Current questions in science. How can Bioinformatics help to to solve them?
|
|
- Eunice Whitehead
- 5 years ago
- Views:
Transcription
1 Current questions in science How can Bioinformatics help to to solve them?
2 Overview Introduction Historical Historical overview overview Current Current questions questions in in science science Genome projects Proteomics Data analysis Current Current status status of of genome genome projects projects Sequencing Sequencing strategies strategies and and methods methods Strategies Strategies for for gene gene identification identification Proteome: Proteome: 2D 2D gels, gels, mass mass spectroscopy spectroscopy Protein Protein interactions interactions Gene Gene expression: expression: Microarrays, Microarrays, SAGE SAGE Sequence Sequence comparison comparison Data Data mining mining
3 Historical overview Classification in biology Carl von Linne ( ) Evolution Charles Darwin ( ) Genetics Gregor Mendel ( ) Discovery of nuclein Friedrich Miescher ( ) DNA is the genetic material Hershey-Chase Molecular structure of DNA Chargaff, 1962 Nobel Prize James Watson, Francis Crick Recombinant DNA, DNA sequencing 1980 Nobel Prize Walter Gilbert, Frederick Sanger, Paul Berg Amplification of DNA (PCR) Kary Mullis & others, 1993 Nobel Prize
4
5 Classical genetics Mutant Phaenotypic Feature Protein Function Gene Biochemical Pathways Enzymes Cell cycle Visual signal response Development of tissues Development of organisms Embryogenesis Immune response Receptor proteins Hormones
6 The limits The dogma: Gene Protein Specific function is not true for all biological functions. Cellular processes involve many different gene products and their interactions. Cellular processes are complex and multi dimensional. This asks for a completely new kind of research.
7 Current questions in science Genome Transcriptome Regulome High throughput! Proteome Metabolome
8 Current questions in science To understand complex biological processes Proteomics in the cell and organism. Biology Research Medicine Disease Diagnostics Biotechnology Pharmacology Drug targeting Synthetic substances
9 Methanococcus jannaschii
10 Overview Introduction Historical Historical overview overview Current Current questions questions in in science science Genome projects Proteomics Data analysis Current Current status status of of genome genome projects projects Sequencing Sequencing strategies strategies and and methods methods Strategies Strategies for for gene gene identification identification Proteome: Proteome: 2D 2D gels, gels, mass mass spectroscopy spectroscopy Protein Protein interactions interactions Gene Gene expression: expression: Microarrays, Microarrays, SAGE SAGE Sequence Sequence comparison comparison Data Data mining mining
11 Highlights in Genome Projects Organism Year Millions of bases Number of genes Number of genes per million bases Saccharomizes cerevisiae Caenorabditis elegans Drosophila melanogaster Arabidopsis thaliana Human genome (public sequence) Human genome (Celera)
12 Complete genomes Whole-genome Whole-genome sequences sequences for for more more than than organisms organisms (bacteria, (bacteria, archaea, archaea, and and eukaryota eukaryotaas as well well as as many many viruses viruses and and organells) organells) are are either either complete complete or or being being determined. determined.
13 Human Genome Project Goals: Determine the sequence (0.75Gb of of data) Identify all all the genes in in the human DNA Store this information in in databases Develop tools for for data analysis and Address the ethical, legal, and social issues that may arise from the project.
14 Human Genome Project genes Current estimate: functional genes More transcripts due to to alternative ~ one splicing gene three or or proteins recombination More than 95% of of the human genome is isnot coding Mostly DNA with Proteome: unknown functions ~ proteins CpG islands (45000 per haploid genome) protein families Repeated sequences (sines and lines)
15 Overview Introduction Historical Historical overview overview Current Current questions questions in in science science Genome projects Proteomics Data analysis Current Current status status of of genome genome projects projects Sequencing Sequencing strategies strategies and and methods methods Strategies Strategies for for gene gene identification identification Proteome: Proteome: 2D 2D gels, gels, mass mass spectroscopy spectroscopy Protein Protein interactions interactions Gene Gene expression: expression: Microarrays, Microarrays, SAGE SAGE Sequence Sequence comparison comparison Data Data mining mining
16 High throughput! Genome projects Sequencing a genome Clone large parts into special vectors (BACs, can contain up to 1Mbp) Primerwalking Sequence the BACs from beginning to end Shotgun sequencing Fractionate the BAC insert into small fragments Shotgun sequence these (only the ends) computer-assemble all pieces 10-fold excess essential
17 Genome projects Physical maps of genomes by mapping of known diseases to certain areas or by placing more abstract landmarks on the map such as: PCR fragments (STS sequence tagged sites) These can be random fragments of DNA or those corresponding to ESTs or other cdnas EXAMPLE: Duchenne Muscular Dystrophy Duchenne muscular dystrophy (DMD) is one of a group of muscular dystrophies characterized by enlargement of muscles. All are Y-linked and affect mainly males. "Dystrophy" refers to any of a number of disorders characterized by weakening, degeneration or abnormal development of muscle. Y chromosome
18 Genome projects Fluorescent in situ hybridisation
19 Overview Introduction Historical Historical overview overview Current Current questions questions in in science science Genome projects Proteomics Data analysis Current Current status status of of genome genome projects projects Sequencing Sequencing strategies strategies and and methods methods Strategies Strategies for for gene gene identification identification Proteome: Proteome: 2D 2D gels, gels, mass mass spectroscopy spectroscopy Gene Gene expression: expression: Microarrays, Microarrays, SAGE SAGE Protein Protein interactions interactions Sequence Sequence comparison comparison Data Data mining mining
20 Predicting protein encoding genes Transcription: prerna Splicing: mrna (A) 200 Translation: Modification Protein
21 Three basic strategies to to find gene specific sequence motives Homology searching Analysis of of sequence signals Statistical analysis Whole genome comparison
22 Three basic strategies to to find gene specific sequence motives Homology searching Analysis of of sequence signals Statistical analysis Whole genome comparison Ideally, gene prediction tools should be be able to to identify and automatically annotate all all genes.
23 Recognition sites for gene regulation
24 Three basic strategies to to find gene specific sequence motives Homology searching Analysis of of sequence signals Statistical analysis Whole genome comparison
25 Genome comparison
26 Genomes
27 Bioinformatics Why Sequence Comparison? Evolutionary relationships paralog ancestor ortholog species 1 species 2 species 3
28
29
30
31 Homo sapiens chromosome X versus Mus musculus chromosome X
32 Overview Introduction Historical Historical overview overview Current Current questions questions in in science science Genome projects Proteomics Data analysis Current Current status status of of genome genome projects projects Sequencing Sequencing strategies strategies and and methods methods Strategies Strategies for for gene gene identification identification Proteome: Proteome: 2D 2D gels, gels, mass mass spectroscopy spectroscopy Gene Gene expression: expression: Microarrays, Microarrays, SAGE SAGE Protein Protein interactions interactions Sequence Sequence comparison comparison Data Data mining mining
33 Identical genome Totally different proteome
34 Proteome Sequence the proteome Tissue Isolate proteins Run a 2 D SDS-PAGE Isolate single protein dots Sequence the protein
35 2-dimensional SDS-PAGE 1. Step: + -
36 2-dimensional SDS-PAGE 2. Step: - +
37 Proteome Tissue Identify a protein with mass spectrometry Isolate proteins Run a 2 D SDS-PAGE Isolate single protein dots Enzymatic digestion Peptide mass fingerprinting Database search
38 Proteome 5'UTR 3'UTR prerna: Exon 1 Exon 2 Exon 3 Intron 1 Intron 2 ATG TAA mrna: Splicing / Polyadenylation ATG polya TAA AAAAAAAAA active protein: Translation CPLTW...GFL CPLTW...PJC Splice variant Posttranslationale Modification CPLTW...LAC
39 Proteome
40 Proteomics Ultimate goal of proteomics Identical expression pattern Receptor/ligand relationship Sequence identity
41 Novel definitions in biology Genome The complete set of chromosomes with the genes they contain It s more or less static information! Proteome All proteins encoded by the genome - Splice variants, - Post-translational modifications, - Polymorphismen, - Disease mutations, Proteomics
42 HPI Human Proteomics Initiative A major effort of the Swiss Institute of Bioinformatics (SIB) and the European Bioinformatics Institute (EBI) GOALS Annotation of all known human proteins (+ splice variants). Annotation of all known human polymorphisms and disease mutations. Annotation of all known post-translational modifications in human proteins. Tight links to structural information. Annotation of mammalian orthologs of human proteins.
43 Proteomics - Many interactions with other proteins and compounds - Changes of protein concentrations: - Subcellular localization - Time - Tissue - Developmental stages -..
44 Proteomics Goal Reconstructing molecular circuitry of a living cell. Techniques Molecular genetics: Gen expression: Micro arrays SAGE Protein analysis: 2-D gel electrophoresis Mass spectroscopy Protein interactions (peptide arrays, yeast two hybrid) And bioinformatics to integrate heterogenous data from different knowledge databases
45 Overview Introduction Historical Historical overview overview Current Current questions questions in in science science Genome projects Proteomics Data analysis Current Current status status of of genome genome projects projects Sequencing Sequencing strategies strategies and and methods methods Strategies Strategies for for gene gene identification identification Proteome: Proteome: 2D 2D gels, gels, mass mass spectroscopy spectroscopy Gene Gene expression: expression: Microarrays, Microarrays, SAGE SAGE Protein Protein interactions interactions Sequence Sequence comparison comparison Data Data mining mining
46 High throughput! DNA Microarrays DNA microarrays are perfectly suited for comparing gene expression Different probes are compared to find, e.g. Tissue-specific Genes Regulatory Gene Defects in Cancer Medicine Disease related metabolic pathways Candidate genes Cellular Responses to the Environment
47 Microarray technique Affymetrix GeneChip or Spotted DNA Microarrays Two different cell samples RNA extraction and reverse transcription Labelling Hybridisation
48 Microarrays: a flood of data Data collection Arrays are scanned to extract signal intensities from the image. Normalization Data is calibrated e.g. by dividing RNA signal by genomic DNA signal. Clustering Bioinformatics methods identify groups of Up and down regulated genes. Annotation Bioinformatics methods / Data mining To get more information about the function and interaction of up and down regulated genes. Submission to public repositories
49 High throughput! Serial Analysis of Gene Expression (SAGE) AAAAAAA Isolate tissue specific RNA. 4 Nucleotides, RT, primer TTTTTT... Reverse transcribe to cdna TTTTTTTT cdna is linked to matrix via biotin/streptavidin. TTTTTTTT Digest with enzyme 1. TTTTTTTT Remove unbound fragments.
50 Serial Analysis of Gene Expression (SAGE) 14 bp Linker + RE TTTTTTTT Divide sample in two parts. Ligate two different linkers to the samples. 14 bp Linker + RE TTTTTTTT Digest with (type II) enzyme. Linker + RE Linker + RE Linker + RE Linker + RE Ligate and multiply/amplify with PCR, clone.
51 Serial Analysis of Gene Expression (SAGE) The result is a huge chain of 14 bp fragments. 14 bp The sequence of the concatemer is determined. Tumor cells copies 60 interleukin 93 actin 14 synthase 110 unknown Healthy cells copies bp (4 14 possible combinations) are sufficient to characterize any individual RNA Determine the frequency of each transcript. Goal: identify novel genes involved in disease or investigate how known genes are regulated.
52 Transcriptome High throughput! Next to to determining the sequence of of the genome (DNA), many laboratories determine the sequence of of Expressed Sequence Tags (ESTs) Tissue Isolate RNA Reverse transcribe into DNA Sequence both ends Max 500bp The resulting sequences are ESTs
53 Overview Introduction Historical Historical overview overview Current Current questions questions in in science science Genome projects Proteomics Data analysis Current Current status status of of genome genome projects projects Sequencing Sequencing strategies strategies and and methods methods Strategies Strategies for for gene gene identification identification Proteome: Proteome: 2D 2D gels, gels, mass mass spectroscopy spectroscopy Gene Gene expression: expression: Microarrays, Microarrays, SAGE SAGE Protein Protein interactions interactions Sequence Sequence comparison comparison Data Data mining mining
54 High throughput! Protein-protein interaction Peptide arrays Peptide chips provide new ways to study protein-protein interaction, unravel signal transduction pathways, perform multi-parameter diagnosis, study individual immunological repertoires, e.g. autoimmune reactions.
55 Protein-protein interaction Yeast two hybrid system
56 Overview Introduction Historical Historical overview overview Current Current questions questions in in science science Genome projects Proteomics Data analysis Current Current status status of of genome genome projects projects Sequencing Sequencing strategies strategies and and methods methods Strategies Strategies for for gene gene identification identification Proteome: Proteome: 2D 2D gels, gels, mass mass spectroscopy spectroscopy Gene Gene expression: expression: Microarrays, Microarrays, SAGE SAGE Protein Protein interactions interactions Sequence Sequence comparison comparison Data Data mining mining
57 Bioinformatics Current status of data analysis Scientific exploitation of molecular biology databases Database searches to find related sequences Pair-wise comparison of two sequences Alignment of multiple sequences Evolutionary analysis of molecular sequence data Analysis of protein secondary structure Analysis of RNA secondary structure Geneprediction... Thousands of software tools exist
58 Bioinformatics Data analysis Analyze one Sequence Compare Sequences e.g. Restriction maps e.g. Calculation of MW Structure prediction Gene prediction Database searches Assembling Sequence alignments Phylogeny Enter and Edit Sequences
59 Bioinformatics Why sequence comparison? Sequence comparison is often used: To find related genes in the database; When dealing with a sequence of unknown function the presence of similar domains implies similar function. Homologous sequences share the same ancestral sequence They can be ortholog or paralog
60 Bioinformatics Example: Blast2P Searching for homologous sequences Searching...done Sequences producing significant alignments: Score E (bits) Value >>>swissprot:25a1_mouse P11928 mus musculus (mouse). (2'-5')oli e-180 >>>swissprot:25a2_mouse P29080 mus musculus (mouse). (2'-5')oli e-140 >>>swissprot:25a2_human P04820 homo sapiens (human). (2'-5')oli e-140 >>>swissprot:25a1_human P00973 homo sapiens (human). (2'-5')oli e-140 >>>swissprot:25a3_mouse P29081 mus musculus (mouse). (2'-5')oli e-139 >>>swissprot:25a6_human P29728 homo sapiens (human). 69/71 kd ( e-96 >>>swissprot:tr14_human Q15646 homo sapiens (human). thyroid re e-14 >>>swissprot:rn14_yeast P25298 saccharomyces cerevisiae (baker'
61 Bioinformatics Why sequence comparison? Evolution of genes and proteins Many proteins consist of many different domains which have specific functions Gene Protein Gene duplication Domain shuffling
62 Bioinformatics Why sequence comparison? Evolution of genes and proteins Gene duplication: Mostly pseudogenes (without function) or Similar gene product with new function (e.g. haemoglobin alpha, beta chain)
63 Bioinformatics Why sequence comparison? Evolution of genes and proteins Many genes and proteins are members of families which share a common biochemical function or evolutionary origin. Protein A Protein B Protein C Protein D1 Protein D2
64 Bioinformatics Why sequence comparison? Evolutionary relationships paralog ancestor ortholog species 1 species 2 species 3
65 Bioinformatics The birth of molecular evolution In In the the early early days, days, evolution was was studied studied by by comparison of of morphologic features In In the the 50s 50s and and 60s, 60s, the the protein protein sequences of of insulin insulin (Sanger), heamoglobins and and cytochrome c were were available and and sequence comparisons became possible.
66 Bioinformatics The birth of molecular evolution The phylogenetic tree of all cytochrome c proteins The phylogenetic tree of the species (organisms) Comparison... revealed a great overlap, supporting classical phylogeny At the same time, minor variations helped to improve existing trees
67 Gene prediction The Challenge The gap between data collection and data interpretation is is growing rapidly.
68 High-throughput data collection World wide collection of data Storage in databases Global efforts to collect: sequence data structure data protein expression profiles functional data metabolic pathways.. Data analysis Bioinformatics Data mining
69 The Biocomputing Service Group HUSAR Sequence Retrieval Analysis Packages BIOCCELERATOR EST CLUSTERING PHYLIP SRS STADEN Databases (EMBL, GENBANK, Swissprot, PIR, TRANSFAC,., Genome databases GDB/OMIM, Flybase, AceDB,...) Heidelberg UNIX Sequence Analysis Resources GCG / EGCG User Support Scientific Consulting, Training, Workshops, Hotline Hardware Environment Mapping Methods Linkage Package, Mapmaker, Crimap, Map, Pedpack, APM, LIPED, LDB, SIGMA
70 GCG (~130 programs) EGCG In-house developments - own programs - automated tasks EMBOSS (~150 programs) HUSAR Program Package Third-party Programs (~150 programs) DATABASES - >300 - Prompt updates (daily, weekly) SRS (Sequence Retrieval System)
71
72 Number of analysis programs is huge and must be combined for many purposes. Users need compact presentable reports on analysis results, especially for high throughput analysis
73
74 !" mapping in the human genome exhaustive gene structure analysis extraction of most recent annotation information merging with precomputed data from the NCBI pipeline
75 #$$!"
76 %&
77 '%! % %(' "!#$ % % & ' ( & % ) ) &) * + ' +, -
78 )$% (%"
79 %"*$"$% %%"%" %%% (%
80 +$("! "!#! $% &'! heidelberg.de
GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,
More informationThis place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.
G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationMotivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
More information3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome
Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationChapter 10 Genetic Engineering: A Revolution in Molecular Biology
Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical
More informationGenome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
More informationMolecular Evolution. Lectures Papers Lab. Dr. Walter Salzburger. Structure of the course: Structure i
Dr. Walter Salzburger Molecular Evolution Herbstsemester 2008 Freitag 13:15-15 Uhr 2 Kreditpunkte Structure i Structure of the course: The Nature of Molecular Evolution Molecules as Documents of Evolutionary
More informationTIGR THE INSTITUTE FOR GENOMIC RESEARCH
Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,
More informationTranscriptomics. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona
Transcriptomics Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Central dogma of molecular biology Central dogma of molecular biology Genome Complete DNA content of
More informationEECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science
EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can
More informationCAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1
CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing
More informationCHAPTER 21 LECTURE SLIDES
CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More informationKlinisk kemisk diagnostik BIOINFORMATICS
Klinisk kemisk diagnostik - 2017 BIOINFORMATICS What is bioinformatics? Bioinformatics: Research, development, or application of computational tools and approaches for expanding the use of biological,
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationConcepts of Genetics, 10e (Klug/Cummings/Spencer/Palladino) Chapter 1 Introduction to Genetics
1 Concepts of Genetics, 10e (Klug/Cummings/Spencer/Palladino) Chapter 1 Introduction to Genetics 1) What is the name of the company or institution that has access to the health, genealogical, and genetic
More informationChapter 1. from genomics to proteomics Ⅱ
Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more
More informationBiology 644: Bioinformatics
Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....
More informationBiotechnology and DNA Technology
11/27/2017 PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College CHAPTER 9 Biotechnology and DNA Technology Introduction to Biotechnology Learning Objectives Compare
More informationComputational gene finding
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
More informationAGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1
AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 - Genetics: Progress from Mendel to DNA: Gregor Mendel, in the mid 19 th century provided the
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 February 15, 2013 Multiple choice questions (numbers in brackets indicate the number of correct answers) 1. Which of the following statements are not true Transcriptomes consist of mrnas Proteomes consist
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More informationSGN-6106 Computational Systems Biology I
SGN-6106 Computational Systems Biology I A View of Modern Measurement Systems in Cell Biology Kaisa-Leena Taattola 21.2.2007 1 The cell a complex system (Source: Lehninger Principles of Biochemistry 4th
More informationGenomes: What we know and what we don t know
Genomes: What we know and what we don t know Complete draft sequence 2001 October 15, 2007 Dr. Stefan Maas, BioS Lehigh U. What we know Raw genome data The range of genome sizes in the animal & plant kingdoms!
More informationHigh-throughput Transcriptome analysis
High-throughput Transcriptome analysis CAGE and beyond Dr. Rimantas Kodzius, Singapore, A*STAR, IMCB rkodzius@imcb.a-star.edu.sg for KAUST 2008 Agenda 1. Current research - PhD work on discovery of new
More informationThe Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica
The Ensembl Database Dott.ssa Inga Prokopenko Corso di Genomica 1 www.ensembl.org Lecture 7.1 2 What is Ensembl? Public annotation of mammalian and other genomes Open source software Relational database
More informationBENG 183 Trey Ideker. Genome Assembly and Physical Mapping
BENG 183 Trey Ideker Genome Assembly and Physical Mapping Reasons for sequencing Complete genome sequencing!!! Resequencing (Confirmatory) E.g., short regions containing single nucleotide polymorphisms
More informationIntroduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph
Introduction to Plant Genomics and Online Resources Manish Raizada University of Guelph Genomics Glossary http://www.genomenewsnetwork.org/articles/06_00/sequence_primer.shtml Annotation Adding pertinent
More informationIntroduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks
Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional
More informationComplete draft sequence 2001
Genomes: What we know and what we don t know Complete draft sequence 2001 November11, 2009 Dr. Stefan Maas, BioS Lehigh U. What we know Raw genome data The range of genome sizes in the animal & plant kingdoms
More informationGene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis
Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods
More informationComputational Genomics. Irit Gat-Viks & Ron Shamir & Haim Wolfson Fall
Computational Genomics Irit Gat-Viks & Ron Shamir & Haim Wolfson Fall 2015-16 1 What s in class this week Motivation Administrata Some very basic biology Some very basic biotechnology Examples of our type
More informationAP Biology
Advanced Techniques Electrophoresis & RFLPs Gel Electrophoresis Separation of DNA fragments by size DNA is negatively charged moves toward + charge in electrical field agarose gel swimming through Jello
More informationDay 3. Examine gels from PCR. Learn about more molecular methods in microbial ecology
Day 3 Examine gels from PCR Learn about more molecular methods in microbial ecology Genes We Targeted 1: dsrab 1800bp 2: mcra 750bp 3: Bacteria 1450bp 4: Archaea 950bp 5: Archaea + 950bp 6: Negative control
More informationBranches of Genetics
Branches of Genetics 1. Transmission genetics Classical genetics or Mendelian genetics 2. Molecular genetics chromosomes, DNA, regulation of gene expression recombinant DNA, biotechnology, bioinformatics,
More informationDiscovering gene regulatory control using ChIP-chip and ChIP-seq. Part 1. An introduction to gene regulatory control, concepts and methodologies
Discovering gene regulatory control using ChIP-chip and ChIP-seq Part 1 An introduction to gene regulatory control, concepts and methodologies Ian Simpson ian.simpson@.ed.ac.uk http://bit.ly/bio2links
More informationIntroduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
More informationBIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP
Jasper Decuyper BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP MB&C2017 Workshop Bioinformatics for dummies 2 INTRODUCTION Imagine your workspace without the computers Both in research laboratories and in
More informationMachine Learning. HMM applications in computational biology
10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly
More informationCS313 Exercise 1 Cover Page Fall 2017
CS313 Exercise 1 Cover Page Fall 2017 Due by the start of class on Monday, September 18, 2017. Name(s): In the TIME column, please estimate the time you spent on the parts of this exercise. Please try
More informationComputational gene finding
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
More informationLecture 12. Genomics. Mapping. Definition Species sequencing ESTs. Why? Types of mapping Markers p & Types
Lecture 12 Reading Lecture 12: p. 335-338, 346-353 Lecture 13: p. 358-371 Genomics Definition Species sequencing ESTs Mapping Why? Types of mapping Markers p.335-338 & 346-353 Types 222 omics Interpreting
More informationAnswer: Sequence overlap is required to align the sequenced segments relative to each other.
14 Genomes and Genomics WORKING WITH THE FIGURES 1. Based on Figure 14-2, why must the DNA fragments sequenced overlap in order to obtain a genome sequence? Answer: Sequence overlap is required to align
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary
More informationResearch techniques in genetics. Medical genetics, 2017.
Research techniques in genetics Medical genetics, 2017. Techniques in Genetics Cloning (genetic recombination or engineering ) Genome editing tools: - Production of Knock-out and transgenic mice - CRISPR
More informationFrom Proteomics to Systems Biology. Integration of omics - information
From Proteomics to Systems Biology Integration of omics - information Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - data What
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationDiscovering gene regulatory control using ChIP-chip and ChIP-seq. An introduction to gene regulatory control, concepts and methodologies
Discovering gene regulatory control using ChIP-chip and ChIP-seq An introduction to gene regulatory control, concepts and methodologies Ian Simpson ian.simpson@.ed.ac.uk bit.ly/bio2_2012 The Central Dogma
More informationPLNT2530 (2018) Unit 6b Sequence Libraries
PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
More informationDESIGNER GENES - BIOTECHNOLOGY
DESIGNER GENES - BIOTECHNOLOGY Technology to manipulate DNA techniques often called genetic engineering or Recombinant DNA Technology-Technology used to manipulate DNA Procedures often called genetic engineering
More informationTwo Mark question and Answers
1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three
More informationProteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125
Proteomics Manickam Sugumaran Department of Biology University of Massachusetts Boston, MA 02125 Genomic studies produced more than 75,000 potential gene sequence targets. (The number may be even higher
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationData Mining for Biological Data Analysis
Data Mining for Biological Data Analysis Data Mining and Text Mining (UIC 583 @ Politecnico di Milano) References Data Mining Course by Gregory-Platesky Shapiro available at www.kdnuggets.com Jiawei Han
More informationBioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationStudying the Human Genome. Lesson Overview. Lesson Overview Studying the Human Genome
Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful
More information11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11
Proteomics, functional genomics, and systems biology Biosciences 741: Genomics Fall, 2013 Week 11 1 Figure 6.1 The future of genomics Functional Genomics The field of functional genomics represents the
More information2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?
2/5/16 DNA sequencing, Transcriptomics and Genomics Honeypot Ants "nequacatl" BY2208, Mani Lecture 3 Gene sequence changes? And/or gene expression changes? gene expression differences DNA sequencing, Transcriptomics
More informationIntroduction to 'Omics and Bioinformatics
Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current
More informationBi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8
Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically
More informationChapter 5. Structural Genomics
Chapter 5. Structural Genomics Contents 5. Structural Genomics 5.1. DNA Sequencing Strategies 5.1.1. Map-based Strategies 5.1.2. Whole Genome Shotgun Sequencing 5.2. Genome Annotation 5.2.1. Using Bioinformatic
More informationBiosc10 schedule reminders
Biosc10 schedule reminders Review of molecular biology basics DNA Is each person s DNA the same, or unique? What does DNA look like? What are the three parts of each DNA nucleotide Which DNA bases pair,
More informationIntroduction to Molecular Biology
Introduction to Molecular Biology Bioinformatics: Issues and Algorithms CSE 308-408 Fall 2007 Lecture 2-1- Important points to remember We will study: Problems from bioinformatics. Algorithms used to solve
More informationIntroduction to Bioinformatics and Gene Expression Technology
Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA
More informationIntroduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the
Introduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the Gene Genetic Analysis Molecular Foundations of Genetics
More informationFollowing text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005
Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of
More informationOutline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information
From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class
More informationThe Biotechnology Toolbox
Chapter 15 The Biotechnology Toolbox Cutting and Pasting DNA Cutting DNA Restriction endonuclease or restriction enzymes Cellular protection mechanism for infected foreign DNA Recognition and cutting specific
More informationManipulating genes and cells (Kap. 10)
Manipulating genes and cells (Kap. 10) restriction enzymes and agarose gel electrophoresis DNA sequencing nucleic acid hybridization techniques genomic and cdna libraries cloning of DNA PCR and PCR applications
More informationComputational Genomics. Ron Shamir & Roded Sharan Fall
Computational Genomics Ron Shamir & Roded Sharan Fall 2012-13 Bioinformatics The information science of biology: organize, store, analyze and visualize biological data Responds to the explosion of biological
More informationCHAPTERS 16 & 17: DNA Technology
CHAPTERS 16 & 17: DNA Technology 1. What is the function of restriction enzymes in bacteria? 2. How do bacteria protect their DNA from the effects of the restriction enzymes? 3. How do biologists make
More informationCHAPTER 21 GENOMES AND THEIR EVOLUTION
GENETICS DATE CHAPTER 21 GENOMES AND THEIR EVOLUTION COURSE 213 AP BIOLOGY 1 Comparisons of genomes provide information about the evolutionary history of genes and taxonomic groups Genomics - study of
More informationCourse Information. Introduction to Algorithms in Computational Biology Lecture 1. Relations to Some Other Courses
Course Information Introduction to Algorithms in Computational Biology Lecture 1 Meetings: Lecture, by Dan Geiger: Mondays 16:30 18:30, Taub 4. Tutorial, by Ydo Wexler: Tuesdays 10:30 11:30, Taub 2. Grade:
More informationMARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305
MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305 UNIT-1 MARINE GENOMICS AND PROTEOMICS 1. Define genomics? 2. Scope and functional genomics? 3. What is Genetics? 4. Define functional genomics? 5. What
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationArray-Ready Oligo Set for the Rat Genome Version 3.0
Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.
More informationComputational Genomics
Computational Genomics Introduction to cell biology, genomics, development, and probability Eric Xing Lecture 1a, January 18, 2007 Reading: Chap. 1, DTM book Introduction to cell biology, functional genomics,
More informationExpressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes
Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional
More informationGenetics and Bioinformatics
Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s
More informationMoc/Bio and Nano/Micro Lee and Stowell
Moc/Bio and Nano/Micro Lee and Stowell Moc/Bio-Lecture GeneChips Reading material http://www.gene-chips.com/ http://trueforce.com/lab_automation/dna_microa rrays_industry.htm http://www.affymetrix.com/technology/index.affx
More informationIntroduction to Genome Biology
Introduction to Genome Biology Sandrine Dudoit, Wolfgang Huber, Robert Gentleman Bioconductor Short Course 2006 Copyright 2006, all rights reserved Outline Cells, chromosomes, and cell division DNA structure
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More information21.5 The "Omics" Revolution Has Created a New Era of Biological Research
21.5 The "Omics" Revolution Has Created a New Era of Biological Research 1 Section 21.5 Areas of biological research having an "omics" connection are continually developing These include proteomics, metabolomics,
More informationBiotechnolog y and DNA Technology
PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College C H A P T E R 9 Biotechnolog y and DNA Technology Introduction to Biotechnology Biotechnology: the use of microorganisms,
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map
More informationBasics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility
2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,
More informationIntroduction to Algorithms in Computational Biology Lecture 1
Introduction to Algorithms in Computational Biology Lecture 1 Background Readings: The first three chapters (pages 1-31) in Genetics in Medicine, Nussbaum et al., 2001. This class has been edited from
More informationBIOTECHNOLOGY. Biotechnology is the process by which living organisms are used to create new products THE ORGANISMS
BIOTECHNOLOGY Biotechnology is the process by which living organisms are used to create new products THE ORGANISMS Bacteria: are prokaryotic organisms that contain circular DNA and no organelles. They
More informationGENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.
Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two
More informationAfter the draft sequence, what next for the Human Genome Mapping Project Resource Centre?
Comparative and Functional Genomics Comp Funct Genom 2001; 2: 176 179. DOI: 10.1002 / cfg.83 Interview: Duncan Campbell After the draft sequence, what next for the Human Genome Mapping Project Resource
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationGene Identification in silico
Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction
More information