotic RNA (small nuclear RNA: snrna) and protein. The snrna have a sequence which is complementary to cleavage site of intron

19 pre-mrna is cleaved at the 5 end of the intron - attachment of a snrnp called U1 to its complementary sequence within the intron at 5 end. BBP and U2AF attached to A residue of branch point Inactive splicesome (U1-6) - snrnps U2 appear and replace itself on A residue instead of BBP and U2AF - Remaining snrnps U4 and U6 form a U4/U6 complex and U5 bind to form inactive spliceosome and then form a loop structure known as a lariant Transesterification # 1 (A GU of intron) Transesterification # 2 (3 OH of Exon splice site) - Internal rearrangement convert this inactive to active spliceosome by pairing U6 with U5 and U2. - The bonding of the guanine and adenine bases takes place via a chemical reaction known as transesterification, in which a hydroxyl (OH) group on a carbon atom of the adenine "attacks" the bond of the guanine nucleotide at the splice site. The guanine residue is thus cleaved from the RNA strand and forms a new bond with the adenine. - OH group at the 3 end of the exon attacks the phosphodiester bond at the 3 splice site (AG) by Transesterification.

20 Alternative RNA splicing A gene can give rise to multiple products by differential RNA processing Most eukaryotic mrna transcript produce only mature RNA and one corresponding polypeptide????? Complex transcript can have either more than one site for cleavage and polyadenylation Poly A site

21 Alternative processing of the calcitonin gene into Calcitonin protein at Thyroid and Calcitoningene-related peptide (CGRP) at Brain

22 Ribosomal RNA and trna also undergo Processing Post transcriptional processing is not limited to mrna. Ribosomal RNA (rrna) of both prokaryotic and eukaryotic cells are made from longer precursors called Preribosomal RNAs (pre-rrna) Prokaryote Eukaryote

23 Processing of trna Exonuclease Rnase D Endonuclease Rnase P mg = methylgaunosine D = Dihydrouridine I = Inosine T =Ribothymidine A = Isopenenyladenosine = Pseudouridine

24 RNA Editing Occasionally researches encounter a gene with a sequence of nucleotides that does not match exactly that in its RNA product RNA editing occurs by two distinct mechanisms: 1. Substitution Editing: chemical alteration of individual nucleotides These alterations are catalyzed by enzymes that recognize a specific target sequence of nucleotides Cytidine deaminases (Cytosine to uracil) Adenosine deaminases (Adenine to Inosine), which the ribosome translates as a G. CAG codon (for Gln) can be converted to a (CIG) CGG codon (for Arg)

25 RNA Editing 2. Insertion/Deletion Editing: insertion or deletion of nucleotides in the RNA. These alterations are mediated by guide RNA molecules that base-pair as best they can with the RNA to be edited and serve as a template for the addition (or removal) of nucleotides in the target

26 Cellular mrna are degraded at different rate mrna Degradation pathway ensure that mrna do not build up in the cell and direct the synthesis of unnecessary protein Average half life of mrna in Prokaryotic cells 1.5 min and Eukaryotic cell about 3 hrs Shortening the poly A tail Decapping the 5 end Degrading the RNA strand Mechanisms of deadenylation dependent decay

27 Reverse Transcriptase (RNA-directed DNA polymerase) from Retrovirus which have RNA as genetic material RNA replicase (RNA-directed RNA polymerase) from Bacteriophage which is a virus infecting bacterial. This virus contain RNA as genetic material

28 Reverse Transcription in Retrovirus 28

29 Human Immunodeficiency Virus (HIV) ----> AIDS Zidovudine (ZDV), formerly called Azidothymidine (AZT) 29

30 Reverse Transcription in Eukaryote Telomerase is a specialized reverse transcriptase in Eukaryotic cell Telomere is the structure at the end of linear eukaryotic chromosome. It contain tandem copies of short oligonucleotide sequence T X G Y TG strand is longer than its complement. 5 GACGCATCGATTTTGGGGGTTGGGTTGGGTTGGGTT 3 3 CTGCGTAGCTAAAACC 5 Telomeres are not readily replicate by DNA polymerase Chromosome end would be short end in every time of cell division 30

31 Reverse Transcription in Eukaryote Telomerase solve the problem by adding telomere to chromosome end (3 end) Telomerase contain RNA and protein components RNA component is about 150 nts and contain about 1.5 copies of C X A Y telomere repeat (CCCAA) using as a template for synthesis of TG strand 31