Biochemistry 302. Exam 2. March 10, Answer Key
|
|
- Chad Phillips
- 6 years ago
- Views:
Transcription
1 1 Biochemistry 302 Exam 2 March 10, 2004 Answer Key
2 2 Biochemistry 302, Spring 2004 Exam 2 (100 points) Name I. Short answer 1. Identify the 5 end, 3 end, amino acid acceptor nucleoside, and bases comprising the anticodon loop on this cloverleaf model of trna (4 points). 2. Write the general chemical equations that describe the sequential two-step reaction catalyzed by aminoacyl trna synthetases (2 points). Amino acid + ATP Aminoacyl-adenylate (AMP) + PPi Aminoacyl-adenylate + trna Aminoacyl-tRNA + AMP 3. In which ribosomal subunit(s) does the acceptor stem and the anticodon loop of a charged trna reside (2 points)? Acceptor stem large subunit Anticodon loop small subunit 4. Where exactly does the amino acid get attached on the trna acceptor nucleoside (i.e. base or ribose)? Be specific and name the substituent group (2 points). 3 hydroxyl of adenosine acceptor 5. What types of intramolecular interactions stabilize the tertiary structure of trna (2 points)? triple-base (H-bonding), base-stacking (van der Waals), and base-phosphate backbone interactions
3 3 6. This modified amino acid plays a special role in information metabolism in prokaryotes. Name the amino acid and describe its unique functional role (4 points). N-formylmethionine (fmet), initiation of protein synthesis (fmet-trna is the first charged trna to associate with mrna template and 30S subunit) 7. i) Explain the chemical role of the N3 group of adenine in this reaction scheme. ii) Name the macromolecular complex capable of catalyzing the reaction as described. iii) Describe what the products of this reaction are. (6 points) i) general base: as an imino tautomer, N3 attracts a proton from α-amino group facilitating nucleophilic attack of this amino group on the carbonyl carbon ii) large ribosomal subunit iii) de-acylated trna (trna-oh) and a peptidyl-trna with one additional amino acid 8. Name the enzyme that catalyzes the polynucleotide synthesis reaction as indicated (2 points). Reverse transcriptase
4 4 II. Multiple choice. Write the letter of the best answer on the line provided (3 points each). 1. _A_ The sequence, AAUAAA, in the 3 -UTR of a eukaryotic mrna sequence is a signal for: A. Cleavage and polyadenylation of the 3 end B. Translational initiation C. Transcriptional attenuation D. None of the above 2. _D_ Which of the following enzymes are involved in post-transcriptional modifications (i.e. capping reactions) on the 5 end of eukaryotic mrnas? A. Guanylyl transferase B. Guanine-7-methyl transferase C. 2 -O-methyl transferase D. All of the above 3. _B_ Processing of ribosomal RNA and transfer RNA in prokaryotes is carried out by: A. Proteases B. Ribonucleases C. Group II introns D. Spliceosome 4. _A_ This modified base is found at the 5 -position in the anticodon of trna Arg, forms wobble base pairs, and is generated by the action of adenosine deaminase: A. Inosine B. Methylcytosine C. Ribothymidine D. Pseudouracil 5. _A_ The DNA recognition helices of helix-turn-helix proteins such as λ repressor and zincfinger proteins such as Zif268 are related because: A. They form chemical contacts in the major groove of B-DNA B. They form chemical contacts in the minor groove of A-DNA C. They preferentially interact with Z-DNA forming sequences 6. _C_ In the absence of a mrna template, dissociation of ribosomal subunits is facilitated by: A. Specific translation initiation factors B. Intracellular ionic strength conditions C. Both A and B D. Neither A or B
5 5 7. _A_ The Sanger method of DNA sequencing relies on chain termination chemistry mediated by which of the following DNA synthesis inhibitors: A. 2, 3 -dideoxy NTPs B. EDTA C. 3 -O-methylated NTPs 8. _C_ The antibiotics, puromycin and streptomycin, are inhibitors of: A. DNA synthesis B. RNA synthesis C. Protein synthesis D. Both A and B 9._B_ Binding of an inducer such as lactose or IPTG to the lac repressor protein promotes a conformational change in the protein that: A. Enhances DNA-binding affinity of lac repressor for operator sequences B. Reduces DNA-binding affinity of lac repressor for operator sequences C. Stimulates proteolytic degradation of lac repressor 10._D_ Attenuation (i.e. premature transcriptional termination) of the E. coli biosynthetic trp operon occurs by a mechanism that is dependent upon: A. Ability of the 5 -leader sequence to adopt a specific stem-loop structure that promotes factor-independent transcriptional termination B. Ribosome positioning along the 5 leader sequence C. Relative intracellular concentration of tryptophan D. All of the above 11._A_ Synergistic activation of gene expression in higher eukaryotes is generally mediated by: A. Multiple trans-acting factors with distinct cis-element binding specificities functioning in a cooperative manner to recruit RNA polymerase II, associated general transcription factors, and/or chromatin remodeling complexes to a gene promoter B. Single gene-specific trans-acting factor functioning in an autonomous manner to recruit RNA polymerase II, associated general transcription factors, and/or chromatin remodeling complexes to a gene promoter C. Targeted recruitment of the ribosome to a specific mrna template 12._D_ The composition of the eukaryotic ribosome differs from the prokaryotic ribosome because the eukaryotic ribosome has: A. An additional 5.8 S rrna component in the large subunit B. More proteins in the small subunit C. More proteins in the large subunit D. All of the above
6 6 III. True/False. Write T or F on the line provided. For statements that are deemed false, provide a brief justification for your answer. (2 points each) 1. Excision of introns from nuclear pre-mrnas can occur in the absence of protein and is completely RNA-dependent. _F_ need snrnps 2. Group I introns require a guanosine cofactor to initiate self-splicing. _T_ 3. Stem-loop helices in trna molecules exist primarily in a B-form configuration. _F_ RNA duplexes are usually A-form. 4. The restriction enzyme, Dpn I, is often used in mutagenesis applications because of its ability to digest methylated DNA templates. _T_ 5. Guanine nucleotide exchange factors such as EF-Ts (prokaryotic) and eif2b (eukaryotic) initiate exchange by virtue of their intrinsic GTPase activity. _F_ Protein-protein interaction-mediated conformational changes promote exchange. 6. Messenger RNA synthesis and processing reactions occur as independent molecular events in the nucleus of eukaryotes. _F_ Biochemical evidence suggests that factors involved in splicing and polyadenylation can associate with RNA polymerase. 7. Despite differences in primary nucleotide sequence, the stem-loop or secondary structure of 16S rrna is highly conserved across all kingdoms of life. _T_ 8. RNA strand cleavage by the hammerhead ribozyme involves formation of an intramolecular 2-3 phosphodiester linkage. _T_ IV. Answers requiring a carefully worded sentence or two (6 points each). 1. Describe the molecular basis of ATP selection by poly(a) polymerase. In other words, why does the enzyme recognize ATP but not other NTPs? The organization of the active site of PAP is such that only ATP can fit properly. The monocyclic pyrimidine ring present in CTP and UTP is two small to H-bond with certain amino acid side chains (Asp) while the bicyclic purine ring of GTP possesses substituent groups (attached to C6 and C2) which preclude formation of stabilizing van der Waals, H-bond, and metal ion-facilitated contacts that can take place with active site-bound ATP.
7 7 2. Explain the chemical role of the branch point adenosine in nuclear pre-mrna splicing. The branch point adenosine (BPA) initiates the first of two trans-esterification reactions required for intron removal. The 2 hydroxyl (OH) of the BPA attacks a phosphate at the 5 intron/exon boundary (i.e. 5 splice site) resulting in formation of 1) a partially excised loop-containing intron stabilized by a 2-5 phosphodiester bond and 2) a 5 exon with a free 3 OH to initiate the second transesterification reaction on the 3 splice site. 3. Describe the location, sequence characteristics, and function of Shine-Dalgarno elements in prokaryotic mrnas. Shine-Dalgarno elements are short purine-rich sequences that are located upstream (5 ) and relative close to the AUG start codon in a prokaryotic mrna template. These elements assist in alignment of the small ribosomal subunit by virtue of base pairing with the 3 end of 16S rrna. (They also serve as recognition elements for the fmettrna/if2 initiator complex.) 4. How can chromatin (nucleosome) remodeling contribute to either activation or repression of gene expression? Swi/Snf ATPase complexes and histone acetyltransferases promote disassembly, sliding, and/or removal of histones from the DNA, which can expose cis-regulatory elements to recognition by transcriptional activators. On the other hand, histone deacetylases promote deposition of histones onto DNA, which could act as a barrier to target site recognition by transcriptional activators resulting in repression. V. Propose a plausible model for how the 21 st amino acid, selenocysteine (SeC), is selectively incorporated into a peptide chain using the UGA stop codon. Hint: All mrna templates encoding SeC-containing redox enzymes contain a specific stem-loop signal in the 3 UTR. (up to 5 bonus points) Mechanism must necessarily involve recoding of the UGA stop codon to a SeC insertion codon. So some other cis-acting element in the mrna template and probably an associated trans-acting factor(s) must somehow signal the translation machinery to recognize the UGA as a SeC insertion site rather than a stop site. It so happens that mrnas encoding selenoproteins all contain a highly conserved stem-loop structure in their 3 UTRs. This cis-element known as SECIS (for selenocysteine insertion sequence) serves as a binding site for a ribonucleoprotein complex containing SeC-tRNA SeC and a special elongation factor that helps deliver the SeC-tRNA to the ribosome as it encounters the UGA codon.
Spring 2006 Biochemistry 302 Exam 2
Name Spring 2006 Biochemistry 302 Exam 2 Directions: This exam has 45 questions/problems totaling 110 points. Check to make sure you have seven pages. Some questions have multiple parts so read each one
More informationRNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
More informationBIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationCH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationMOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1
AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationGene function at the level of traits Gene function at the molecular level
Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines
More informationCh. 10 From DNA to Protein. AP Biology
Ch. 10 From DNA to Protein Protein Synthesis Metabolism and Gene Expression n Inheritance of metabolic diseases suggests that genes coded for enzymes n Diseases (phenotypes) caused by non-functional gene
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More informationComputational Biology I LSM5191 (2003/4)
Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationUnit IX Problem 3 Genetics: Basic Concepts in Molecular Biology
Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize
More informationChapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics
Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps
More informationDNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.
Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationRNA metabolism. DNA dependent synthesis of RNA RNA processing RNA dependent synthesis of RNA and DNA.
RNA metabolism DNA dependent synthesis of RNA RNA processing RNA dependent synthesis of RNA and DNA http://www.youtube.com/watch?v=ovc8nxobxmq DNA dependent synthesis of RNA : production of an RNA molecule
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationBiol 3301 Genetics Exam #2A October 26, 2004
Biol 3301 Genetics Exam #2A October 26, 2004 This exam consists of 40 multiple choice questions worth 2.5 points each, for a total of 100 points. Good luck. Name SS# 1. Which of the following statements
More informationC. Incorrect! Threonine is an amino acid, not a nucleotide base.
MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationInformation Readout: Transcription and Post-transcriptional Processing Translation
Information Readout: Transcription and Post-transcriptional Processing Translation Copyright 2013 Pearson Canada Inc. 27-1 DNA as the Template for RNA Synthesis Enzymology of RNA Synthesis: RNA Polymerase
More informationNucleotides: structure and functions. Prof. Dalė Vieželienė Biochemistry department Room No
Nucleotides: structure and functions Prof. Dalė Vieželienė Biochemistry department Room No. 229 Email: daleveze@med.kmu.lt Composition of Nucleic Acids Nucleotide structure Two types of nucleic acids:
More informationRNA and Protein Synthesis
Harriet Wilson, Lecture Notes Bio. Sci. 4 - Microbiology Sierra College RNA and Protein Synthesis Considerable evidence suggests that RNA molecules evolved prior to DNA molecules and proteins, and that
More informationRNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds.
The Versatility of RNA Primary structure of RNA RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds. Each nucleotide subunit is composed of a ribose sugar,
More informationProtein Synthesis. Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy
Protein Synthesis Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy STRUCTURE OF RNA RNA, adenine forms a base pair with
More informationPART THREE - ANSWERS. ANSWERS to Questions from Part Three
ANSWERS to Questions from Part Three Answers, Chapter 10. Transcription: RNA polymerases 10.1 The sigma factor (σ) causes RNA polymerase to bind to the correct sites on DNA to initiate transcription (i.e.
More informationChapter 4: How Cells Work
Chapter 4: How Cells Work David Shonnard Department of Chemical Engineering 1 Presentation Outline: l l l l l Introduction : Central Dogma DNA Replication: Preserving and Propagating DNA Transcription:
More informationBig Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationDNA Transcription. Dr Aliwaini
DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger
More informationIndependent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)
Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the
More informationCh Molecular Biology of the Gene
Ch. 12 - Molecular Biology of the Gene AP BIOLOGY CHAPTER GUIDE 1. In the middle of the unraveling the mysteries of DNA, researchers knew that genetic material must be able to. It must be stable so it
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More informationGene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
More informationDNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationLecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6
Marieb s Human Anatomy and Physiology Marieb Hoehn Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Lecture Overview The Genetic Information Structure of DNA/RNA DNA Replication Overview of protein synthesis
More informationChem 465 Biochemistry II
Chem 465 Biochemistry II Name: 2 points Multiple choice (4 points apiece): 1. Which of the following is not true of trna molecules? A) The 3'-terminal sequence is -CCA. B) Their anticodons are complementary
More informationMatakuliah Genetika (BIO612206) Jurusan Biologi FMIPA Universitas Lampung. Priyambodo, M.Sc. staff.unila.ac.id/priyambodo
Matakuliah Genetika (BIO612206) Jurusan Biologi FMIPA Universitas Lampung Priyambodo, M.Sc. staff.unila.ac.id/priyambodo Prokariotik Eukariotik staff.unila.ac.id/priyambodo Regulasi ekspresi gen pada
More informationNucleic Acids. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology 1
Nucleic Acids Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology 1 Topics : 2 hrs - Nucleic acid ----------------------------- Nucleic acid structure
More informationChem 465 Biochem II Test 3
Chem 465 Biochem II Test 3 Name: Multiple choice 4 points each. 1. Which of the following are features of the wobble hypothesis? A) A trna can recognize only one codon. B) Some trnas can recognize codons
More informationDNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base
DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationBiochemistry Eukaryotic Transcription
1 Description of Module Subject Name Paper Name Module Name/Title Dr. Vijaya Khader Dr. MC Varadaraj 2 1. Objectives 1. Understand and have an overview of eucaryotic transcriptional regulation. 2. Explain
More informationTranscription in Prokaryotes. Jörg Bungert, PhD Phone:
Transcription in Prokaryotes Jörg Bungert, PhD Phone: 352-273-8098 Email: jbungert@ufl.edu Objectives Understand the basic mechanism of transcription. Know the function of promoter elements and associating
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationPUC Vikasana Program- 2012
Chromosome Nucleus DNA PUC Vikasana Program- 2012 Introduction Molecular biology is the study of biology at a molecular level. Macromolecules and the macromolecular mechanisms. Interactions between the
More informationLecture 11. Initiation of RNA Pol II transcription. Transcription Initiation Complex
Lecture 11 *Eukaryotic Transcription Gene Organization RNA Processing 5 cap 3 polyadenylation splicing Translation Initiation of RNA Pol II transcription Consensus sequence of promoter TATA Transcription
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationDNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan
Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose
More informationChapter 14 Active Reading Guide From Gene to Protein
Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single
More informationName: Class: Date: ID: A
Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12
More informationProkaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
More informationControl of Gene Expression
Control of Gene Expression 1 How Gene Regulation Works 2 Control of Gene Expression Controlling gene expression is often accomplished by controlling transcription initiation Regulatory proteins bind to
More informationBiological information flow
BCMB 3100 Chapters 36-38 Transcription & RNA Processing Biological information flow Definition of gene RNA Polymerase Gene coding vs template strand Promoter Transcription in E. coli Transcription factors
More informationChapter 14: Gene Expression: From Gene to Protein
Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 1 The Nature of Genes Early ideas to explain how genes work came from studying human diseases Archibald Garrod 1902 Recognized that alkaptonuria (black urine disease)
More informationCh. 10 Notes DNA: Transcription and Translation
Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that
More informationBioinformatics. ONE Introduction to Biology. Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012
Bioinformatics ONE Introduction to Biology Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012 Biology Review DNA RNA Proteins Central Dogma Transcription Translation
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationMolecular Genetics Quiz #1 SBI4U K T/I A C TOTAL
Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct
More informationResources. This lecture Campbell and Farrell's Biochemistry, Chapter 11
Transcription Resources This lecture Campbell and Farrell's Biochemistry, Chapter 11 2 Definition of a gene The entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide
More informationGenetics Biology 331 Exam 3B Spring 2015
Genetics Biology 331 Exam 3B Spring 2015 MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) DNA methylation may be a significant mode of genetic regulation
More information9/3/2009. DNA RNA Proteins. DNA Genetic program RNAs Ensure synthesis of proteins Proteins Ensure all cellular functions Carbohydrates (sugars) Energy
Structure Properties Functions of the cell Chemical organization of the cell Based on molecular substrate : DNA contains information RNA ensures protein synthesis Proteins ensure vitality Relations between
More informationGENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function
More informationChapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix
Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix Deoxyribonucleic acid ) (DNA) is a nucleic acid that contains the genetic instructions used in the development and functioning
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley
More informationMULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Ch 17 Practice Questions MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Garrod hypothesized that "inborn errors of metabolism" such as alkaptonuria
More informationChapter 17: From Gene to Protein
Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master
More informationChapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins
KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.
More informationSIBC504: TRANSCRIPTION & RNA PROCESSING Assistant Professor Dr. Chatchawan Srisawat
SIBC504: TRANSCRIPTION & RNA PROCESSING Assistant Professor Dr. Chatchawan Srisawat TRANSCRIPTION: AN OVERVIEW Transcription: the synthesis of a single-stranded RNA from a doublestranded DNA template.
More informationChapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
More informationHello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
More informationproduces an RNA copy of the coding region of a gene
1. Transcription Gene Expression The expression of a gene into a protein occurs by: 1) Transcription of a gene into RNA produces an RNA copy of the coding region of a gene the RNA transcript may be the
More informationRNA synthesis/transcription I Biochemistry 302. February 6, 2004 Bob Kelm
RNA synthesis/transcription I Biochemistry 302 February 6, 2004 Bob Kelm Overview of RNA classes Messenger RNA (mrna) Encodes protein Relatively short half-life ( 3 min in E. coli, 30 min in eukaryotic
More informationName. Student ID. Midterm 2, Biology 2020, Kropf 2004
Midterm 2, Biology 2020, Kropf 2004 1 1. RNA vs DNA (5 pts) The table below compares DNA and RNA. Fill in the open boxes, being complete and specific Compare: DNA RNA Pyrimidines C,T C,U Purines 3-D structure
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationChapter Fundamental Molecular Genetic Mechanisms
Chapter 5-1 - Fundamental Molecular Genetic Mechanisms 5.1 Structure of Nucleic Acids 5.2 Transcription of Protein-Coding Genes and Formation of Functional mrna 5.3 The Decoding of mrna by trnas 5.4 Stepwise
More informationNafith Abu Tarboush DDS, MSc, PhD
Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush I. Hierarchical structure of nucleic acids II. Structures of nucleotides A. Purines & pyrimidines B. Nucleosides & nucleotides
More informationNucleic acids. How DNA works. DNA RNA Protein. DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology
Nucleic acid chemistry and basic molecular theory Nucleic acids DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology Cell cycle DNA RNA Protein Transcription Translation
More informationChapter 17. From Gene to Protein. AP Biology
Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationTranscription & post transcriptional modification
Transcription & post transcriptional modification Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be transferred from DNA to RNA Similarity
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More information* What are the nucleic acids?
Nucleic Acids This lecture is meant to be a refreshment, it s a brief introduction to nucleic acids since we ll be given a full course about it next year in molecular biology. One last lecture and you
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationNafith Abu Tarboush DDS, MSc, PhD
Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush I. Hierarchical structure of nucleic acids II. Structures of nucleotides A. Purines & pyrimidines B. Nucleosides & nucleotides
More informationMicrobiology: The Blueprint of Life, from DNA to protein
Microbiology: The Blueprint of Life, from DNA to protein I. Overview A. DNA ultimately determines every aspect of a cell from shape to function 1. DNA = 2. Nucleotides of DNA have three units a. A nitrogen-containing
More informationRNA does not adopt the classic B-DNA helix conformation when it forms a self-complementary double helix
Reason: RNA has ribose sugar ring, with a hydroxyl group (OH) If RNA in B-from conformation there would be unfavorable steric contact between the hydroxyl group, base, and phosphate backbone. RNA structure
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationSection 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein?
Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Messenger RNA Carries Information for Protein Synthesis from the DNA to Ribosomes Ribosomes Consist
More informationBiological information flow
BCMB 3100 Chapters 36-38 Transcription & RNA Processing Biological information flow Definition of gene RNA Polymerase Gene coding vs template strand Promoter Transcription in E. coli Transcription factors
More information