Gene Prediction Chengwei Luo, Amanda McCook, Nadeem Bulsara, Phillip Lee, Neha Gupta, and Divya Anjan Kumar
|
|
- Buddy Hodges
- 6 years ago
- Views:
Transcription
1 Gene Prediction Chengwei Luo, Amanda McCook, Nadeem Bulsara, Phillip Lee, Neha Gupta, and Divya Anjan Kumar
2 Gene Prediction Introduction Protein-coding gene prediction RNA gene prediction Modification and finishing Project schema
3 Gene Prediction Introduction Protein-coding gene prediction RNA gene prediction Modification and finishing Project schema
4 Why gene prediction? experimental way?
5 Why gene prediction? Exponential growth of sequences New sequencing technology Metagenomics: ~1% grow in lab
6 How to do it?
7 How to do it? It is a complicated task, let s break it into parts
8 How to do it? It is a complicated task, let s break it into parts Genome
9 How to do it? It is a complicated task, let s break it into parts Genome
10 How to do it? Protein-coding gene prediction Homology Search Phillip Lee & Divya Anjan Kumar ab initio approach Nadeem Bulsara & Neha Gupta
11 How to do it? RNA gene prediction Amanda McCook & Chengwei Luo trna rrna srna
12 Gene Prediction Introduction Protein-coding gene prediction RNA gene prediction Modification and finishing Project schema
13 Homology Search
14 Homology Search
15 Strategy
16 open reading frame(orf)
17 How/Why find ORF?
18 How/Why find ORF?
19 How/Why find ORF?
20 Protein Database Searches
21 Domain searches
22 Limits of Extrinsic Prediction
23 ab initio Prediction
24 Homology Search is not Enough! Biased and incomplete Database Sequenced genomes are not evenly distributed on the tree of life, and does not reflect the diversity accordingly either. Number of sequenced genomes clustered here
25 ab initio Gene Prediction
26 Features
27 ORFs (6 frames)
28 Codon Statistics
29 Features (Contd.)
30 Probabilistic View
31 Supervised Techniques
32 Unsupervised Techniques
33 Usually Used Tools GeneMark GLIMMER EasyGene PRODIGAL
34 GeneMark Developed in 1993 at Georgia Institute of Technology as the first gene finding tool. Used markov chain to represent the statistics of coding and noncoding reading frames using dicodon statistics. Shortcomings Inability to find exact gene boundaries
35 GeneMark.hmm
36 GeneMark.hmm Probability of any sequence S underlying functional sequence X is calculated as P(X S)=P(x 1,x 2,,x L b 1,b 2,,b L ) Viterbi algorithm then calculates the functional sequence X * such that P(X * S) is the largest among all possible values of X. Ribosome binding site model was also added to augment accuracy in the prediction of translational start sites.
37 GeneMark Even in prokaryotic genomes gene overlaps are quite common RBS feature overcomes this problem by defining a % position nucleotide matrix based on alignment of 325 E coli genes whose RBS signals have already been annotated. Uses a consensus sequence AGGAG to search upstream of any alternative start codons for genes predicted by HMM. GeneMarkS GENEMARKS Considered the best gene prediction tool. Based on unsupervised learning.
38 GLIMMER Maintained by Steven Salzberg, Art Delcher at the University of Maryland, College Park Used IMM (Interpolated Markov Models) for the first time. Predictions based on variable context (oligomers of variable lengths). More flexible than the fixed order Markov models. Principle IMM combines probability based on 0,1..k previous bases, in this case k=8 is used. But this is for oligomers that occur frequently. However, for rarely occurring oligomers, 5th order or lower may also be used.
39 Glimmer development Glimmer 2 (1999) Increased the sensitivity of prediction by adding concept of ICM (Interpolated Context Model) Glimmer 3 (2007) Overcomes the shortcomings of previous models by taking in account sum of RBS score, IMM coding potentials and a score for start codons which is dependent on relative frequency of each possible start codon in the same training set used for RBS determination. Algorithm used reverse scoring of IMM by scoring all ORF (open reading frames) in reverse, from the stop codon to start codon. Score being the sum of log likelihood of the bases contained in the ORF.
40 Glimmer3.02
41 PRODIGAL Prokaryotic Dynamic Programming Gene Finding Algorithm Developed at Oak Ridge National Laboratory and the University of Tennessee
42 PRODIGAL-Features
43 PRODIGAL-Features
44 EasyGene Developed at University of Copenhagen Statistical significance is the measure for gene prediction. High quality data set based on similarity in SwissPRot is extracted from genome. Data set used to estimate the HMM where based on ORF score and length statistical significance is calculated. Problem: No standalone version available
45 Comparison of Different Tools
46 Gene Prediction Introduction Protein-coding gene prediction RNA gene prediction Modification and finishing Project schema
47 RNA Gene Prediction
48 Why Predict RNA?
49 Regulatory srna
50 srna Challenges
51 Fundamental Methodology
52 RFAM
53 What Is Covariance? Fig: Christian Weile et al. BMC Genomics (2007) 8:244
54 Noncomparative Prediction Fig: James A. Goodrich & Jennifer F. Kugel, Nature Rev. Mol. Cell Biol. (2006) 7:612
55 Noncomparative Prediction *Rolf Backofen & Wolfgang R. Hess, RNA Biol. (2010) 7:1
56 Comparative+Noncomparative Effective srna prediction in V. cholerae Non-enterobacteria srnapredict2 32 novel srnas predicted 9 tested 6 confirmed Jonathan Livny et al. Nucleic Acids Res. (2005) 33:4096
57 Software *Rolf Backofen & Wolfgang R. Hess, RNA Biol. (2010) 7:1 Eva K. Freyhult et al. Genome Res. (2007) 17:117
58 Gene Prediction Introduction Protein-coding gene prediction RNA gene prediction Modification and finishing Project schema
59 Modification & Finishing Consensus strategy to integrate ab initio results Broken gene recruiting TIS correcting IS calling operon annotating Gene presence/absence analysis
60 Modification & Finishing Consensus strategy Broken gene recruiting pass pass fail candidate fragments homology search ab initio results
61 Modification & Finishing TIS correcting Start codon redundancy:atg, GTG, TTG, CTG Leaderless genes Markov iteration, experimental verified data
62 Modification & Finishing IS calling Operon annotating IS Finder DB
63 Modification & Finishing Gene Presence/absence analysis
64 Gene Prediction Introduction Protein-coding gene prediction RNA gene prediction Modification and finishing Project schema
65 Schema (proposed)
66 Schema (proposed) assembly group
67 Schema (proposed) assembly group
GeneMarkS-2: Raising Standards of Accuracy in Gene Recognition
GeneMarkS-2: Raising Standards of Accuracy in Gene Recognition Alexandre Lomsadze 1^, Shiyuyun Tang 2^, Karl Gemayel 3^ and Mark Borodovsky 1,2,3 ^ joint first authors 1 Wallace H. Coulter Department of
More informationSmall Genome Annotation and Data Management at TIGR
Small Genome Annotation and Data Management at TIGR Michelle Gwinn, William Nelson, Robert Dodson, Steven Salzberg, Owen White Abstract TIGR has developed, and continues to refine, a comprehensive, efficient
More informationComputational gene finding. Devika Subramanian Comp 470
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) The biological context Lec 1 Lec 2 Lec 3 Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
More informationOutline. Gene Finding Questions. Recap: Prokaryotic gene finding Eukaryotic gene finding The human gene complement Regulation
Tues, Nov 29: Gene Finding 1 Online FCE s: Thru Dec 12 Thurs, Dec 1: Gene Finding 2 Tues, Dec 6: PS5 due Project presentations 1 (see course web site for schedule) Thurs, Dec 8 Final papers due Project
More informationUCSC Genome Browser. Introduction to ab initio and evidence-based gene finding
UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene
More informationLeonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
More informationGenscan. The Genscan HMM model Training Genscan Validating Genscan. (c) Devika Subramanian,
Genscan The Genscan HMM model Training Genscan Validating Genscan (c) Devika Subramanian, 2009 96 Gene structure assumed by Genscan donor site acceptor site (c) Devika Subramanian, 2009 97 A simple model
More informationBaum-Welch and HMM applications. November 16, 2017
Baum-Welch and HMM applications November 16, 2017 Markov chains 3 states of weather: sunny, cloudy, rainy Observed once a day at the same time All transitions are possible, with some probability Each state
More informationGenes and gene finding
Genes and gene finding Ben Langmead Department of Computer Science You are free to use these slides. If you do, please sign the guestbook (www.langmead-lab.org/teaching-materials), or email me (ben.langmead@gmail.com)
More informationOutline. Introduction to ab initio and evidence-based gene finding. Prokaryotic gene predictions
Outline Introduction to ab initio and evidence-based gene finding Overview of computational gene predictions Different types of eukaryotic gene predictors Common types of gene prediction errors Wilson
More informationGenome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)
Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA
More informationGene Identification in silico
Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction
More informationA comparative genomic method for computational identification of prokaryotic translation initiation sites
A comparative genomic method for computational identification of prokaryotic translation initiation sites Megon Walker, Vladimir Pavlovic, and Simon Kasif* Bioinformatics Department Boston University Boston,
More informationAb initio gene identification in metagenomic sequences
Nucleic Acids Research Advance Access published April 19, 2010 Nucleic Acids Research, 2010, 1 15 doi:10.1093/nar/gkq275 Ab initio gene identification in metagenomic sequences Wenhan Zhu 1, Alexandre Lomsadze
More informationGenomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 1, 2004 Prokaryotic Gene Structure prokaryotes are simplest free-living organisms studying prokaryotes can give us a sense what is the minimum
More informationRoseobacter denitrificans genome annotation using Manatee
Roseobacter denitrificans genome annotation using Manatee Chaitanya R. Acharya Computational Biosciences Arizona State University May 3, 2006 Acknowledgements Thanks to my project advisor Dr. Robert Blankenship,
More informationGenomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 3, 2004 Eukaryotic Gene Structure eukaryotic genomes are considerably more complex than those of prokaryotes eukaryotic cells have organelles
More informationGlossary of Commonly used Annotation Terms
Glossary of Commonly used Annotation Terms Akela a general use server for the annotation group as well as other groups throughout TIGR. Annotation Notebook a link from the gene list page that is associated
More informationComputational analysis of non-coding RNA. Andrew Uzilov BME110 Tue, Nov 16, 2010
Computational analysis of non-coding RNA Andrew Uzilov auzilov@ucsc.edu BME110 Tue, Nov 16, 2010 1 Corrected/updated talk slides are here: http://tinyurl.com/uzilovrna redirects to: http://users.soe.ucsc.edu/~auzilov/bme110/fall2010/
More informationA Novel Bacterial Gene-Finding System with Improved Accuracy in Locating Start Codons
DNA Research 8, 97 106 (2001) A Novel Bacterial Gene-Finding System with Improved Accuracy in Locating Start Codons Tetsushi Yada, 1, Yasushi Totoki, 1 Toshihisa Takagi, 2 and Kenta Nakai 2, Genomic Sciences
More informationRNA folding & ncrna discovery
I519 Introduction to Bioinformatics RNA folding & ncrna discovery Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Non-coding RNAs and their functions RNA structures RNA folding
More informationMATH 5610, Computational Biology
MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationAnnotating Fosmid 14p24 of D. Virilis chromosome 4
Lo 1 Annotating Fosmid 14p24 of D. Virilis chromosome 4 Lo, Louis April 20, 2006 Annotation Report Introduction In the first half of Research Explorations in Genomics I finished a 38kb fragment of chromosome
More informationMotif Discovery from Large Number of Sequences: a Case Study with Disease Resistance Genes in Arabidopsis thaliana
Motif Discovery from Large Number of Sequences: a Case Study with Disease Resistance Genes in Arabidopsis thaliana Irfan Gunduz, Sihui Zhao, Mehmet Dalkilic and Sun Kim Indiana University, School of Informatics
More informationCh. 10 Notes DNA: Transcription and Translation
Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that
More informationRelationship between nucleotide sequence and 3D protein structure of six genes in Escherichia coli, by analysis of DNA sequence using a Markov model
Relationship between nucleotide sequence and 3D protein structure of six genes in Escherichia coli, by analysis of DNA sequence using a Markov model Yuko Ohfuku 1,, 3*, Hideo Tanaka and Masami Uebayasi
More informationSequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned
More informationABSTRACT METHODS FOR MICROBIAL GENOMICS. Professor Steven L. Salzberg Department of Computer Science
ABSTRACT Title of Dissertation: COMPARATIVE AND COMPUTATIONAL METHODS FOR MICROBIAL GENOMICS Derrick Edward Wood, Doctor of Philosophy, 2014 Directed by: Professor Steven L. Salzberg Department of Computer
More informationOutline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases
Chapter 7: Similarity searches on sequence databases All science is either physics or stamp collection. Ernest Rutherford Outline Why is similarity important BLAST Protein and DNA Interpreting BLAST Individualizing
More informationGene and Translation Initiation Site Prediction in Metagenomic Sequences
Bioinformatics Advance Access published July 12, 2012 Gene and Translation Initiation Site Prediction in genomic Sequences Doug Hyatt 1,2*, Philip F. LoCascio 1, Loren J. Hauser 1,2,and Edward C. Uberbacher
More informationRNA Genomics II. BME 110: CompBio Tools Todd Lowe & Andrew Uzilov May 17, 2011
RNA Genomics II BME 110: CompBio Tools Todd Lowe & Andrew Uzilov May 17, 2011 1 TIME Why RNA? An evolutionary perspective The RNA World hypotheses: life arose as self-replicating non-coding RNA (ncrna)
More informationGenome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does
More informationEukaryotic Gene Prediction. Wei Zhu May 2007
Eukaryotic Gene Prediction Wei Zhu May 2007 In nature, nothing is perfect... - Alice Walker Gene Structure What is Gene Prediction? Gene prediction is the problem of parsing a sequence into nonoverlapping
More informationGenome sequence of Acinetobacter baumannii MDR-TJ
JB Accepts, published online ahead of print on 11 March 2011 J. Bacteriol. doi:10.1128/jb.00226-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationPRiB - Mandatory Project 2. Gene finding using HMMs
PRiB - Mandatory Project 2 Gene finding using HMMs Viterbi decoding >NC_002737.1 Streptococcus pyogenes M1 GAS TTGTTGATATTCTGTTTTTTCTTTTTTAGTTTTCCACATGAAAAATAGTTGAAAACAATA GCGGTGTCCCCTTAAAATGGCTTTTCCACAGGTTGTGGAGAACCCAAATTAACAGTGTTA
More informationBIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationMethods and Algorithms for Gene Prediction
Methods and Algorithms for Gene Prediction Chaochun Wei 韦朝春 Sc.D. ccwei@sjtu.edu.cn http://cbb.sjtu.edu.cn/~ccwei Shanghai Jiao Tong University Shanghai Center for Bioinformation Technology 5/12/2011 K-J-C
More informationPost-assembly Data Analysis
Assembled transcriptome Post-assembly Data Analysis Quantification: the expression level of each gene in each sample DE genes: genes differentially expressed between samples Clustering/network analysis
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationAnalysis of Biological Sequences SPH
Analysis of Biological Sequences SPH 140.638 swheelan@jhmi.edu nuts and bolts meet Tuesdays & Thursdays, 3:30-4:50 no exam; grade derived from 3-4 homework assignments plus a final project (open book,
More informationGene prediction in novel fungal genomes using an ab initio algorithm with unsupervised training
Methods Gene prediction in novel fungal genomes using an ab initio algorithm with unsupervised training Vardges Ter-Hovhannisyan, 1,4 Alexandre Lomsadze, 2,4 Yury O. Chernoff, 1 and Mark Borodovsky 2,3,5
More informationTranscription Gene regulation
Transcription Gene regulation The machine that transcribes a gene is composed of perhaps 50 proteins, including RNA polymerase, the enzyme that converts DNA code into RNA code. A crew of transcription
More informationGenome Annotation. What Does Annotation Describe??? Genome duplications Genes Mobile genetic elements Small repeats Genetic diversity
Genome Annotation Genome Sequencing Costliest aspect of sequencing the genome o But Devoid of content Genome must be annotated o Annotation definition Analyzing the raw sequence of a genome and describing
More informationTERTIARY MOTIF INTERACTIONS ON RNA STRUCTURE
1 TERTIARY MOTIF INTERACTIONS ON RNA STRUCTURE Bioinformatics Senior Project Wasay Hussain Spring 2009 Overview of RNA 2 The central Dogma of Molecular biology is DNA RNA Proteins The RNA (Ribonucleic
More informationName: Class: Date: ID: A
Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12
More informationThree-Way Comparison and Investigation of Annotated Halorhabdus utahensis Genome
Three-Way Comparison and Investigation of Annotated Halorhabdus utahensis Genome Peter Bakke, Nick Carney, Will DeLoache, Mary Gearing, Matt Lotz, Jay McNair, Pallavi Penumetcha, Samantha Simpson, Laura
More informationWhy learn sequence database searching? Searching Molecular Databases with BLAST
Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results
More informationCOMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
More informationSelf-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype)
Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Question#1: One-Gene, One-Polypeptide The figure below shows the results of feeding trials with one auxotroph strain of Neurospora
More informationYear III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
More informationRNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
More informationMolecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology
Molecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology Question No. 1 of 10 1. Which statement describes how an organism is organized from most simple to most complex? Question
More informationProtein Synthesis: Transcription and Translation
Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)
More informationAntisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression
Vol. 1:7-15 Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression Ji, Tom, Lu, Aneka, Wu, Kaylee Department of Microbiology and Immunology, University of British Columbia
More informationDNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted
DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More informationProgrammed Ribosomal Frameshifts as Synthetic Biology Tools. University of Lethbridge Lethbridge, AB, Canada November 2, 2013.
c F h R a A n M g E er Programmed Ribosomal Frameshifts as Synthetic Biology Tools University of Lethbridge Lethbridge, AB, Canada November 2, 2013 FRAMEchanger Project Goals Design a new class of regulatory
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationGenome sequence of Brucella abortus vaccine strain S19 compared to virulent strains yields candidate virulence genes
Fig. S2. Additional information supporting the use case Application to Comparative Genomics: Erythritol Utilization in Brucella. (A) Genes encoding enzymes involved in erythritol transport and catabolism
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationVL Algorithmische BioInformatik (19710) WS2013/2014 Woche 3 - Mittwoch
VL Algorithmische BioInformatik (19710) WS2013/2014 Woche 3 - Mittwoch Tim Conrad AG Medical Bioinformatics Institut für Mathematik & Informatik, Freie Universität Berlin Vorlesungsthemen Part 1: Background
More informationIndependent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)
Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationBIOINFORMATICS Introduction
BIOINFORMATICS Introduction Mark Gerstein, Yale University bioinfo.mbb.yale.edu/mbb452a 1 (c) Mark Gerstein, 1999, Yale, bioinfo.mbb.yale.edu What is Bioinformatics? (Molecular) Bio -informatics One idea
More informationProtein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl)
Protein Sequence Analysis BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical
More informationBIOINFORMATICS. Accuracy improvement for identifying translation initiation sites in microbial genomes
BIOINFORMATICS Vol. 20 no. 18 2004, pages 3308 3317 doi:10.1093/bioinformatics/bth390 Accuracy improvement for identifying translation initiation sites in microbial genomes Huai-Qiu Zhu 1, Gang-Qing Hu
More informationDNA - DEOXYRIBONUCLEIC ACID
DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating
More informationComputational aspects of ncrna research. Mihaela Zavolan Biozentrum, Basel Swiss Institute of Bioinformatics
Computational aspects of ncrna research Mihaela Zavolan Biozentrum, Basel Swiss Institute of Bioinformatics Computational aspects on ncrna Bacterial ncrnas research Gene discovery Target discovery Discovery
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationGenie Gene Finding in Drosophila melanogaster
Methods Gene Finding in Drosophila melanogaster Martin G. Reese, 1,2,4 David Kulp, 2 Hari Tammana, 2 and David Haussler 2,3 1 Berkeley Drosophila Genome Project, Department of Molecular and Cell Biology,
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationRNA-Seq with the Tuxedo Suite
RNA-Seq with the Tuxedo Suite Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 2015 Workshop The Basic Tuxedo Suite References Trapnell C, et al. 2009 TopHat: discovering splice junctions with
More informationM I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationLecture 2: Central Dogma of Molecular Biology & Intro to Programming
Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Central Dogma of Molecular Biology Proteins: workhorse molecules of biological systems Proteins are synthesized from the genetic blueprints
More informationDNA Transcription. Dr Aliwaini
DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger
More informationABSTRACT COMPUTATIONAL METHODS TO IMPROVE GENOME ASSEMBLY AND GENE PREDICTION. David Kelley, Doctor of Philosophy, 2011
ABSTRACT Title of dissertation: COMPUTATIONAL METHODS TO IMPROVE GENOME ASSEMBLY AND GENE PREDICTION David Kelley, Doctor of Philosophy, 2011 Dissertation directed by: Professor Steven Salzberg Department
More informationDNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.
Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationI nternet Resources for Bioinformatics Data and Tools
~i;;;;;;;'s :.. ~,;;%.: ;!,;s163 ~. s :s163:: ~s ;'.:'. 3;3 ~,: S;I:;~.3;3'/////, IS~I'//. i: ~s '/, Z I;~;I; :;;; :;I~Z;I~,;'//.;;;;;I'/,;:, :;:;/,;'L;;;~;'~;~,::,:, Z'LZ:..;;',;';4...;,;',~/,~:...;/,;:'.::.
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationCreation of a PAM matrix
Rationale for substitution matrices Substitution matrices are a way of keeping track of the structural, physical and chemical properties of the amino acids in proteins, in such a fashion that less detrimental
More informationDNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More informationAdvanced Bioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2018
Advanced Bioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2018 Anthony Gitter gitter@biostat.wisc.edu www.biostat.wisc.edu/bmi776/ These slides, excluding third-party
More informationTRANSCRIPTION AND TRANSLATION
TRANSCRIPTION AND TRANSLATION Bell Ringer (5 MINUTES) 1. Have your homework (any missing work) out on your desk and ready to turn in 2. Draw and label a nucleotide. 3. Summarize the steps of DNA replication.
More informationEukaryotic Gene Structure
Eukaryotic Gene Structure Terminology Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Gene Basic physical and
More informationAnnotating 7G24-63 Justin Richner May 4, Figure 1: Map of my sequence
Annotating 7G24-63 Justin Richner May 4, 2005 Zfh2 exons Thd1 exons Pur-alpha exons 0 40 kb 8 = 1 kb = LINE, Penelope = DNA/Transib, Transib1 = DINE = Novel Repeat = LTR/PAO, Diver2 I = LTR/Gypsy, Invader
More informationThe String Alignment Problem. Comparative Sequence Sizes. The String Alignment Problem. The String Alignment Problem.
Dec-82 Oct-84 Aug-86 Jun-88 Apr-90 Feb-92 Nov-93 Sep-95 Jul-97 May-99 Mar-01 Jan-03 Nov-04 Sep-06 Jul-08 May-10 Mar-12 Growth of GenBank 160,000,000,000 180,000,000 Introduction to Bioinformatics Iosif
More informationGene Signal Estimates from Exon Arrays
Gene Signal Estimates from Exon Arrays I. Introduction: With exon arrays like the GeneChip Human Exon 1.0 ST Array, researchers can examine the transcriptional profile of an entire gene (Figure 1). Being
More informationSequence Analysis Lab Protocol
Sequence Analysis Lab Protocol You will need this handout of instructions The sequence of your plasmid from the ABI The Accession number for Lambda DNA J02459 The Accession number for puc 18 is L09136
More informationProtein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
More informationName Class Date. Practice Test
Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.
More information