Nature Genetics: doi: /ng.3556 INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE. Supplementary Figure 1
|
|
|
- Horace Stafford
- 5 years ago
- Views:
Transcription
1 INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE Supplementary Figure 1 REF6 expression in transgenic lines. (a,b) Expression of REF6 in REF6-HA ref6 and REF6ΔZnF-HA ref6 plants detected by RT qpcr (a) and immunoblot (b). Gene expression was normalized to that of the control gene TUBULIN2 (AT5G62960). RT-qPCR was performed with four technical replicates. Data are shown as means ± s.e. (n = 4). LHP1 was used as the loading control for the immunoblot. (c) pref6::ref6δznf- HA cannot rescue the short-petiole phenotypes of ref6 mutants. Scale bar, 1 cm. 1
2 Supplementary Figure 2 H3K27me3 hypermethylation in REF6ΔZnF-HA ref6 is similar to that in ref6. (a) Number of genes showing H3K27me3 hypermethylation in ref6 and REF6ΔZnF-HA ref6 plants. (b) Diagram showing the comparison of H3K27me3-hypermethylated genes in ref6-1 and ref6-3 (ref. 1). The greater number of H3K27me3-hypermethylated genes called in ref6-1 compared to ref6-3 is mainly due to greater sequencing depth in ChIP-seq experiments. (c) Density profile of H3K27me3 in 1,000 randomly selected genes. The H3K27me3 signal was summarized in fixed 1-kb regions around the transcriptional start site (TSS), transcriptional termination site (TTS), and center of the gene. 2
3 Supplementary Figure 3 The C2H2-ZnF domains are dispensable for the H3K27me3 and H3K27me2 demethylase activity of REF6. (a) Overexpression of REF6ΔZnF-YFP-HA reduced the levels of H3K27me3 and H3K27me2 in vivo. REF6ΔZnF-YFP-HA fusion protein was transiently expressed in tobacco, and nuclei were isolated for immunostaining. More than 25 pairs of non-transfected nuclei versus transfected nuclei in the same field of view were analyzed. Arrows indicate transfected nuclei. Scale bars, 2 m. (b) Quantitative analysis of a. Data are shown as means ± s.e. (n = 20). WT, wild type (non-transfected nuclei). (c) REF6ΔZnFox plants showed similar phenotypes to REF6ox plants. The plants showed upward-curling leaves with deeper serrations in the margin, early flowering, and terminal flower phenotypes of various degrees. Scale bar, 1 cm. (d) Activation of Polycomb target genes in REF6ΔZnFox plants. Expression of Polycomb target genes was analyzed by RT qpcr. Gene expression is normalized to that of the control gene TUBULIN2 (AT5G62960). RT-qPCR was performed with four technical replicates. Data are shown as means ± s.e. (n = 4). (e) H3K27me3 and H3K27me2 levels are reduced in REF6ΔZnFox plants. H3 lysine methylation status is shown in two REF6ΔZnFox lines and one REF6ox line as detected by immunoblotting with the antibodies specified on the right. Immunoblotting with antibody to H3 showed equal loading. 3
4 Supplementary Figure 4 REF6 direct targets identified by ChIP-seq with antibody to HA. (a) Density profile of REF6 binding signals in 1,000 randomly selected genes. REF6 binding signal was summarized in fixed 1-kb regions around the transcriptional start site (TSS), transcriptional termination site (TTS), and center of the gene. (b) Number of genes showing enrichment in REF6-HA ref6 and REF6ΔZnF-HA ref6 plants by ChIP-seq using antibody to HA. 4
5 Supplementary Figure 5 Genome Browser view of ChIP-seq data and ChIP qpcr validation. (a,b) ChIP-seq data and ChIP qpcr validation for NAC004 (a) and SUS3 (b) loci. ChIP qpcr used another biological replicate of samples. Data from ChIP qpcr analysis are shown as assay-site fold enrichment of the signal from immunoprecipitation over the background. Col was used as the negative-control sample. ChIP qpcr was performed with four technical replicates. Data are shown as means ± s.e. (n = 4). (c,d) ChIP-seq data at another two genes, HB23 (AT1G26960) (c) and CER3 (AT5G57800) (d). Regions validated by ChIP qpcr in a and b are marked by black lines on top of the gene model. The locations of CTCTGYTY motifs are indicated by blue bars above the gene models. NA, not analyzed. 5
6 Supplementary Figure 6 EMSA showing that the CTCTGYTY motif but not the flanking sequence is important for protein DNA interaction. (a,d) Sequences of 50-bp DNA fragments of the NAC04 (a) and CUC1 (d) loci, containing one and two CTCTGTTT motifs, respectively, and their mutant versions used in b, c, and e. WT, wild type. (b) The flanking sequence has minimal effect on DNA protein interaction. (c) GST-REF6C interacts with probes containing the other three variants of the CTCTGYTY motif. (e) EMSA showing that one CTCTGTTT motif is sufficient for DNA protein interaction. 6
7 Supplementary Figure 7 Occupancy profiles of REF6 binding and hypermethylated H3K27me3 sites around peak summits in response to the number of motifs within REF6 binding peaks. 7
8 Supplementary Figure 8 REF6 binds CUC1 and CUC3 in shoot apical tissues. (a,b) The CTCTGYTY motifs at the CUC1 (a) and CUC3 (b) loci. The numbers indicate base positions from the TSS. The motifs in the sense strand are labeled in red, and the motifs in the anti-sense strand are labeled in blue. Nucleotides in exons and introns are shown in uppercase and lowercase letters, respectively. Nucleotides in qpcr-detected regions are shown in bold letters. (c,d,f) In shoot apical tissues (Online Methods), HA ChIP qpcr (c) and RT qpcr (d,f) showed that REF6 binds CUC3 but does not affect the transcript level of CUC3. (e) Transcript levels of CUC2 and CUC3 are not changed in ref6 mutants (14-d-old seedlings). Data from ChIP qpcr analysis are shown as assay-site fold enrichment of the signal from immunoprecipitation over the background. Col was used as the negative control. Gene expression is normalized to that of the control gene ACTIN7 (AT5G09810). ChIP qpcr and RT-qPCR were performed with four technical replicates. Data are shown as means ± s.e. (n = 4). NA, not analyzed. 8
9 Supplementary Figure 9 Phenotype of ref6 cuc double and triple mutants. Representative 10-d-old seedlings with different phenotypes are shown. Scale bars, 2 mm. 9
10 Supplementary Figure 10 Role of the CTCTGYTY motif and chromatin states in REF6 targeting to activate gene expression through H3K27me3 demethylation. REF6 binds the CTCTGYTY motif through the C2H2-ZnF cluster and removes local H3K27me3 methylation. Genes containing clusters of CTCTGYTY motifs recruit REF6 more efficiently (top), whereas motifs in heterochromatic regions cannot recruit REF6 (bottom). 10
11 Supplementary Figure 11 Phylogenetic tree of REF6 homologs in plants. The phylogenetic tree was constructed with MEGA (ver.5.05) 44 using the neighbor-joining method. The red branches mark the monocot species, and the blue branches mark the eudicots. Amborella trichopoda is the most basal lineage in the clade of angiosperms ( basal angiosperms ) 30. Selaginella moellendorffii and Physcomitrella patens are outgroups. 11
12 Supplementary Table 1 Summary of ChIP-seq data. Sample Total Reads a Reads b Mapped Non-redundant Reads c Mapping Efficiency d H3K27me3_Col 14,005,936 11,253,367 10,316, % H3K27me3_ref6 17,250,561 13,446,060 12,450, % H3K27me3_REF6-HA 14,816,713 8,155,438 7,439, % H3K27me3_REF6ΔZnF-HA 15,562,578 11,737,957 10,678, % HA_Col 14,031,577 7,507,410 6,181, % HA_REF6-HA 13,853,992 8,363,558 7,045, % HA_REF6ΔZnF-HA 15,560,496 8,852,790 7,325, % H3K9me2_Col 7,023,152 4,057,830 2,326, % a Number of raw reads; b Number of reads successfully mapped to TAIR10 genome with Bowtie2; c Number of reads after filtering out of duplicated reads which might be from PCR duplication; d Mapping efficiency of mapped reads in total reads.
Nature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.
Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray
Supplemental Data. Zhou et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Confirmation of mutant mapping results. (A) Complementation assay with stably transformed genomic fragments (ComN-N) (2 kb upstream of TSS and 1.5 kb downstream of TES) and CaMV
Supplemental Data. Sethi et al. (2014). Plant Cell /tpc
Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes
Supplemental Figure 1.
Supplemental Data. Charron et al. Dynamic landscapes of four histone modifications during de-etiolation in Arabidopsis. Plant Cell (2009). 10.1105/tpc.109.066845 Supplemental Figure 1. Immunodetection
Nature Genetics: doi: /ng Supplementary Figure 1. High-confidence PRC2 targets and candidate PREs.
Supplementary Figure 1 High-confidence PRC2 targets and candidate PREs. (a) Flowchart for identification of candidate Arabidopsis PREs. We identified 1504 genomic regions marked by at least 3 of the following:
Supplementary Information
Supplementary Information MED18 interaction with distinct transcription factors regulates plant immunity, flowering time and responses to hormones Supplementary Figure 1. Diagram showing T-DNA insertion
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Validation of CDK9-inhibitor treatment.
Supplementary Figure 1 Validation of CDK9-inhibitor treatment. (a) Schematic of GAPDH with the middle of the amplicons indicated in base pairs. The transcription start site (TSS) and the terminal polyadenylation
SUPPLEMENTARY INFORMATION
AS-NMD modulates FLM-dependent thermosensory flowering response in Arabidopsis NATURE PLANTS www.nature.com/natureplants 1 Supplementary Figure 1. Genomic sequence of FLM along with the splice sites. Sequencing
Supplemental Data. Na Xu et al. (2016). Plant Cell /tpc
Supplemental Figure 1. The weak fluorescence phenotype is not caused by the mutation in At3g60240. (A) A mutation mapped to the gene At3g60240. Map-based cloning strategy was used to map the mutated site
Supplemental Data. Farmer et al. (2010) Plant Cell /tpc
Supplemental Figure 1. Amino acid sequence comparison of RAD23 proteins. Identical and similar residues are shown in the black and gray boxes, respectively. Dots denote gaps. The sequence of plant Ub is
Supplemental Figure legends Figure S1. (A) (B) (C) (D) Figure S2. Figure S3. (A-E) Figure S4. Figure S5. (A, C, E, G, I) (B, D, F, H, Figure S6.
Supplemental Figure legends Figure S1. Map-based cloning and complementation testing for ZOP1. (A) ZOP1 was mapped to a ~273-kb interval on Chromosome 1. In the interval, a single-nucleotide G to A substitution
AD BD TOC1. Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between
AD X BD TOC1 AD BD X PIFΔAD PIF TOC1 TOC1 PIFΔAD PIF N TOC1 TOC1 C1 PIFΔAD PIF C1 TOC1 TOC1 C PIFΔAD PIF C TOC1 Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between PIF and TOC1
A Repressor Complex Governs the Integration of
Developmental Cell 15 Supplemental Data A Repressor Complex Governs the Integration of Flowering Signals in Arabidopsis Dan Li, Chang Liu, Lisha Shen, Yang Wu, Hongyan Chen, Masumi Robertson, Chris A.
Supplementary Figure 1 Collision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK2, PPK3 and PPK4 respectively.
Supplementary Figure 1 lision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK, PPK3 and PPK respectively. % of nuclei with signal / field a 5 c ppif3:gus pppk1:gus 0 35 30 5 0 15 10
Flow through. lgg. 7mIPA1-GFP. ChIP-SA rep 1. Flow through. lgg. 7mIPA1-GFP. ChIP-SA rep 2. Flow through. Input. ChIP-YP rep 1.
Supplemental Data. Lu et al. Plant Cell. (213). 1.115/tpc.113.113639 Number of reads A Kd 8 lgg Flow through agfp lgg kb 2. 7mIPA1-GFP 1. B 6 Kd 8 6 Kd 8 agfp agfp lgg agfp lgg Flow through Flow through
Supplemental Data. Guo et al. (2015). Plant Cell /tpc
Supplemental Figure 1. The Mutant exb1-d Displayed Pleiotropic Phenotypes and Produced Branches in the Axils of Cotyledons. (A) Branches were developed in exb1-d but not in wild-type plants. (B) and (C)
Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh
Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
Supplemental Data. Jing et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Characterization of epp1 Mutants. (A) Cotyledon angles of 5-d-old Col wild-type (gray bars) and epp1-1 (black bars) seedlings under red (R), far-red (FR) and blue (BL) light conditions,
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Ihh interacts preferentially with its upstream neighboring gene Nhej1. Genes are indicated by gray lines, and Ihh and Nhej1 are highlighted in blue. 4C seq performed in E14.5 limbs
A Naturally Occurring Epiallele associates with Leaf Senescence and Local Climate Adaptation in Arabidopsis accessions He et al.
A Naturally Occurring Epiallele associates with Leaf Senescence and Local Climate Adaptation in Arabidopsis accessions He et al. Supplementary Notes Origin of NMR19 elements Because there are two copies
Supplementary Tables. Primers and probes. Target Primer / probe sequences Chemistry Human HBB F: AACTGTGTTCACTAGCAACCTCAAA
Supplementary Tables Primers and probes Target Primer / probe sequences Chemistry H F: AACTGTGTTCACTAGCAACCTCAAA promoter R: ACAGGGCAGTAACGGCAGACT H Downstream Actb alpha (162) alpha (162.) (Pro) (16)
Zhang et al., RepID facilitates replication Initiation. Supplemental Information:
Supplemental Information: a b 1 Supplementary Figure 1 (a) DNA sequence of all the oligonucleotides used in this study. Only one strand is shown. The unshaded nucleotide sequences show changes from the
Construction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
Figure S1. nuclear extracts. HeLa cell nuclear extract. Input IgG IP:ORC2 ORC2 ORC2. MCM4 origin. ORC2 occupancy
A nuclear extracts B HeLa cell nuclear extract Figure S1 ORC2 (in kda) 21 132 7 ORC2 Input IgG IP:ORC2 32 ORC C D PRKDC ORC2 occupancy Directed against ORC2 C-terminus (sc-272) MCM origin 2 2 1-1 -1kb
Supplemental Figure 1
Supplemental Figure 1 A gta2-1 gta2-2 1kb AT4G08350 B Col-0 gta2-1 LP+RP+LBb1.3 C Col-0 gta2-2 LP+RP+LB1 D Col-0 gta2-2 gta2-1 GTA2 TUBLIN E Col0 gta2-1 gta2-2 Supplemental Figure 1. Phenotypic analysis
SUPPLEMENTARY INFORMATION
doi:10.1038/nature09861 & &' -(' ()*+ ')(+,,(','-*+,&,,+ ',+' ' 23,45/0*6787*9:./09 ;78?4?@*+A786?B- &' )*+*(,-* -(' ()*+ ')(+,,(','-*+,&,,+ ',+'./)*+*(,-*..)*+*(,-*./)*+*(,-*.0)*+*(,-*..)*+*(,-*
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
Supplementary Information
Supplementary Information Supplementary Fig. 1. Seed dormancy and germination responses of RVE1 and PIF1. (a) Diagram of RVE1 and the T-DNA insertion of the rve1-2 mutant (SAIL_326_A01). Black boxes represent
Activation of a Floral Homeotic Gene in Arabidopsis
Activation of a Floral Homeotic Gene in Arabidopsis By Maximiliam A. Busch, Kirsten Bomblies, and Detlef Weigel Presentation by Lis Garrett and Andrea Stevenson http://ucsdnews.ucsd.edu/archive/graphics/images/image5.jpg
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity.
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity. (A) Amino acid alignment of HDA5, HDA15 and HDA18. The blue line
Supplemental Data. Bai et al. Plant Cell. (2012) /tpc A
A B Unconserved Conserved AIF4 AIF2 AIF3 AIF1 UPB1 IBH1 Supplemental Figure 1. IBH1, UPB1 and AIFs belong to the same HLH family. (A), Part of a phylogenetic tree constructed using conserved domains shows
BS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
6/256 1/256 0/256 1/256 2/256 7/256 10/256. At3g06290 (SAC3B)
Chr.III M 5M 1M 15M 2M 23M BAC clones F22F7 F1A16 F24F17 F24P17 T8E24 F17A9 F21O3 F17A17 F18C1 F2O1 F28L1 F5E6 F3E22 T1B9 MLP3 Number of recombinants 6/256 1/256 /256 1/256 2/256 7/256 1/256 At3g629 (SAC3B)
Supplemental Data. Liu et al. (2013). Plant Cell /tpc
Supplemental Figure 1. The GFP Tag Does Not Disturb the Physiological Functions of WDL3. (A) RT-PCR analysis of WDL3 expression in wild-type, WDL3-GFP, and WDL3 (without the GFP tag) transgenic seedlings.
Supplementary Table 1: Oligo designs. A list of ATAC-seq oligos used for PCR.
Ad1_noMX: Ad2.1_TAAGGCGA Ad2.2_CGTACTAG Ad2.3_AGGCAGAA Ad2.4_TCCTGAGC Ad2.5_GGACTCCT Ad2.6_TAGGCATG Ad2.7_CTCTCTAC Ad2.8_CAGAGAGG Ad2.9_GCTACGCT Ad2.10_CGAGGCTG Ad2.11_AAGAGGCA Ad2.12_GTAGAGGA Ad2.13_GTCGTGAT
Fig. S1. TPL and TPL N176H protein interactions. (A) Semi-in vivo pull-down assays using recombinant GST N-TPL and GST N-TPL N176H fusions and
Fig. S1. TPL and TPL N176H protein interactions. (A) Semi-in vivo pull-down assays using recombinant GST N-TPL and GST N-TPL N176H fusions and transgenic Arabidopsis TPL-HA lysates. Immunoblotting of input
Fig. S1. Clustering analysis of expression array and ChIP-PCR assay in the ARF3 locus. (A) Typical examples of the transgenic plants used for
Fig. S1. Clustering analysis of expression array and ChIP-PCR assay in the ARF3 locus. (A) Typical examples of the transgenic plants used for ChIP-chip and ChIP-PCR assays. The presence of pas1:t7:as1
(phosphatase tensin) domain is shown in dark gray, the FH1 domain in black, and the
Supplemental Figure 1. Predicted Domain Organization of the AFH14 Protein. (A) Schematic representation of the predicted domain organization of AFH14. The PTEN (phosphatase tensin) domain is shown in dark
Supplemental Data. Cui et al. (2012). Plant Cell /tpc a b c d. Stem UBC32 ACTIN
A Root Stem Leaf Flower Silique Senescence leaf B a b c d UBC32 ACTIN C * Supplemental Figure 1. Expression Pattern and Protein Sequence of UBC32 Homologues in Yeast, Human, and Arabidopsis. (A) Expression
Supplementary Figure Legends
Supplementary Figure Legends Figure S1 gene targeting strategy for disruption of chicken gene, related to Figure 1 (f)-(i). (a) The locus and the targeting constructs showing HpaI restriction sites. The
SUPPLEMENTARY INFORMATION
Gene replacements and insertions in rice by intron targeting using CRISPR Cas9 Table of Contents Supplementary Figure 1. sgrna-induced targeted mutations in the OsEPSPS gene in rice protoplasts. Supplementary
Fig. S1. Molecular phylogenetic analysis of AtHD-ZIP IV family. A phylogenetic tree was constructed using Bayesian analysis with Markov Chain Monte
Fig. S1. Molecular phylogenetic analysis of AtHD-ZIP IV family. A phylogenetic tree was constructed using Bayesian analysis with Markov Chain Monte Carlo algorithm for one million generations to obtain
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10928 Materials and Methods 1. Plant material and growth conditions. All plant lines used were in Col-0 background unless otherwise specified. pif4-101 mutant
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11070 Supplementary Figure 1 Purification of FLAG-tagged proteins. a, Purification of FLAG-RNF12 by FLAG-affinity from nuclear extracts of wild-type (WT) and two FLAG- RNF12 transgenic
Supplemental Data. Polycomb Silencing of KNOX Genes Confines. Shoot Stem Cell Niches in Arabidopsis Current Biology, Volume 18
Supplemental Data Polycomb Silencing of KNOX Genes Confines Shoot Stem Cell Niches in Arabidopsis Lin Xu and Wen-Hui Shen - 1 - Figure S1. Phylogram of RING1, BMI1 and RAD18 homologues in several organisms
Supplementary Information. Supplementary Figure S1. Phenotypic comparison of the wild type and mutants.
Supplementary Information Supplementary Figure S1. Phenotypic comparison of the wild type and mutants. Supplementary Figure S2. Transverse sections of anthers. Supplementary Figure S3. DAPI staining and
Supporting Information
Supporting Information Park et al. 10.1073/pnas.1410555111 5 -TCAAGTCCATCTACATGGCC-3 5 -CAGCTGCCCGGCTACTACTA-3 5 -TGCAGCTGCCCGGCTACTAC-3 5 -AAGCTGGACATCACCTCCCA-3 5 -TGACAGGAACACCTACAAGT-3 5 -AAGGCACCTTTCTGTCTCCA-3
Galaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory http://collaboratory.lifesci.ucla.edu Workshop Outline ü Day 1 UCLA galaxy
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Endogenous gene tagging to study subcellular localization and chromatin binding. a, b, Schematic of experimental set-up to endogenously tag RNAi factors using the CRISPR Cas9 technology,
Abcam.com. hutton.ac.uk. Ipmdss.dk. Bo Gong and Eva Chou
Abcam.com Bo Gong and Eva Chou Ipmdss.dk hutton.ac.uk What is a homeotic gene? A gene which regulates the developmental fate of anatomical structures in an organism Why study them? Understand the underlying
TECH NOTE Ligation-Free ChIP-Seq Library Preparation
TECH NOTE Ligation-Free ChIP-Seq Library Preparation The DNA SMART ChIP-Seq Kit Ligation-free template switching technology: Minimize sample handling in a single-tube workflow >> Simplified protocol with
Supplementary Fig 1. The responses of ERF109 to different hormones and stresses. (a to k) The induced expression of ERF109 in 7-day-old Arabidopsis
Supplementary Fig 1. The responses of ERF109 to different hormones and stresses. (a to k) The induced expression of ERF109 in 7-day-old Arabidopsis seedlings expressing ERF109pro-GUS. The GUS staining
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Characterization of Hi-C/CHi-C dynamics and enhancer identification. (a) Scatterplot of Hi-C read counts supporting contacts between domain boundaries. Contacts enclosing domains
Suppl. Table S1. Characteristics of DHS regions analyzed by bisulfite sequencing. No. CpGs analyzed in the amplicon. Genomic location specificity
Suppl. Table S1. Characteristics of DHS regions analyzed by bisulfite sequencing. DHS/GRE Genomic location Tissue specificity DHS type CpG density (per 100 bp) No. CpGs analyzed in the amplicon CpG within
Supplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1 shrna mediated knockdown of ZRSR2 in K562 and 293T cells. (a) ZRSR2 transcript levels in stably transduced K562 cells were determined using qrt-pcr. GAPDH was
Applied Bioinformatics - Lecture 16: Transcriptomics
Applied Bioinformatics - Lecture 16: Transcriptomics David Hendrix Oregon State University Feb 15th 2016 Transcriptomics High-throughput Sequencing (deep sequencing) High-throughput sequencing (also
Figure S1 Correlation in size of analogous introns in mouse and teleost Piccolo genes. Mouse intron size was plotted against teleost intron size for t
Figure S1 Correlation in size of analogous introns in mouse and teleost Piccolo genes. Mouse intron size was plotted against teleost intron size for the pcloa genes of zebrafish, green spotted puffer (listed
SUPPLEMENTARY INFORMATION
Supplementary Discussion Interestingly, a recent study demonstrated that knockdown of Tet1 alone would lead to dysregulation of differentiation genes, but only minor defects in ES maintenance and no change
S156AT168AY175A (AAA) were purified as GST-fusion proteins and incubated with GSTfused
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Supplemental Materials Supplemental Figure S1 (a) Phenotype of the wild type and grik1-2 grik2-1 plants after 8 days in darkness.
Schematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
Supplementary Table S1
Primers used in RT-qPCR, ChIP and Bisulphite-Sequencing. Quantitative real-time RT-PCR primers Supplementary Table S1 gene Forward primer sequence Reverse primer sequence Product TRAIL CAACTCCGTCAGCTCGTTAGAAAG
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Seeds of Col-0 were harvested from plants grown at 16 C, stored for 2 months, imbibed for indicated
SUPPLEMENTARY INFORMATION
Ca 2+ /calmodulin Regulates Salicylic Acid-mediated Plant Immunity Liqun Du, Gul S. Ali, Kayla A. Simons, Jingguo Hou, Tianbao Yang, A.S.N. Reddy and B. W. Poovaiah * *To whom correspondence should be
SUPPLEMENTARY INFORMATION
doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8
IDN1 and IDN2: two proteins required for de novo DNA methylation in Arabidopsis thaliana.
IDN1 and IDN2: two proteins required for de novo DNA methylation in Arabidopsis thaliana. Israel Ausin, Todd C. Mockler, Joanne Chory, and Steven E. Jacobsen Col Ler nrpd1a rdr2 dcl3-1 ago4-1 idn1-1 idn2-1
ChampionChIP Quick, High Throughput Chromatin Immunoprecipitation Assay System
ChampionChIP Quick, High Throughput Chromatin Immunoprecipitation Assay System Liyan Pang, Ph.D. Application Scientist 1 Topics to be Covered Introduction What is ChIP-qPCR? Challenges Facing Biological
administration of tamoxifen. Bars show mean ± s.e.m (n=10-11). P-value was determined by
Supplementary Figure 1. Chimerism of CD45.2 + GFP + cells at 1 month post transplantation No significant changes were detected in chimerism of CD45.2 + GFP + cells between recipient mice repopulated with
Alternative Cleavage and Polyadenylation of RNA
Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related
SUPPLEMENTARY INFORMATION
SUPPLEMENTRY INFORMTION DOI:.38/ncb Kdmb locus kb Long isoform Short isoform Long isoform Jmj XX PHD F-box LRR Short isoform XX PHD F-box LRR Target Vector 3xFlag Left H Neo Right H TK LoxP LoxP Kdmb Locus
Supplemental information, Figure S1
Supplemental information, Figure S1 Figure S1 DNA methylation inhibitor 5 AZA treatment released the transcriptional silencing of SUC2 and NPTII transgenes. Related to Figures 1 and 2. (A) DNA methylation
PrimePCR Assay Validation Report
Gene Information Gene Name minichromosome maintenance complex component 8 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID MCM8 Human The protein encoded by
Supplemental Data. Tilbrook et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Protein alignment of with. Identical aligned residues highlighted in black and similar and non-similar residues highlighted in grey and white, respectively. Position of Trp residues
APPLICATION NOTE. Abstract. Introduction
From minuscule amounts to magnificent results: reliable ChIP-seq data from 1, cells with the True MicroChIP and the MicroPlex Library Preparation kits Abstract Diagenode has developed groundbreaking solutions
SUPPLEMENTARY INFORMATION
doi:138/nature10532 a Human b Platypus Density 0.0 0.2 0.4 0.6 0.8 Ensembl protein coding Ensembl lincrna New exons (protein coding) Intergenic multi exonic loci Density 0.0 0.1 0.2 0.3 0.4 0.5 0 5 10
Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and
Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary
Table S1. Primers used in RT-PCR studies (all in 5 to 3 direction)
Table S1. Primers used in RT-PCR studies (all in 5 to 3 direction) Epo Fw CTGTATCATGGACCACCTCGG Epo Rw TGAAGCACAGAAGCTCTTCGG Jak2 Fw ATCTGACCTTTCCATCTGGGG Jak2 Rw TGGTTGGGTGGATACCAGATC Stat5A Fw TTACTGAAGATCAAGCTGGGG
Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95
Supplementary Information Regulation of transcription by the complex and MLL complex-associated Hao Jiang, Xiangdong Lu, Miho Shimada, Yali Dou, Zhanyun Tang, and Robert G. Roeder Input HeLa NE IP lot:
Supplemental Data. Seo et al. (2014). Plant Cell /tpc
Supplemental Figure 1. Protein alignment of ABD1 from other model organisms. The alignment was performed with H. sapiens DCAF8, M. musculus DCAF8 and O. sativa Os10g0544500. The WD40 domains are underlined.
PIE1 ARP6 SWC6 KU70 ARP6 PIE1. HSA SNF2_N HELICc SANT. pie1-3 A1,A2 K1,K2 K1,K3 K3,LB2 A3, A4 A3,LB1 A1,A2 K1,K2 K1,K3. swc6-1 A3,A4.
A B N-terminal SWC2 H2A.Z SWC6 ARP6 PIE1 HSA SNF2_N HELICc SANT C pie1-3 D PIE1 ARP6 5 Kb A1 200 bp A3 A2 LB1 arp6-3 A4 E A1,A2 A3, A4 A3,LB1 K1,K2 K1,K3 K3,LB2 SWC6 swc6-1 A1,A2 A3,A4 K1,K2 K1,K3 100
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
PrimePCR Assay Validation Report
Gene Information Gene Name keratin 78 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT78 Human This gene is a member of the type II keratin gene family
TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals:
TRANSGENIC ANIMALS -transient transfection of cells -stable transfection of cells - Two methods to produce transgenic animals: 1- DNA microinjection - random insertion 2- embryonic stem cell-mediated gene
(a) Scheme depicting the strategy used to generate the ko and conditional alleles. (b) RT-PCR for
Supplementary Figure 1 Generation of Diaph3 ko mice. (a) Scheme depicting the strategy used to generate the ko and conditional alleles. (b) RT-PCR for different regions of Diaph3 mrna from WT, heterozygote
Supplementary Table, Figures and Videos
Supplementary Table, Figures and Videos Table S1. Oligonucleotides used for different approaches. (A) RT-qPCR study. (B) qpcr study after ChIP assay. (C) Probes used for EMSA. Figure S1. Notch activation
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Distribution of mirnas between lncrna and protein-coding genes. Pie chart showing distribution of human mirna between protein coding and lncrna genes. To the right, lncrna mirna
Somatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb
Cell Reports Supplemental Information Somatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb Hirotsugu Ishizu, Yuka W. Iwasaki, Shigeki Hirakata, Haruka Ozaki, Wataru Iwasaki,
Supplemental Figure 1 A
Supplemental Figure 1 A Supplemental Data. Han et al. (2016). Plant Cell 10.1105/tpc.15.00997 BamHI -1616 bp SINE repeats SalI ATG SacI +1653 bp HindIII LB HYG p35s pfwa LUC Tnos RB pfwa-bamhi-f: CGGGATCCCGCCTTTCTCTTCCTCATCTGC
SUPPLEMENTARY INFORMATION
Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers Wataru Sakai, Elizabeth M. Swisher, Beth Y. Karlan, Mukesh K. Agarwal, Jake Higgins, Cynthia Friedman, Emily Villegas,
Supplemental Data. Fan et al. (2014). Plant Cell /tpc
Supplemental Data. Fan et al. (). Plant Cell./tpc.. Cell wall EXP EXP EXP9 HLH/bHLH AIF HFR HBI PAR ABAR Atg778 At3g39 Atg38 Atg3 EXP EXP6 EXP8 Photosynthesis PSAD- PSAD- PSBY PSBO- PSAN LHCB6 PSBS LHCB
supplementary information
DOI: 10.1038/ncb1979 Figure S1 Alignment and domain composition of HsTSN and PaTSN. Since both HsTSN (accession number AAA80488) and PaTSN (accession number CAL38976) have five staphylococcal nuclease
To investigate the heredity of the WFP gene, we selected plants that were homozygous
Supplementary information Supplementary Note ST-12 WFP allele is semi-dominant To investigate the heredity of the WFP gene, we selected plants that were homozygous for chromosome 1 of Nipponbare and heterozygous
Supplemental Data. Zhang et al. (2010). Plant Cell /tpc
Supplemental Figure 1. uvs90 gene cloning The T-DNA insertion in uvs90 was identified using thermal asymmetric interlaced (TAIL)-PCR. Three rounds of amplification were performed; the second (2 nd ) and
Percent survival. Supplementary fig. S3 A.
Supplementary fig. S3 A. B. 100 Percent survival 80 60 40 20 Ml 0 0 100 C. Fig. S3 Comparison of leukaemia incidence rate in the triple targeted chimaeric mice and germline-transmission translocator mice
Epigenetic control of tomato fruit development. Key Laboratories of Molecular Epigenetics of MOE, Northeast Normal University, Changchun, China
Epigenetic control of tomato fruit development Silin Zhong 1,2*,, Zhangjun Fei 1,3,*,, Yun-Ru Chen 1, Yi Zheng 1, Mingyun Huang 1, Julia Vrebalov 1, Ryan McQuinn 1, Nigel Gapper 1, Bao Liu 2, Jenny Xiang
Nature Biotechnology: doi: /nbt Supplementary Figure 1. In vitro validation of OTC sgrnas and donor template.
Supplementary Figure 1 In vitro validation of OTC sgrnas and donor template. (a) In vitro validation of sgrnas targeted to OTC in the MC57G mouse cell line by transient transfection followed by 4-day puromycin
Introduction to genome biology
Introduction to genome biology Lisa Stubbs We ve found most genes; but what about the rest of the genome? Genome size* 12 Mb 95 Mb 170 Mb 1500 Mb 2700 Mb 3200 Mb #coding genes ~7000 ~20000 ~14000 ~26000
Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis
Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods