Analysis Report. Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly
|
|
|
- Bruno Sims
- 6 years ago
- Views:
Transcription
1 Analysis Report Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly 1
2 Table of Contents 1. Result of Whole Genome Assembly 1.1 Subread filtering de novo assembly Genome Annotation Data Download 3.1 Raw Data & Result of Analysis Description of File Extensions Appendix 1. FAQ RS_HGAP_Assembly.3 protocol
3 1. Whole genome assembly 1.1 Subread Filtering Mean Subread length 8,691 N50 12,085 Total Number of Bases 653,628,053 Number of Reads 75,207 3
4 1.2 de novo assembly In order to use only PacBio long reads, softwares such as HCAP, Falcon, and PBcR are used. In this analysis, HGAP2 is used (detailed options are shown in appendix). When each end of contigs is overlapped, contigs are connected to form a circular DNA (finished). When there is no sign of overlapping, there might be a gap in each end (circular gap) Contig Name Length (bp) GC % Circular Gap? Finished? Depth Alias contig1 6,613, No Yes 80 Chromosome Total 6,613,159 Result of Assembly. 1 contig is formed from 8380 sample. 4
5 2. Genome annotation After whole genome or draft genome is analyzed, the locations of protein-coding sequences, trna genes, and rrna genes are identified. Then their functions are annotated. Prokka ( is a pipeline that performs series of process automatically. At the end of the pipeline, Prokka gives GBK file as well as various types of files such as GFF3, SQN Contig Name Bases (bp) Alias CDS trna rrna contig1 6,613,159 Chromosome 6, Total 6,613,159 6, Result of Genome Annotation. 6,056 CDS, 77 trna, 12 rrna genes are discovered 5
6 Circular map chromosome: Marked characteristics are shown from outside to the center: CDS on forward strand, CDS on reverse strand, trna, rrna, GC content and GC skew. 6
7 3. Data Download 3.1 Raw Data & Result of Analysis Description Download link md5sum Raw data of 8380 Download link de17d48571d33c6eebedb83cdb1ef1d2 Assembly of 8380 sample & Result of Genome Annotation Download link f24b96c06cf062ae1fa31afcae8cb49a 3.2 Description of File Extensions File Extension *.fna *.fsa *.txt *.tbl *.gff *.ffn *.faa *.sqn *.gbk Description Whole nucleotide sequence Whole nucleotide sequence (Detailed description) Summary of Genome Annotation Tab Separation Formality of NCBI ( html). GFF3 Format ( Fasta format of CDS nucleotide Fasta format of Amino Acid NCBI's Sequin Format (Edited with Sequin ( Sequin/). GenBank Format ( Can be opened with Artemis 7
8 Appendix 1. Frequently Asked Questions Q: I would like to see the result. How can I open the files? A: The downloaded file is zipped file that has fastq.gz extension. After unzipping the file, the data can be opened with any kind of text editor. However, if you are dealing with big sized data, we recommend using Vim ( or Notepad++ ( Q: How can I see the annotation results? A: Since all the annotation result files are text files, they can be viewed with Vim, Notepad++, Microsoft word, Excel, and any program that can open text files. Q: How can I view annotation gene with sequence at the same time? A: You can view the result by opening.gbk file with Genome browser such as Artemis ( Q: How can I register the analyzed genome to NCBI? A: First you have to sign up for NCBI. Then you can register the genome through Genome (WGC) submission portal ( nlm.nih.gov/subs/wgs/). In case of microorganism, you can use specific genome annotation pipeline provided by NCBI. Q: Is there any other gene annotation pipeline that can be used? A:You can use Prokaryotic Genome Annotation Pipeline (PGAP) ( /annotation_prok/) of NCBI. When registering the genome, you can decide whether you are going to use it or not. Additionally you can request through NCBI. 8
9 2. RS_HGAP_Assembly.3 protocol Protocol: Option Details: Filtering Assembly *At this analysis, the Minimum Seed Read Length adjusted to 2,000. Mapping 9
10 10
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
Gene Prediction Group
Group Ben, Jasreet, Jeff, Jia, Kunal TACCTGAAAAAGCACATAATACTTATGCGTATCCGCCCTAAACACTGCCTTCTTTCTCAA AGAAGATGTCGCCGCTTTTCAACCGAACGATGTGTTCTTCGCCGTTTTCTCGGTAGTGCA TATCGATGATTCACGTTTCGGCAGTGCAGGCACCGGCGCATATTCAGGATACCGGACGCT
European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)
Guideline for the submission of DNA sequences derived from genetically modified organisms and associated annotations within the framework of Directive 2001/18/EC and Regulation (EC) No 1829/2003 European
Bioinformatics Course AA 2017/2018 Tutorial 2
UNIVERSITÀ DEGLI STUDI DI PAVIA - FACOLTÀ DI SCIENZE MM.FF.NN. - LM MOLECULAR BIOLOGY AND GENETICS Bioinformatics Course AA 2017/2018 Tutorial 2 Anna Maria Floriano annamaria.floriano01@universitadipavia.it
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G
![Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G](/thumbs/95/123686269.jpg "Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G")
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of
Prokaryotic Annotation Pipeline SOP HGSC, Baylor College of Medicine
1 Abstract A prokaryotic annotation pipeline was developed to automatically annotate draft and complete bacterial genomes. The protein coding genes in the genomes are predicted by the combination of Glimmer
ELE4120 Bioinformatics. Tutorial 5
ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar
Fast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing:
Fast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing: Patented, Anti-Correlation Technology Provides 99.5% Accuracy & Sensitivity to 5% Variant Knowledge Base and External Annotation
Introduction to DNA-Sequencing
informatics.sydney.edu.au sih.info@sydney.edu.au The Sydney Informatics Hub provides support, training, and advice on research data, analyses and computing. Talk to us about your computing infrastructure,
Gene Prediction: Preliminary Results
Gene Prediction: Preliminary Results Outline Preliminary Pipeline Programs Program Comparison Tests Metrics Gene Prediction Tools: Usage + Results GeneMarkS Glimmer 3.0 Prodigal BLAST ncrna Prediction
From Infection to Genbank
From Infection to Genbank How a pathogenic bacterium gets its genome to NCBI Torsten Seemann VLSCI - Life Sciences Computation Centre - Genomics Theme - Lab Meeting - Friday 27 April 2012 The steps 1.
What will be covered?
What will be covered? 1. Annotation overview 2. Using the RAST family for genome annotation: Optimizing RAST for phages Command line/ Batch options 3. Introducing PATRIC and resources in development Therapeutic
De Novo and Hybrid Assembly
On the PacBio RS Introduction The PacBio RS utilizes SMRT technology to generate both Continuous Long Read ( CLR ) and Circular Consensus Read ( CCS ) data. In this document, we describe sequencing the
Genome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M)
Maj Gen (R) Suhaib Ahmed, I (M) The human genome comprises DNA sequences mostly contained in the nucleus. A small portion is also present in the mitochondria. The nuclear DNA is present in chromosomes.
Small Exon Finder User Guide
Small Exon Finder User Guide Author Wilson Leung wleung@wustl.edu Document History Initial Draft 01/09/2011 First Revision 08/03/2014 Current Version 12/29/2015 Table of Contents Author... 1 Document History...
The University of California, Santa Cruz (UCSC) Genome Browser
The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,
Data Retrieval from GenBank
Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing
NCBI & Other Genome Databases. BME 110/BIOL 181 CompBio Tools
NCBI & Other Genome Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2011 Admin Reading Dummies Ch 3 Assigned Review: "The impact of next-generation sequencing technology on genetics" by E.
This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part
This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part of the author's official duties as a United States Government
Browser Exercises - I. Alignments and Comparative genomics
Browser Exercises - I Alignments and Comparative genomics 1. Navigating to the Genome Browser (GBrowse) Note: For this exercise use http://www.tritrypdb.org a. Navigate to the Genome Browser (GBrowse)
Section 3: DNA Replication
Section 3: DNA Replication Main Idea: Replication- process by which DNA is copied during the cell cycle DNA Polymerase- a group of enzymes that bond the new nucleotides together 1 DNA Replication Replication
Genome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does
I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics
Ch 12 Lecture Notes - DNA I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics 1 II. Griffith and Transformation
De Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight
De Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight 1 Workflow Import NGS raw data QC on reads De novo assembly Trim reads Finding Genes BLAST Sample to Insight Case Study Pseudomonas aeruginosa
Deep Sequencing technologies
Deep Sequencing technologies Gabriela Salinas 30 October 2017 Transcriptome and Genome Analysis Laboratory http://www.uni-bc.gwdg.de/index.php?id=709 Microarray and Deep-Sequencing Core Facility University
Package geno2proteo. December 12, 2017
Type Package Package geno2proteo December 12, 2017 Title Finding the DNA and Protein Sequences of Any Genomic or Proteomic Loci Version 0.0.1 Date 2017-12-12 Author Maintainer biocviews
Investigation of Genomic Variation in the Rising Era of Individual Genome Sequence: A Primer on Some Available Datasets and Structures
Investigation of Genomic Variation in the Rising Era of Individual Genome Sequence: A Primer on Some Available Datasets and Structures September 28, 2015 A 10,000 Foot View Genomics Data at NCBI Organizational
1.1 Post Run QC Analysis
Post Run QC Analysis 100 339 200 01 1. Post Run QC Analysis 1.1 Post Run QC Analysis Welcome to Pacific Biosciences' Post Run QC Analysis Overview. This training module will describe the workflow to assess
Annotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University
Annotation Walkthrough Workshop NAME: BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University A Simple Annotation Exercise Adapted from: Alexis Nagengast,
Transcription Start Sites Project Report
Transcription Start Sites Project Report Student name: Student email: Faculty advisor: College/university: Project details Project name: Project species: Date of submission: Number of genes in project:
Genome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
SeattleSNPs Interactive Tutorial: Database Inteface Entrez, dbsnp, HapMap, Perlegen
SeattleSNPs Interactive Tutorial: Database Inteface Entrez, dbsnp, HapMap, Perlegen The tutorial is designed to take you through the steps necessary to access SNP data from the primary database resources:
Ensembl workshop. Thomas Randall, PhD bioinformatics.unc.edu. handouts, papers, datasets
Ensembl workshop Thomas Randall, PhD tarandal@email.unc.edu bioinformatics.unc.edu www.unc.edu/~tarandal/ensembl handouts, papers, datasets Ensembl is a joint project between EMBL - EBI and the Sanger
Chapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
DNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
Protein Synthesis 101
Protein Synthesis 101 What is DNA? - Blueprint of Life (has the instructions for making ) - Gene = a segment of DNA which determines a ( ) - - is wrapped around protein to form - Structure was discovered
RNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
Gene-centered resources at NCBI
COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving
Videos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
Applied Biosystems SOLiD 3 Plus System. RNA Application Guide
Applied Biosystems SOLiD 3 Plus System RNA Application Guide For Research Use Use Only. Not intended for any animal or human therapeutic or diagnostic use. TRADEMARKS: Trademarks of Life Technologies Corporation
Tutorial. Bisulfite Sequencing. Sample to Insight. September 15, 2016
Bisulfite Sequencing September 15, 2016 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com Bisulfite
Bacterial Genome Annotation
Bacterial Genome Annotation Bacterial Genome Annotation For an annotation you want to predict from the sequence, all of... protein-coding genes their stop-start the resulting protein the function the control
SMRT Analysis Barcoding Overview (v6.0.0)
SMRT Analysis Barcoding Overview (v6.0.0) Introduction This document applies to PacBio RS II and Sequel Systems using SMRT Link v6.0.0. Note: For information on earlier versions of SMRT Link, see the document
MODULE 5: TRANSLATION
MODULE 5: TRANSLATION Lesson Plan: CARINA ENDRES HOWELL, LEOCADIA PALIULIS Title Translation Objectives Determine the codons for specific amino acids and identify reading frames by looking at the Base
How to deal with your RNA-seq data?
How to deal with your RNA-seq data? Rachel Legendre, Thibault Dayris, Adrien Pain, Claire Toffano-Nioche, Hugo Varet École de bioinformatique AVIESAN-IFB 2017 1 Rachel Legendre Bioinformatics 27/11/2018
De Novo Transcript Discovery using Long and Short Reads
De Novo Transcript Discovery using Long and Short Reads December 4, 2018 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com
user s guide Question 1
Question 1 How does one find a gene of interest and determine that gene s structure? Once the gene has been located on the map, how does one easily examine other genes in that same region? doi:10.1038/ng966
Videos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
DNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
Processing Very Large Genomic Files
Processing Very Large Genomic Files Michael Robinson School of Computer Information Science Florida International University Miami, Florida, USA michael.robinson@cs.fiu.edu Abstract We have developed a
Mate-pair library data improves genome assembly
De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate
Gene Prediction Final Presentation
Gene Prediction Final Presentation Final Proposed Pipeline Assembled Genome Protein - coding Gene Prediction Ab Initio Prodigal Glimmer GeneMarkS RNA Gene Prediction ncrna Specific trnascanse (trna) RNAmmer
Basic Bioinformatics: Homology, Sequence Alignment,
Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi
Genes are coded DNA instructions that control the production of proteins within a cell. The first step in decoding genetic messages is to copy a part
Genes are coded DNA instructions that control the production of proteins within a cell. The first step in decoding genetic messages is to copy a part of the nucleotide sequence of the DNA into RNA. RNA
Download the Lectin sequence output from
Computer Analysis of DNA and Protein Sequences Over the Internet Part I. IN CLASS Download the Lectin sequence output from http://stan.cropsci.uiuc.edu/courses/cpsc265/ Open these in BioEdit (free software).
COMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928
HEREDITY = passing on of characteristics from parents to offspring I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin= uncoiled DNA
Fermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
Collect, analyze and synthesize. Annotation. Annotation for D. virilis. Evidence Based Annotation. GEP goals: Evidence for Gene Models 08/22/2017
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
Introduction to CGE tools
Introduction to CGE tools Pimlapas Leekitcharoenphon (Shinny) Research Group of Genomic Epidemiology, DTU-Food. WHO Collaborating Centre for Antimicrobial Resistance in Foodborne Pathogens and Genomics.
Strain/species identification in metagenomes using genome-specific markers. Tu, He and Zhou Nucleic Acids Research
Strain/species identification in metagenomes using genome-specific markers. Tu, He and Zhou. 2014 Nucleic Acids Research Journal Club Triinu Kõressaar 25.04.2014 Introduction (1/2) Shotgun metagenome sequencing
DNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC
Tutorial for Stop codon reassignment in the wild
Tutorial for Stop codon reassignment in the wild Learning Objectives This tutorial has two learning objectives: 1. Finding evidence of stop codon reassignment on DNA fragments. 2. Detecting and confirming
Collect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
Bionano Access v1.2 Release Notes
Bionano Access v1.2 Release Notes Document Number: 30220 Document Revision: A For Research Use Only. Not for use in diagnostic procedures. Copyright 2018 Bionano Genomics, Inc. All Rights Reserved. Table
Lesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
Gegenees V User Manual :
User Manual : Gegenees V 1.0.1 What is Gegenees?... 1 Version system:... 2 What's new... 2 Installation:... 2 Perspectives... 3 The workspace... 3 The local database... 4 Remote Sites... 5 Gegenees genome
Draft 3 Annotation of DGA06H06, Contig 1 Jeannette Wong Bio4342W 27 April 2009
Page 1 Draft 3 Annotation of DGA06H06, Contig 1 Jeannette Wong Bio4342W 27 April 2009 Page 2 Introduction: Annotation is the process of analyzing the genomic sequence of an organism. Besides identifying
An Introduction to the package geno2proteo
An Introduction to the package geno2proteo Yaoyong Li January 24, 2018 Contents 1 Introduction 1 2 The data files needed by the package geno2proteo 2 3 The main functions of the package 3 1 Introduction
earray 5.0 Create your own Custom Microarray Design
earray 5.0 Create your own Custom Microarray Design http://earray.chem.agilent.com earray 5.x Overview Session Summary Session Summary Agilent Genomics Microarray Solution earray Functional Overview Gene
DNA, RNA & Proteins Chapter 13
DNA, RNA & Proteins Chapter 13 DNA stands for. What is DNA? - The genetic information that controls the activity of a cell. - Located in the of every one of your cells. What is the structure of DNA like?
Protein Synthesis: From Gene RNA Protein Trait
Protein Synthesis: From Gene RNA Protein Trait Human Genome The human genome contains about genes. Each gene is a of DNA (sequence of nitrogen bases) contained within each chromosome. Each chromosome contains
ab initio and Evidence-Based Gene Finding
ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene
9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3
cdna libraries, EST clusters, gene prediction and functional annotation Biosciences 741: Genomics Fall, 2013 Week 3 1 2 3 4 5 6 Figure 2.14 Relationship between gene structure, cdna, and EST sequences
user s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
ISO/IEC JTC 1/SC 29/WG 11 N15527 Warsaw, CH June Introduction
INTERNATIONAL ORGANISATION FOR STANDARDISATION ORGANISATION INTERNATIONALE DE NORMALISATION ISO/IEC JTC 1/SC 29/WG 11 CODING OF MOVING PICTURES AND AUDIO ISO/IEC JTC 1/SC 29/WG 11 N15527 Warsaw, CH June
Codon usage diversity in city microbiomes
Codon usage diversity in city microbiomes Haruo Suzuki 1,2 1. Institute for Advanced Biosciences, Keio University, Tsuruoka, Yamagata, Japan 2. Faculty of Environment and Information Studies, Keio University,
BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology
BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology Jeremy Buhler March 15, 2004 In this lab, we ll annotate an interesting piece of the D. melanogaster genome. Along the way, you ll get
NUCLEIC ACIDS. DNA (Deoxyribonucleic Acid) and RNA (Ribonucleic Acid): information storage molecules made up of nucleotides.
NUCLEIC ACIDS DNA (Deoxyribonucleic Acid) and RNA (Ribonucleic Acid): information storage molecules made up of nucleotides. Base Adenine Guanine Cytosine Uracil Thymine Abbreviation A G C U T DNA RNA 2
Protein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
Bioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
FUNCTIONAL BIOINFORMATICS
Molecular Biology-2018 1 FUNCTIONAL BIOINFORMATICS PREDICTING THE FUNCTION OF AN UNKNOWN PROTEIN Suppose you have found the amino acid sequence of an unknown protein and wish to find its potential function.
Thebiotutor.com A2 Biology OCR Unit F215: Control, genomes and environment Module 1.1 Cellular control Answers
Thebiotutor.com A2 Biology OCR Unit F215: Control, genomes and environment Module 1.1 Cellular control Answers Andy Todd 1 1. 1 ref to operon; 2 normally repressor substance bound to operator; 3 prevents
Chimp Sequence Annotation: Region 2_3
Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker
File name: Supplementary Information. Description: Supplementary Figures, Supplementary Tables and Supplementary References.
1 2 File name: Supplementary Information Description: Supplementary Figures, Supplementary Tables and Supplementary References. 3 1 4 Supplementary Figures 5 6 7 Figure S1 Comparison of the One-Step-Assembly
Transcriptome Assembly, Functional Annotation (and a few other related thoughts)
Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types
Bioinformatics for NGS projects. Guidelines. genomescan.nl
Next Generation Sequencing Bioinformatics for NGS projects Guidelines genomescan.nl GenomeScan s Guidelines for Bioinformatics Services on NGS Data Using our own proprietary data analysis pipelines Dear
Genome Projects. Part III. Assembly and sequencing of human genomes
Genome Projects Part III Assembly and sequencing of human genomes All current genome sequencing strategies are clone-based. 1. ordered clone sequencing e.g., C. elegans well suited for repetitive sequences
DNA & RNA. Chapter Twelve and Thirteen Biology One
DNA & RNA Chapter Twelve and Thirteen Biology One I. DNA Structure A. DNA monomers = nucleotides *1. sugar bonded to PO4 & one of four possible nitrogen bases 2. bases = Adenine, Guanine, Cytosine, Thymine
Types of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
Corynebacterium pseudotuberculosis genome sequencing: Final Report
Summary To provide an invaluable resource to assist in the development of diagnostics and vaccines against caseous lymphadenitis (CLA), the sequencing of the genome of a virulent, United Kingdom Corynebacterium
Worksheet for Bioinformatics
Worksheet for Bioinformatics ACTIVITY: Learn to use biological databases and sequence analysis tools Exercise 1 Biological Databases Objective: To use public biological databases to search for latest research
UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding
UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene
SCGC Service Description For further information, go to scgc.bigelow.org Updated June 1, 2018
SCGC Service Description For further information, go to scgc.bigelow.org Updated June 1, 2018 Single cell genomics unveils the genomic blueprints of the most fundamental units of life without the need
Biology A: Chapter 9 Annotating Notes Protein Synthesis
Name: Pd: Biology A: Chapter 9 Annotating Notes Protein Synthesis -As you read your textbook, please fill out these notes. -Read each paragraph state the big/main idea on the left side. -On the right side
user s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
Analyzing an individual sequence in the Sequence Editor
BioNumerics Tutorial: Analyzing an individual sequence in the Sequence Editor 1 Aim The Sequence editor window is a convenient tool implemented in BioNumerics to edit and analyze nucleotide and amino acid
Protein Synthesis: Transcription and Translation
Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)
Probiotic Strain Isolated from the Vagina of Healthy Women
JB Accepts, published online ahead of print on 1 April 2011 J. Bacteriol. doi:10.1128/jb.00358-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.