Developmental Biology BY1101 P. Murphy
|
|
- Sybil Lane
- 6 years ago
- Views:
Transcription
1 Developmental Biology BY1101 P. Murphy Lecture 7 Cellular differentiation and the regulation of gene expression. In this lecture we looked at two main questions: How is gene expression regulated? (revision of some material in chapters 11, 17 and 18) and How does this relate to cellular differentiation? As you heard in lecture 1, Cellular differentiation is one of the 3 main processes needed to form a complex organism from a single fertilized egg cell (Cell division, cell differentiation and morphogenesis). A complex organism requires many hundreds of different cell types to form structures and carry out specific functions. For example, red blood cells are required to carry oxygen, muscle cells are required for movement, neurons are required to receive and transmit nerve signals. If all the cells arise from a single fertilised egg cell and all contain the same DNA in their nuclei, how do they become different to each other or differentiate? This is what we call cellular differentiation. Cellular differentiation is brought about by differential gene expression: the cells become different because they express different genes. e.g. Muscle cells must express the myosin gene so that they have one of the structural proteins needed (myosin) to enable a muscle fiber to contract and red blood cells must express globin genes in order to produce haemoglobin to transport oxygen. Red blood cells do not express the myosin gene and muscle cells do not express globin genes.- these different cell types follow different differentiation programmes. So in order to understand how this can be brought about, we recapped on what it means to express a gene (turn it on) and how the decision to be expressed (or not) is controlled in a cell. How are genes turned on and off? = How are genes regulated? Some terms revised: DNA (deoxyribonucleic acid): The substance that constitutes the hereditary material of an organism. It resides in the nucleus of all eukaryotic cells, organised into linear units called chromosomes. It is a double stranded polymer of deoxyribonucleotides of which there are 4 types (see genetic code below)
2 A gene: A unit of hereditary information consisting of a particular nucleotide sequence of DNA (generally). Many genes are organised along a chromosome. (There are many definitions of a gene depending on the perspective you take) The genetic code: DNA is made up of 4 types of nucleotide: A (adenine), C (cytosine), G (guanine) and T (thymine). The sequence in which these nucleotides occur determines the protein that a gene will encode. Transcription: When a gene is turned on its DNA sequence is used as a template for the synthesis of a complimentary RNA (RiboNucleic Acid) molecule (messenger RNA; mrna) by a process called transcription. mrna: A single stranded polymer of ribonucleotides produced by transcription of a gene. It directs the production of a protein during translation. The sequence of ribonucleotides is complimentary to the DNA sequence being transcribed. (U instead of T) Translation: The production of protein from RNA, the sequence of amino acids that make up the protein depending on the genetic code carried by the RNA. See Campbell and Reece Fig 17.4 for an illustration of transcription and translation To view what happens when a gene is on (being expressed) in a eukaryotic cell, see Campbell and Reece figure A gene includes more than coding sequences (sequences that are transcribed and translated). It also includes regulatory sequences that determine which cells express that gene and when they turn it on. Remember this when you need to define or describe a gene; a gene is not just coding sequence but also the regulatory sequences that determine when and where it will be expressed (turned on). Regulatory sequences at the start of the coding sequence (Promoters) are needed for the transcriptional machinery to assemble and begin to transcribe the DNA sequence into an RNA message or transcript (mrna). These are similar in all eukaryotic genes. See Campbell and Reece figure 17.8 Other regulatory sequences are gene specific and these determine when and where a gene will be turned on. They can be situated close to the coding sequence (proximal control elements) or at large distances (distal control elements). These are often called enhancers and can be positioned upstream (before) or downstream (after) or within the coding sequence (in an intron) See Campbell and Reece figure 18.8 Transcription initiation is controlled by proteins that interact with DNA (regulatory
3 sequences) and with each other- see figure These proteins are called transcription factors and operate by binding to the specific regulatory sequence elements (control elements- enhancers) described above. Cell specific transcription factors influence the efficiency with which the general transcription factors (transcription initiation complex) assemble on the promoter sequence and initiates expression of the gene. Distant control elements, enhancers, may be thousands of nucleotides away from the promoter or even downstream of the gene or within an intron. Factors that turn a gene on in this way are called activators. Eukaryotic genes can also be influenced by repressor proteins that bind to DNA regulatory sequences and tend to destabilize transcription and turn the gene off (can also be called silencers). So to recap: Activator If the balance is favourable Transcription Three important points to note about cellular differentiation: Point 1 Cellular differentiation is usually a result of transcriptional regulation: turning genes on and off. Point 2: During embryonic development, cells become obviously different in
4 structure and function as they differentiate. But differentiation does not happen suddenly. Differentiation happens progressively as the embryo develops. When differentiated cells appear they already produce the proteins that allow them to carry out their specialised roles in the organism e.g eye lens cells, 80% of their capacity for protein synthesis makes crystallins. However changes will be taking place inside a cell long before it visibly differentiates. These include a gradual reprogramming of the genes that are expressed. This would show up only at the molecular level. We looked at the example of progressive myoblast differentiation under the control of the cell specific transcription factor MyoD to illustrate progressive differentiation. This is well covered in the text book: See Campbell and Reece Fig and from bottom of page 414 Point 3: The genes that encode transcription factors that control cellular differentiation (e.g. MyoD) are called Master regulatory genes. These control the expression of sets of target genes (downstream genes), the products of which are needed for the cell to differentiate. Many of the downstream genes may also be regulatory genes controlling the expression of more target genes. This is how a cascade event along a differentiation pathway may be controlled and explains why differentiation is progressive. These master regulatory genes, or developmental regulators, are the genes of most interest to developmental biologists This leaves much unexplained How is the pathway initiated? How are the master regulators (e.g. MyoD) spurred into action? How do cells receive instructions about which master regulators to turn on? We will begin to address these questions in lecture 8 Key concepts in lecture 7 1. Cellular differentiation, one of the three major processes that must take place during
5 development, is brought about by different cells expressing different sets of genes. 2. The genes that are expressed in a cell give it its special characteristics and allow it to carry out its particular functions, e.g. muscle must contract, neurons must receive and transmit signals, lens cells must transmit and focus light, and blood cells must transport oxygen. 3. Consideration of what a gene is and how its expression is regulated is therefore fundamental to working out how development is controlled. The basic facts about gene expression were therefore revised. 4. The primary level at which gene expression is controlled is transcription: the decision about whether or not to make an mrna copy of the coding sequence of the gene. 5. Regulatory sequences (control regions) outside the coding sequence of the gene determine when and where a gene is transcribed. They do this by acting as binding sites for regulatory proteins called transcription factors. Most transcription factors are activators of transcription but some can act as repressors. 6. The genes that are expressed in a cell therefore depend on the transcription factors that are present. Muscle structural genes are therefore active in muscle cells because the cells possess the right transcription factors (e.g. MyoD) to turn them on. Lecture 7: Learning outcomes: you should be able to A) Define cellular differentiation and describe its importance during embryonic development giving examples of cell types that must be established, mentioning how differential gene expression is the basis of cellular differentiation. B) Describe how cell specific transcription factors binding to enhancers in the control regions of genes, regulate the turn on of different genes in different cells. (N.B. you can use the lac operon in bacteria as an example of gene regulatory mechanisms but make sure you know that the lac operon operates in bacteria and is not involved in the differentiation of cells in a complex multicellular organism.) C) Use the example of muscle differentiation and the experiment used to find the regulator MyoD to illustrate the importance of gene regulation during differentiation. Key terms to be familiar with: differential gene expression, gene regulation, DNA, gene, mrna, transcription, translation, regulatory sequences, promoter, enhancer, transcriptional machinery, transcription factors and cell specific transcription factors, activators, repressors, myod, determination, cascade of events, master regulatory genes,
Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
More informationSections 12.3, 13.1, 13.2
Sections 12.3, 13.1, 13.2 Background: Watson & Crick recognized that base pairing in the double helix allows DNA to be copied, or replicated Each strand in the double helix has all the information to remake
More informationReplication Transcription Translation
Replication Transcription Translation A Gene is a Segment of DNA When a gene is expressed, DNA is transcribed to produce RNA and RNA is then translated to produce proteins. Genotype and Phenotype Genotype
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationdeoxyribose, and one of the four nitrogenous compounds: adenine (C H N ), cytosine (C H N O),
Topic Page: DNA Definition: deoxyribonucleic acid (DNA) from Processing Water, Wastewater, Residuals, and Excreta for Health and Environmental Protection: An Encyclopedic Dictionary The double-stranded,
More informationRegulation of Gene Expression
Slide 1 Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions
More informationIndependent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)
Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the
More informationI. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics
Ch 12 Lecture Notes - DNA I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics 1 II. Griffith and Transformation
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationRNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
More informationBIOLOGY 111. CHAPTER 6: DNA: The Molecule of Life
BIOLOGY 111 CHAPTER 6: DNA: The Molecule of Life Chromosomes and Inheritance Learning Outcomes 6.1 Describe the structure of the DNA molecule and how this structure allows for the storage of information,
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More information32 Gene regulation in Eukaryotes Lecture Outline 11/28/05. Gene Regulation in Prokaryotes and Eukarykotes
3 Gene regulation in Eukaryotes Lecture Outline /8/05 Gene regulation in eukaryotes Chromatin remodeling More kinds of control elements Promoters, Enhancers, and Silencers Combinatorial control Cell-specific
More informationWhy are proteins important?
PROTEIN SYNTHESIS Why are proteins important? proteins help build cell structures some proteins are enzymes that promote biological reactions Proteins are found in muscles, blood, bones, etc.. RNA RNA
More informationLesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
More informationBiotechnology Unit 3: DNA to Proteins. From DNA to RNA
From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationFrom Gene to Protein
8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are
More informationDNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
More informationDNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base
DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells
More informationName: Period: Date: This handout will guide you through the format as you preview section 13.1 RNA in your textbook.
Name: Period: Date: Section 13.1 RNA How does RNA differ from DNA? How does the cell make RNA? This handout will guide you through the format as you preview section 13.1 RNA in your textbook. Part 1. Vocabulary
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationTranscription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.
Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally
More informationCh 10.4 Protein Synthesis
Ch 10.4 Protein Synthesis I) Flow of Genetic Information A) DNA is made into RNA which undergoes transcription and translation to be made into a protein. II) RNA Structure and Function A) RNA contains
More informationDNA and RNA Structure. Unit 7 Lesson 1
Unit 7 Lesson 1 Students will be able to: Explain the structure and function of the DNA and RNA. Illustrate the structure of nucleotide. Summarize the differences between DNA and RNA. Identify the different
More informationCHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION
CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION DNA and the Language of Life RECAP Synthesis= Making something Protein Synthesis= Making Proteins Three steps in Protein Synthesis
More informationTranscription. DNA to RNA
Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationName: Class: Date: ID: A
Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12
More informationDNA and RNA Structure Guided Notes
Nucleic acids, especially DNA, are considered as the key biomolecules that guarantee the continuity of life. DNA is the prime genetic molecule which carry all the hereditary information that's passed from
More informationX-Sheet 1 The Nucleus and DNA
X-Sheet 1 The Nucleus and DNA 1 Key Concepts: In this session we will focus on summarising what you need to know about: the Nucleus, genes, nucleic acids, RNA, DNA Terminology & definitions: Chromatin
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationUNIT 2 HUMAN BIOLOGY NOTES
DNA, genes and chromosomes CHAPTER 13 DNA THE CODE FOR LIFE - DNA is short for deoxyribonucleic acid found in cells of organisms. The DNA is embedded within the nucleus of a cell. - DNA is a long stranded
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More information1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna).
1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna). Which statement best describes the error shown in the diagram? (A) The mrna strand contains the uracil
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More information13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription.
13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. The Role of RNA 1. Complete the table to contrast the structures of DNA and RNA. DNA Sugar Number of Strands Bases
More informationLecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6
Marieb s Human Anatomy and Physiology Marieb Hoehn Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Lecture Overview The Genetic Information Structure of DNA/RNA DNA Replication Overview of protein synthesis
More informationHow to Use This Presentation
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or
More informationClick here to read the case study about protein synthesis.
Click here to read the case study about protein synthesis. Big Question: How do cells use the genetic information stored in DNA to make millions of different proteins the body needs? Key Concept: Genetics
More informationBIOLOGY. Chapter 16 GenesExpression
BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
More informationName Class Date. Practice Test
Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More informationAlgorithms in Bioinformatics
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline Central Dogma of Molecular
More informationGene Expression. Student:
Gene Expression Student: 1. A ribozyme is A. a section of the DNA that is expressed in the mrna. B. a self-splicing intron that acts like an enzyme. C. a complex made up of many ribosomes replicating the
More informationBIOLOGY. Monday 14 Mar 2016
BIOLOGY Monday 14 Mar 2016 Entry Task List the terms that were mentioned last week in the video. Translation, Transcription, Messenger RNA (mrna), codon, Ribosomal RNA (rrna), Polypeptide, etc. Agenda
More informationUnit IX Problem 3 Genetics: Basic Concepts in Molecular Biology
Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize
More informationHuman Anatomy & Physiology I Dr. Sullivan Unit IV Cellular Function Chapter 4, Chapter 27 (meiosis only)
Human Anatomy & Physiology I Dr. Sullivan Unit IV Cellular Function Chapter 4, Chapter 27 (meiosis only) I. Protein Synthesis: creation of new proteins a. Much of the cellular machinery is devoted to synthesizing
More informationRNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
More informationThe Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
More informationGene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
More informationPRINCIPLES OF BIOINFORMATICS
PRINCIPLES OF BIOINFORMATICS BIO540/STA569/CSI660, Fall 2010 Lecture 3 (Sep-13-2010) Primer on Molecular Biology/Genomics Igor Kuznetsov Department of Epidemiology & Biostatistics Cancer Research Center
More informationChapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.
Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions
More informationWhat Are the Chemical Structures and Functions of Nucleic Acids?
THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic
More informationMolecular Genetics Quiz #1 SBI4U K T/I A C TOTAL
Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct
More informationChapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko
Chapter 11 How Genes Are Controlled PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and
More informationCh 12.DNA and RNA.Biology.Landis
Identity Section 12 1 DNA (pages 287 294) This section tells about the experiments that helped scientists discover the relationship between genes and DNA. It also describes the chemical structure of the
More informationTo truly understand genetics, biologists first had to discover the chemical nature of genes
To truly understand genetics, biologists first had to discover the chemical nature of genes Identifying the structure that carries genetic information makes it possible to understand how genes control
More informationDNA and the Production of Proteins Course Notes. Cell Biology. Sub-Topic 1.3 DNA and the Production of Proteins
Cell Biology Sub-Topic 1.3 DNA and the Production of Proteins On completion of this subtopic I will be able to state that: Chromosomes contain genetic information that gives rise to an organism s characteristics.
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationGriffith and Transformation (pages ) 1. What hypothesis did Griffith form from the results of his experiments?
Section 12 1 DNA (pages 287 294) This section tells about the experiments that helped scientists discover the relationship between genes and DNA. It also describes the chemical structure of the DNA molecule.
More informationSection C: The Control of Gene Expression
Section C: The Control of Gene Expression 1. Each cell of a multicellular eukaryote expresses only a small fraction of its genes 2. The control of gene expression can occur at any step in the pathway from
More information3'A C G A C C A G T A A A 5'
AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of
More informationDNA, Proteins and Protein Synthesis
DNA, Proteins and Protein Synthesis It s what cells do! Biochemical Composition of Living Things Nucleic acids are the instructions for making proteins, proteins make up traits Nucleic Acids - store genetic
More informationThe study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics
Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger
More informationChapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?
Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationDNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th. Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video
DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video 17 History of DNA 18 Lecture: DNA Structure Worksheet 19 Lecture:
More informationNucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
More informationLecture Overview. Overview of the Genetic Information. Chapter 3 DNA & RNA Lecture 6
Visual Anatomy & Physiology First Edition Martini & Ober Chapter 3 DNA & RNA Lecture 6 Lecture Overview What is the cell s genetic information? How/where is the genetic information stored in eukaryotic
More informationUnit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology
Unit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated
More informationReplication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?
Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationThe Central Dogma of Molecular Biology
The Central Dogma of Molecular Biology In the Central Dogma of Molecular Biology, this process occurs when mrna is made from DNA? A. TranscripBon B. TranslaBon C. ReplicaBon 1 DNA: The ultimate instruction
More informationCh Molecular Biology of the Gene
Ch. 12 - Molecular Biology of the Gene AP BIOLOGY CHAPTER GUIDE 1. In the middle of the unraveling the mysteries of DNA, researchers knew that genetic material must be able to. It must be stable so it
More informationChemistry 106: Drugs in Society Lecture 17: Where Do Macromolecular Targets Come From? 5/07/18
Chemistry 106: Drugs in Society Lecture 17: Where Do Macromolecular Targets Come From? 5/07/18 By the end of this session, you should be able to 1. Know the general scheme of tissue organization, from
More informationWarm-Up: Check your Answers
Warm-Up 1. What are the 3 components of a nucleotide? 2. What are the 4 nitrogen bases that are found in DNA? 3. What type of bonds are found between 2 nitrogen bases? 4. During DNA replication, what breaks
More informationDNA - DEOXYRIBONUCLEIC ACID
DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating
More informationChapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
More informationRna And Protein Synthesis Chapter Test Key
RNA AND PROTEIN SYNTHESIS CHAPTER TEST KEY PDF - Are you looking for rna and protein synthesis chapter test key Books? Now, you will be happy that at this time rna and protein synthesis chapter test key
More informationNucleic Acids. OpenStax College. 1 DNA and RNA
OpenStax-CNX module: m44403 1 Nucleic Acids OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 4.0 By the end of this section, you will be
More informationmolecular genetics notes 2013_14 filled in.notebook February 10, 2014
Feb 3 8:11 AM 1 Chapters 12 & 13: Molecular Genetics (pg. 338 389) Section 12.1: The Role of DNA I. The Main Functions of DNA A. Figure 12 4 (p. 342) B. DNA must be capable of: 1. Information 2. Information
More informationHow can something so small cause problems so large?
How can something so small cause problems so large? Objectives Identify the structural components of DNA and relate to its function Create and ask questions about a model of DNA DNA is made of genes. Gene
More informationChapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein)
Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) I. Review A. Cells copy their DNA (in S phase of Interphase)-Why? Prepare for Cell Division (Mitosis & Cytokinesis) Genes
More informationProteins and Protein Synthesis body structures, hormones, enzymes & antibodies amino acids sequence number DNA chemical code codon 'initiator'
Proteins and Protein Synthesis - Proteins : large complex molecules that make up body structures, hormones, enzymes & antibodies : are composed of subunits called amino acids : there are 20 different amino
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More informationDNA, RNA and protein synthesis
DNA, RNA and protein synthesis DNA is deoxyribonucleic acid DNA contains all the genetic instructions for making proteins within the cell. Each DNA molecule is made of repeating subunits called nucleotides.
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationChapter 13: RNA and Protein Synthesis. Dr. Bertolotti
Chapter 13: RNA and Protein Synthesis Dr. Bertolotti Essential Question How does information flow from DNA to RNA to direct the synthesis of proteins? How does RNA differ from DNA? RNA and protein synthesis
More informationBiology A: Chapter 9 Annotating Notes Protein Synthesis
Name: Pd: Biology A: Chapter 9 Annotating Notes Protein Synthesis -As you read your textbook, please fill out these notes. -Read each paragraph state the big/main idea on the left side. -On the right side
More informationUNIT 3 GENETICS LESSON #41: Transcription
UNIT 3 GENETICS LESSON #41: Transcription Objective: Explain how transcription converts a gene into a singlestranded RNA molecule. Suppose you want to play a game but you need tokens and you only have
More informationIntroduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
More informationNUCLEIC ACID. Subtitle
NUCLEIC ACID Subtitle NUCLEIC ACID Building blocks of living organisms One of the four important biomolecule 1 st isolated from the nuclei of white blood cells by Friedrich Miescher (1860) Came from the
More informationProtein Synthesis and Processing A New Language
Why? Protein Synthesis and Processing A New Language DNA is often referred to as the genetic blueprint. In the same way blueprints produced by an architect contain the instructions for construction of
More information