Methoden zur Analyse von Transkriptionsfaktoren. Seminar: BCII, Lausen

Transcription

1 Methoden zur Analyse von Transkriptionsfaktoren Seminar: BCII, Lausen

2 Gene expression: from transcription to translation Orphanides G, Reinberg D.Cell Feb 22;108(4):

3 Schematic of a gene regulatory region Promoter - Core promoter - Proximal promoter elements Distal Regulatory Elements - Silencer - Enhancer - Insulator - Locus control region

4 Gene regulation is more complex in higher organisms Yeast 300 TF 6000 Genes Drosophila 1000 TF Genes C.elegans 1000 TF Genes Human 3000 TF Genes Yeast Enhancer are rare Drosophila Several Enhancers/Gene Levine and Tijan, Nature 424, 2003

5 The eukaryotic transcriptional machinery Core Promoter - TATA-box - TFIID complex binds to the TATA box - TSS, Transcription start site PIC, Transcription preinitiation complex - General Transcription Factors (GTF) - The PIC allows only basic transcription Activator (or Repressor) - DNA-binding protein with an AD - Greatly enhances transcription Coactivator (Corepressor) - Has no direct DNA-binding activity

6 Core promoter elements BRE: TFIIB-recognition element (25% of all promoters) TATA: TBP (TFIID) complex binding (15%) Inr: Initiator element (50%) MTE: Motif Ten Element (?) DPE: Downstream Promoter Element (25 %) DCE: Downstream Core Element (?) 25% of all promoters do not have a TATA, Inr, DPE or BRE site

7 Distal transcriptional regulatory elements Enhancers - Increase transcription - Cluster of TFBS - Function independent of their orientation and position - Act cell type specific - DNA-looping model Silencer - Binding sites for repressors Insulator - Can block enhancer promoter communication - Can prevent the spread of repressive chromatin Locus Control Region - Group of regulatory elements - Regulate a single gene or a gene cluster

8

9

10 The ENCODE (ENCyclopedia Of DNA Elements) Project analyses genes and regulatory elements 30 Mb of the human genome (1%) have been selected - regions of up to 2 Mb - presents of characterized genes and elements - availability of comparative sequence data - random choice (50%) The ENCODE members focus on the choosen genomic regions - compare large scale data - focus on a number of cell lines - sequence the ENCODE region of other species - publish results in a comprehensive way 2003 focus on the ENCODE region Develop new methods Now, whole genome analysis!!

11 Functional genomic elements being identified by the ENCODE project Methods used

12

13 Gene specific transcription factors Expressed in the cell where the target gene is expressed They recognize a specific DNA sequence Are often activated by signalling: e.g. phosphorylation, hormones Have or recruit chromatin modifying function: e.g. acetylation Are regulated by: Ligands, Modification, Concentration, DNA-Affinity, Cofactors, Dimerisation

14 The RUNX1 is a cell type specific transcription factor important for hematopoietic stem cell development A diagram of RUNX1 protein with functional domains. RD: Runt domain, AD: transcription activation domain, TE1, TE2 and TE3: subelements within AD, ID: transcription inhibition domain; NLS: nuclear localization signal, NRDBn and NRDBc: negative regulatory region for DNA binding in N-terminal (n) and C-terminal (c). NRHn and NRHc: negative regulatory region for heterodimerization in N-terminal (n) and C-terminal (c). NMTS: nuclear matrix targeting signal. Ito Y. Oncogene May 24;23(24):

15 Identification and Characterisation of Regulatory Elements

16 Identification of regulatory sequences by homology mapping High homology between organisms in coding regions Regulatory Sequences are conserved => Enhancer

17 ACCCTXGXXCCXTGAATTGCAGAXCTGTTGTGTTGGTTTXTGACCATCTGCCCATTCTTCCTGTTATGACAXAGCTTGT CANNTG Conserved E-Box

18 Distribution of binding sites across the genome Jothi et al. Nucleic Acids Research 36(16) , 2008

19 Reporter Gene Assay for the Analysis of Regulatory Elements and Transcription Factor Activity

20 Enhancer/Silencer TF: Transcription factor TF TATA TF binding site TATA TF binding site Enhancer/Silencer Exon1 Intron Luciferase GFP LacZ CAT Exon2

21 Transfection of Reporter Plasmid and TF-Expression Plasmid Transient luciferase reportergene assay TF is expresssed TF activates reporter Reporter gene is expressed Cell extract Measurement of luciferase activity

22 Luciferase reporter assay identifies a transcription factor binding site TATA TF Bindestelle Luciferase Relative Luciferase Activity + TF TATA Luciferase +++ TF TATA Luciferase +

23 Analysis of transcription factor functions by luciferase reportergene assay (examples) TATA Luciferase TATA Luciferase Deletion R=>A TATA Luciferase Mutation CoF TATA Luciferase Co-Expression

24 LacZ reporter is driven by an identified regulatory element that targets LacZ expression to specific tissues Kappel A, Rönicke V, Damert A, Flamme I, Risau W, Breier G. Blood Jun 15;93(12):

25 Analysis of Transcription Factor Binding to DNA

26 Oligopulldown biotinylated oligo lysate TF TF Strp pcdna3 Tal1 Ε47 Ε47 + Tal1 α-flag streptavidin beads SDS-PAGE Ab against TF

27 Bandshift Assay, Gelshift EMSA: Electrophoretic mobility shift assay Aims Sequence spezific binding of TF Identification of binding sequence for a TF Identification of a TF that binds to a sequence Characterisation of TF Material Native Polyacrylamid Gel Radioactiv labeled oligonucleotid Nuclear extracts oder purified TF (Antibody)

28 Examples for the use of the EMSA method super shift shift Competition with cold Oligo Lausen et al. Nucleic Acids Research 28(2) , 2000

29 Chromatin Immunoprecipitation Analysis of in vivo TF binding on DNA Binding to a known region of genomic DNA PCR Binding to an unknown DNA sequence Cloning DNA-Array ChIP-sequencing

30 Direct cloning Sequencing Massie CE, Mills IG. ChIPping away at gene regulation. EMBO Rep Apr;9(4):

31 Detection of transcription factor binding to a known genomic region by ChIP PCR Primer P Primer US 1. Tube with Input DNA 2. Tube with DNA ChIPd with control-antibody 3. Tube with DNA ChIPd with TF-Antibody Enhancer/Silencer TF Enhancer/Silencer TATA Exon1 Intron Exon2 Primer Pair US Primer Pair P

32 ChIP on Chip Bioinformatic Bulyka, Current Opinion in Biotechnology Volume 17, Issue 4,