Additional file 2. Sequence origin GC% URL. Sequence type Number of sequences
|
|
|
- Alisha Banks
- 5 years ago
- Views:
Transcription
1 Additional file 2 Table S1 Summary of sorghum transcript and genomic data Sequence origin Sequence type Number of sequences GC% URL Genome Chromosomes Super scaffold UniGene Unclustered UniGene Clustered UniGene ESTs TIGR transcripts ftp://occams.dfci.harvard.edu/pub/bio/tgi/data/ NCBI dbest RNA-seq Maize GEO data (GSE40070) reads NA
2 Table S2 Overview of UniGene libraries (build # 30) Main parts of plants Tissues Number of lib a Library ID Name of Library Sequence number Body site Callus 1 Lib Callus culture/cell suspension embryo 2 Lib.5437 Embryo 1 (EM1) 9843 leaf 12 Lib Lib Lib Lib not shown Wounded leaves Pathogen-infected compatible 1 (PIC1) Drought-stressed after flowering Drought-stressed before flowering each <1000 ovary 3 Lib.5439 Lib not shown Ovary 1 (OV1) Ovary 2 (OV2) <1000 panicle 2 Lib not shown Immature panic le 1 (IP1) 9588 <1000 pollen 1 Lib Pollen chloroplast 1 not shown each <1000 root 3 Lib Lib Lib Acid- and alkaline-treated roots Anaerobic roots Sorghum bicolor BTx623 Root hair shoot 2 Lib not shown GA- or brassinolidetreated seedlings <1000 Whole 4 not shown each <1000 Unspecified tissue 1 not shown <1000 mixed 13 Lib.4037 Lib Lib Lib.4038 Lib Lib Lib Lib Lib Lib Lib Dark Grown 1 (DG1) Heat-shocked seedlings Oxidatively-stressed leaves and roots Water-stressed 1 (WS1) Ethylene-treated seedlings Salt-stressed seedlings Salicylic acid-treated seedlings Abscisic acid-treated seedlings
3 Main parts of plants Tissues Number of lib a Library ID Name of Library Sequence number 2 not shown Iron-deficient seedlings Nitrogen-deficient seedlings Phosphorous-deficient seedlings each < 1000 not yet classified 4 Lib.5441 Lib not shown Pathogen induced 1 (PI1) Light Grown 1 (LG1) each <1000 Developmental stage Germinating seed seedling vegetative flowering ripening unknown developmental stage not yet classified Not shown Not shown Not shown Not shown Not shown Not shown Not shown Not shown each <1000 each < 1000 each < 1000 < 1000 < 1000 < 1000 each < 1000 each < 1000
4 Table S3 Chromosomal distribution of UniGene clusters mapped to genome Chrom osomes UniGene clusters that overlapped Known genes UniGene clusters that mapped to intergenic region DR 1 Non-DR(DR) 2 Total DR Non-DR Total Grand Total Chr (37) Chr (33) Chr (39) Chr (35) Chr (13) Chr (21) Chr (23) Chr (13) Chr (27) Chr (15) Super 0 99 (2) Total (258) Key to legend: 1 UniGene clusters that represent purely drought responsive 2 UniGene clusters that basically represent non-drought responsive, however, contain shorter ESTs which were expressed under drought conditions dispersed within the clusters.
5 Table S4 Comparison and update of annotation Existing annotation Current annotation Description Updated Novel gene models mrna gene models mrna gene models mrna Original Updated Total This supplementary table shows the comparison and update of annotation between existing and current prediction of sorghum genome based on PASA alignment evidence.
6 Table S5 Functional distribution of the novel gene structure models Known drought-related function Complete genes Partial genes 3' and 5' UTR only 3' UTR only 5' UTR at-least one truncated at Total attained attained attained end attained both ends DR NDR Total
7 Table S6 Chromosomal distribution of existing genes modified corresponding to the position and structure of modification. Scaffolds Chromosomal distribution of the modified existing gene models A 1 B 2 C 3 D 4 E 5 F 6 G 7 H 8 I 9 Total chr chr chr chr chr chr chr chr chr chr super Total Legend to key: A 1 Transcript A; B 2 Transcript B; C 3 Transcript C; D 4 Transcript D; E 5 Transcript E; F 6 Transcript F; G 7 Transcript G; H 8 Transcript H and I 9 Transcript I (Figure 1)
8 Table S7 Chromosomal distribution of the novel gene structure models Partial gene structure Scaffolds Complete gene structure One end retained truncated at both ends DR a ND-DR b DR a ND-DR b DR a Non-DR b Total chr chr chr chr chr chr chr chr chr chr super Total Key to legend: a Drought responsive; b Non-drought responsive
9 Table S8 Genomic distribution of spliced and retained intron based on PASA analysis Intron S 1 Spliced Retained Coordinate O 2 A 3 M 4 Coordinate O 2 A 3 M 4 chr chr chr chr chr chr chr chr chr chr chr chr chr chr chr chr chr chr chr chr chr chr chr , chr chr chr Key to legend: 1 Chromosomes number 1-10; 2 Orientation of the strand; 3 Assembly number that the transcripts belong to and 4 Maximum evidence support.
10 Table S9 Genomic distribution of skipped and retained exons based on PASA analysis Exon S 1 Skipped Retained Coordinate O 2 A 3 M 4 Coordinate O 2 A 3 M 4 chr , chr chr chr chr chr chr chr chr Key to legend: refer to Table S6.
11 Table S10 PASA based identification of alternative splicing (AS) for the novel genes Types of AS AS event Non-AS events Alternative acceptor 42 - Alternative donor 14 - Alternative 5' site - - Alternative 3' site - - Alternative exon 16 - Ends in intron 10 - Retained exon - 9 Retained Intron 27 - Skipped exon 9 - Spliced intron - 27 Starts in intron 18 - Total
12 Table S11 Patterns of exonic and intronic features in the novel gene structure models Features a Feature Single Double Triple Quadruple Multiple features Total less Total Exons Total introns Gene per exonic b d Gene per intronic c 105 e Key to legend: a Genes, Exons and Introns; b Gene number per exonic feature; c Gene number per intronic feature; d Single exonic genes and e Intronless genes.
13 Table S12 GO functional enrichment of DR sorghum genes based on orthology groups GO-D A GO ID GO-term E/T B GO/Bg C P D BP GO: Response to stress 1102/ / BP GO: Response to water deprivation 118/ / e-55 BP GO: Response to dessication 21/ / e-09 BP GO: Response to heat 91/ / e-38 BP GO: Response to ABA stimulus 109/ / e-28 BP GO: ABA mediated signalling pathway 37/ / e-11 CC GO: Cytoplasmic part 477/ / e-20 CC GO: Plastid 161/ / e-11 CC GO: Chloroplast 144/ / e-10 CC GO: Membrane-bounded organelle 628/ / e-27 CC GO: Plasma membrane 136/ / e-13 MF GO: Unfolding protein binding 36/ / e-10 MF GO: Cofactor binding 81/ / e-10 MF GO: Ion binding 91/ / e-11 MF GO: Antioxidant activity 72/ / e-28 MF GO: Electron transfer activity 86/ / e-07 Key to legend: A GO-D denotes GO domain; B E/T denote enriched genes Vs test set: the numerator and denominator represent the number of enriched genes and test set respectively; C GO/Bg denote genes with GO-terms Vs back ground set: the numerator and denominator represent the number of genes for which corresponding GO-terms were assigned and the background set respectively; D P denote P-value (FDR). The first top GO-term in each GO-domain, eg. BP: response to stress (GO: ), CC: Cytoplasmic part (GO: ) and MF: Unfolding protein binding (GO: ), represent the most likely term associated to the corresponding number of enriched genes. As such, 1102, 477, and 36 genes respectively were assigned to these GO-terms.
14 Table S13 Databases containing potential source for candidate drought responsive genes No. Databases Link or reference 1 Genome database: Phytozome Gramene Ensembl or ftp://ftp.jgipsf.org/pub/compgen/phytozome/v9.0/sbicolor_ v1.4/; Goodstein et al., Ware et al., Flicek et al., 2012 and Sequences databases: RefSeq NCBI UniGene dbests Uniprot Rudd et al., Boguski et al., Protein domain databases Uniref Uniprot Swissprot Interoroscan Signal peptides Expression databases: Gene Expression Omnipus (GEO): experimental genome microarray data, RNA-seq data
15 Table S14 Relevant tools for identification of the candidate gene Ser. # Tools Links or references 1 alignment tools: Blast, Blat, est2genome exonerate exonerate/index_html ClustalW ClustalX 2 Gene structure prediction tools: Augustus, est2genome exonerate, and PASA Evidence Moduler (EVM), ftp://ftp.hgc.jp/pub/mirror/ebi/software/exonerate/ Gene enrichment analysis tools: AgriGO Blast2go MeV, Genevestigator, genevestigator. ethz. Ch/ 4 Genome viewer tools: Galaxy, Gbrowse USCS-Gbrowse Biomart-ensemble, Biomart-Gramene ea281f8c0071af7d45f4ab01f9 Biomart Phytozome cd94d5beb507c71 5 Expression profiling analysis tools: Multivariate Experiment Viewer (MeV) 6 Sequence quality filtering tools:
16 RepeatMasker Statistical analysis tools: R programming, MeV 7 Programming tools: linux OS Perl, Python, R, programming modules, Bioperl Biopython tilities.htm Page Table S15 Functional description of sorghum drought related metabolic pathways.
17 Figure S1. Identified genes by mapping to existing annotation and their characterization status
18 Figure S2 Pattern of exon and intron number and the average length for novel identified genes. Key to legend for exon and intron number: 1=exon1, intron1; 2=exon2, intron2; 3=exon3, intron3; 4=exon4, intron4; 5=exon5, intron5; 6=exon6, intron6; 7=exon7, intron7; 8=exon8, intron8; 9=exon9, intron9 and average = exon total average; intron total average.
19 Nearest intergenic distance LNID RNID Novel complete gene structure models Figure S3 Nearest intergenic distances. Key to legend: RNID (right nearest intergenic distance) and LNID (left nearest intergenic distance). The intergenic distances between the NGSM and the nearest existing neighbour gene were described based on the fourteen NGSMs known to have complete gene structure. The average RNID represents bases long while the average LNID represents bases long.
20 Figure S4 GO annotation based on blasting and mapping to non-redundant databases. GO annotation based on blasting and mapping sequences to non-redundant databases based on balst2go: a) patterns of sequences distribution based on blast hits associated to the GO-terms for the biological process; b) Species specific score for the total blast-hit; c) species specific blast top hits and d) GO-level distribution of annotations
21 Figure S5 Aminoacyl-tRNA biosynthesis (upper) and Cysteine and methionine metabolism (lower).
22
23 Figure S6 Drug metabolism - other enzymes (upper) and Glucosinolate biosynthesis (lower).
24 Figure S7 Glycerophospholipid metabolism (upper) and Glycerolipid metabolism (lower).
25 Figure S8 Phosphatidylinositol signalling system (upper) and nicotinate and nicotinate metabolism (lower).
26
27 Figure S9 Pyrimidine metabolism (upper) and purine metabolism (lower).
28 Figure S10 Valine, Luecine and Isoleucine Biosynthesis (upper) and Valine, Luecine and Isoleucine degradation (lower).
29 Figure S11 Pantothenate and CoA biosynthesis.
30 Figure S12 Description of interpro-domain analysis: List of protein signatures identified.
31 Parametric t-test (P-value < 0.05) Tissue based grouping
32 Parametric t-test (P-value < 0.05) Treatment based grouping Figure S13. Volcano plots for expression profiles based on sorghum drought responsive genes. This figure shows volcano plots with differential expression of genes with most significant at the top of the plot. Volcano plot (a) represents unpaired t-test based on the evaluation of tissue type contributing to the gene expression and (b) on the evaluation of treatment effect on the experimental samples. The red dots indicate a statistical significance for the up and down-regulated genes at the fold-changes (two) above which all genes have p < 0.01 and below which p > 0.01.
33 Parametric t-test (P-value < 0.05) Parametric t-test (P-value < 0.05) Tissue based grouping Treatment based grouping Figure S14 Volcano plots showing expression profiles based on based on maize expression data. This figure describes volcano plot showing differential expression of genes with the most significant genes at the top of the plot. The red dots indicate genes-of-interest that display both large-magnitude of fold-changes (the change in mean values of group A and group B, in our case, x- axis) and a fairly high value of statistical significance (-log10 of p-value, y-axis). The upper line
34 across the plot shows a point where p = 0.01 (i.e. where the fold-change is equal to two (log2 = 1) above which lie all genes having p < 0.01 and below which having p > Volcano plots a) represent unpaired t-test based on treatment grouping, b) depicts the gene expression pattern based on between subject variance with tissue based grouping of samples. The plot shows higher number of genes expressed under drought condition in tissue based grouping with more down-regulated tissue specific genes than in treatment based grouping which shows not only relatively fewer number of genes expressed in total under the same stress condition but also relatively less downregulated genes.
35 Figure S15 Venn diagram showing distribution of significantly expressed genes. Key to legend: Fisher's ET = Fishers Exact Test; Unparired tt = Unpaired t test and RP = Rank product. The figure illustrates the number of statistically significantly expressed genes identified by each statistical model which is equivalent to the sum of values in each respective circle. An overlapping shows the number of significantly expressed genes supported by multiple models. The number at the centre represents a total number of expressed genes supported by all statistical models.
36 Figure S16 Sorghum % GO-terms assigned genes identified from maize orthologs. Significantly expressed 45 genes supported by all statistical models based on analysis of geneexpression are shown (left) and significantly expressed total 1079 genes supported by individual statistical models based on analysis of gene-expression are also shown (right). The percentage of sorghum genes identified from maize orthologs that were assigned to different GO-terms associated to drought responses are also shown on gene expression in maize reproductive and Leaf meristem tissue.
37 Figure S17 Mapping of GO terms related to responses to drought stress based on the biological process of the genes identified using orthology groups. This figure represents significantly overrepresented GO-terms most related to drought tolerance selected based on tree traversing mode using AGRIGO software package. The GO term descriptors that related to drought tolerance included but not limited to response to drought stress, response to desiccation tolerance, response to water deprivation, cellular response to drought stress, cellular response to desiccation and cellular response to water deprivation. Drought stress regulated genes were represented as an expression of mrnas with more than two-fold changes under differential conditions. The number inside the coloured box represent GO accessions, p-values, number of enriched genes in the test set per total number of genes involved in the test set and those in the sorghum database associated with GO-term per total number of genes in the database involved in the background set of the GO-term.
Adugna Abdi Woldesemayat 1,2*, Peter Van Heusden 1, Bongani K. Ndimba 3,4 and Alan Christoffels 1
Woldesemayat et al. BMC Genetics (2017) 18:119 DOI 10.1186/s12863-017-0584-5 RESEARCH ARTICLE Open Access An integrated and comparative approach towards identification, characterization and functional
The Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica
The Ensembl Database Dott.ssa Inga Prokopenko Corso di Genomica 1 www.ensembl.org Lecture 7.1 2 What is Ensembl? Public annotation of mammalian and other genomes Open source software Relational database
Draft 3 Annotation of DGA06H06, Contig 1 Jeannette Wong Bio4342W 27 April 2009
Page 1 Draft 3 Annotation of DGA06H06, Contig 1 Jeannette Wong Bio4342W 27 April 2009 Page 2 Introduction: Annotation is the process of analyzing the genomic sequence of an organism. Besides identifying
Gene Annotation Project. Group 1. Tyler Tiede Yanzhu Ji Jenae Skelton
Gene Annotation Project Group 1 Tyler Tiede Yanzhu Ji Jenae Skelton Outline Tools Overview of 150kb region Overview of annotation process Characterization of 5 putative gene regions Analysis of masked
Collect, analyze and synthesize. Annotation. Annotation for D. virilis. Evidence Based Annotation. GEP goals: Evidence for Gene Models 08/22/2017
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
Overview of the next two hours...
Overview of the next two hours... Before tea Session 1, Browser: Introduction Ensembl Plants and plant variation data Hands-on Variation in the Ensembl browser Displaying your data in Ensembl After tea
Collect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
Chimp Sequence Annotation: Region 2_3
Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker
Annotation of contig27 in the Muller F Element of D. elegans. Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans.
David Wang Bio 434W 4/27/15 Annotation of contig27 in the Muller F Element of D. elegans Abstract Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans. Genscan predicted six
Supplement to: The Genomic Sequence of the Chinese Hamster Ovary (CHO)-K1 cell line
Supplement to: The Genomic Sequence of the Chinese Hamster Ovary (CHO)-K1 cell line Table of Contents SUPPLEMENTARY TEXT:... 2 FILTERING OF RAW READS PRIOR TO ASSEMBLY:... 2 COMPARATIVE ANALYSIS... 2 IMMUNOGENIC
Chapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
Sequence Based Function Annotation
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological
ChIP-seq data analysis with Chipster. Eija Korpelainen CSC IT Center for Science, Finland
ChIP-seq data analysis with Chipster Eija Korpelainen CSC IT Center for Science, Finland chipster@csc.fi What will I learn? Short introduction to ChIP-seq Analyzing ChIP-seq data Central concepts Analysis
Transcriptome analysis
Statistical Bioinformatics: Transcriptome analysis Stefan Seemann seemann@rth.dk University of Copenhagen April 11th 2018 Outline: a) How to assess the quality of sequencing reads? b) How to normalize
Analysis of RNA-seq Data. Feb 8, 2017 Peikai CHEN (PHD)
Analysis of RNA-seq Data Feb 8, 2017 Peikai CHEN (PHD) Outline What is RNA-seq? What can RNA-seq do? How is RNA-seq measured? How to process RNA-seq data: the basics How to visualize and diagnose your
CodeLink Human Whole Genome Bioarray
CodeLink Human Whole Genome Bioarray 55,000 human gene targets on a single bioarray The CodeLink Human Whole Genome Bioarray comprises one of the most comprehensive coverages of the human genome, as it
ChIP-seq and RNA-seq. Farhat Habib
ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions
Non-conserved intronic motifs in human and mouse are associated with a conserved set of functions
Non-conserved intronic motifs in human and mouse are associated with a conserved set of functions Aristotelis Tsirigos Bioinformatics & Pattern Discovery Group IBM Research Outline. Discovery of DNA motifs
Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly
Supplementary Tables Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly Library Read length Raw data Filtered data insert size (bp) * Total Sequence depth Total Sequence
Year III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3
cdna libraries, EST clusters, gene prediction and functional annotation Biosciences 741: Genomics Fall, 2013 Week 3 1 2 3 4 5 6 Figure 2.14 Relationship between gene structure, cdna, and EST sequences
user s guide Question 1
Question 1 How does one find a gene of interest and determine that gene s structure? Once the gene has been located on the map, how does one easily examine other genes in that same region? doi:10.1038/ng966
ChIP-seq and RNA-seq
ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)
COMPUTATIONAL PREDICTION AND CHARACTERIZATION OF A TRANSCRIPTOME USING CASSAVA (MANIHOT ESCULENTA) RNA-SEQ DATA
COMPUTATIONAL PREDICTION AND CHARACTERIZATION OF A TRANSCRIPTOME USING CASSAVA (MANIHOT ESCULENTA) RNA-SEQ DATA AOBAKWE MATSHIDISO, SCOTT HAZELHURST, CHRISSIE REY Wits Bioinformatics, University of the
Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html
Getting to the Roots FOR PHARMA & LIFE SCIENCES WHITEPAPER
FOR PHARMA & LIFE SCIENCES WHITEPAPER Getting to the Roots IMPROVING RUBBER TREE CROP PRODUCTION THROUGH MARKER-ASSISTED SELECTION OF TARGETED GENOME TYPES. Improving rubber tree crop production through
Genome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)
Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA
Genome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
Genome Annotation - 2. Qi Sun Bioinformatics Facility Cornell University
Genome Annotation - 2 Qi Sun Bioinformatics Facility Cornell University Output from Maker GFF file: Annotated gene, transcripts, and CDS FASTA file: Predicted transcript sequences Predicted protein sequences
Chimp Chunk 3-14 Annotation by Matthew Kwong, Ruth Howe, and Hao Yang
Chimp Chunk 3-14 Annotation by Matthew Kwong, Ruth Howe, and Hao Yang Ruth Howe Bio 434W April 1, 2010 INTRODUCTION De novo annotation is the process by which a finished genomic sequence is searched for
Guided tour to Ensembl
Guided tour to Ensembl Introduction Introduction to the Ensembl project Walk-through of the browser Variations and Functional Genomics Comparative Genomics BioMart Ensembl Genome browser http://www.ensembl.org
INTRODUCTION TO BIOINFORMATICS. SAINTS GENETICS Ian Bosdet
INTRODUCTION TO BIOINFORMATICS SAINTS GENETICS 12-120522 - Ian Bosdet (ibosdet@bccancer.bc.ca) Bioinformatics bioinformatics is: the application of computational techniques to the fields of biology and
UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding
UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene
SUPPLEMENTARY INFORMATION
18Pura Brain Liver 2 kb 9Mtmr Heart Brain 1.4 kb 15Ppara 1.5 kb IPTpcc 1.3 kb GAPDH 1.5 kb IPGpr1 2 kb GAPDH 1.5 kb 17Tcte 13Elov12 Lung Thymus 6 kb 5 kb 17Tbcc Kidney Embryo 4.5 kb 3.7 kb GAPDH 1.5 kb
Annotation of a Drosophila Gene
Annotation of a Drosophila Gene Wilson Leung Last Update: 12/30/2018 Prerequisites Lecture: Annotation of Drosophila Lecture: RNA-Seq Primer BLAST Walkthrough: An Introduction to NCBI BLAST Resources FlyBase:
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC
Genome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does
MODULE TSS1: TRANSCRIPTION START SITES INTRODUCTION (BASIC)
MODULE TSS1: TRANSCRIPTION START SITES INTRODUCTION (BASIC) Lesson Plan: Title JAMIE SIDERS, MEG LAAKSO & WILSON LEUNG Identifying transcription start sites for Peaked promoters using chromatin landscape,
Annotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University
Annotation Walkthrough Workshop NAME: BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University A Simple Annotation Exercise Adapted from: Alexis Nagengast,
Infiltrating immune cells do not differ between T2E and non-t2e samples and represent a small fraction of total cellularity.
Supplementary Figure 1 Infiltrating immune cells do not differ between T2E and non-t2e samples and represent a small fraction of total cellularity. (a) ESTIMATE immune score from mrna expression array
Bioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
ab initio and Evidence-Based Gene Finding
ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene
Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro
Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Philip Morris International R&D, Philip Morris Products S.A., Neuchatel, Switzerland Introduction Nicotiana sylvestris
Array-Ready Oligo Set for the Rat Genome Version 3.0
Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.
Agenda. Web Databases for Drosophila. Gene annotation workflow. GEP Drosophila annotation projects 01/01/2018. Annotation adding labels to a sequence
Agenda GEP annotation project overview Web Databases for Drosophila An introduction to web tools, databases and NCBI BLAST Web databases for Drosophila annotation UCSC Genome Browser NCBI / BLAST FlyBase
nature methods A paired-end sequencing strategy to map the complex landscape of transcription initiation
nature methods A paired-end sequencing strategy to map the complex landscape of transcription initiation Ting Ni, David L Corcoran, Elizabeth A Rach, Shen Song, Eric P Spana, Yuan Gao, Uwe Ohler & Jun
Identification of individual motifs on the genome scale. Some slides are from Mayukh Bhaowal
Identification of individual motifs on the genome scale Some slides are from Mayukh Bhaowal Two papers Nature 423, 241-254 (15 May 2003) Sequencing and comparison of yeast species to identify genes and
regression t value two sample t values regression line
Suppl. Table 1: Testing SCRE sequence information without the structural constraint SCRE t test on difference of coefficients SCRE t value sequence only t value Dm1 6.62 6.84 1.29 Dm2 7.06 7.46 1.84 Dm3
Workflows and Pipelines for NGS analysis: Lessons from proteomics
Workflows and Pipelines for NGS analysis: Lessons from proteomics Conference on Applying NGS in Basic research Health care and Agriculture 11 th Sep 2014 Debasis Dash Where are the protein coding genes
GS Analysis of Microarray Data
GS01 0163 Analysis of Microarray Data Keith Baggerly and Kevin Coombes Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org kcoombes@mdanderson.org
Transcriptome Assembly, Functional Annotation (and a few other related thoughts)
Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types
GS Analysis of Microarray Data
GS01 0163 Analysis of Microarray Data Keith Baggerly and Brad Broom Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org bmbroom@mdanderson.org 7
Chapter 3.5. Protein Synthesis
Chapter 3.5 Protein Synthesis Summary of Protein Synthesis How chemical Information is transfer during protein synthesis DNA mrna protein transcription the step from DNA to mrna occurs in the nucleus where
Aaditya Khatri. Abstract
Abstract In this project, Chimp-chunk 2-7 was annotated. Chimp-chunk 2-7 is an 80 kb region on chromosome 5 of the chimpanzee genome. Analysis with the Mapviewer function using the NCBI non-redundant database
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Processing of mutations and generation of simulated controls. On the left, a diagram illustrates the manner in which covariate-matched simulated mutations were obtained, filtered
Analysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review
Transcription Start Sites Project Report
Transcription Start Sites Project Report Student name: Student email: Faculty advisor: College/university: Project details Project name: Project species: Date of submission: Number of genes in project:
Annotating 7G24-63 Justin Richner May 4, Figure 1: Map of my sequence
Annotating 7G24-63 Justin Richner May 4, 2005 Zfh2 exons Thd1 exons Pur-alpha exons 0 40 kb 8 = 1 kb = LINE, Penelope = DNA/Transib, Transib1 = DINE = Novel Repeat = LTR/PAO, Diver2 I = LTR/Gypsy, Invader
Galaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory http://collaboratory.lifesci.ucla.edu Workshop Outline ü Day 1 UCLA galaxy
Annotating Fosmid 14p24 of D. Virilis chromosome 4
Lo 1 Annotating Fosmid 14p24 of D. Virilis chromosome 4 Lo, Louis April 20, 2006 Annotation Report Introduction In the first half of Research Explorations in Genomics I finished a 38kb fragment of chromosome
Analysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer. Project XX1001. Customer Detail
Analysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer Project XX Customer Detail Table of Contents. Bioinformatics analysis pipeline...3.. Read quality check. 3.2. Read alignment...3.3.
PrimePCR Assay Validation Report
Gene Information Gene Name glutathione S-transferase alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID GSTA1 Human Cytosolic and membrane-bound forms
Eukaryotic Gene Prediction. Wei Zhu May 2007
Eukaryotic Gene Prediction Wei Zhu May 2007 In nature, nothing is perfect... - Alice Walker Gene Structure What is Gene Prediction? Gene prediction is the problem of parsing a sequence into nonoverlapping
I. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
Agilent GeneSpring GX 10: Beyond. Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008
Agilent GeneSpring GX 10: Gene Expression and Beyond Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008 GeneSpring GX 10 in the News Our Goals for GeneSpring GX 10 Goal 1: Bring back GeneSpring
Section C: The Control of Gene Expression
Section C: The Control of Gene Expression 1. Each cell of a multicellular eukaryote expresses only a small fraction of its genes 2. The control of gene expression can occur at any step in the pathway from
Supplemental Figure 1.
Supplemental Data. Charron et al. Dynamic landscapes of four histone modifications during de-etiolation in Arabidopsis. Plant Cell (2009). 10.1105/tpc.109.066845 Supplemental Figure 1. Immunodetection
measuring gene expression December 5, 2017
measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA
Figure 1. FasterDB SEARCH PAGE corresponding to human WNK1 gene. In the search page, gene searching, in the mouse or human genome, can be done: 1- By
1 2 3 Figure 1. FasterD SERCH PGE corresponding to human WNK1 gene. In the search page, gene searching, in the mouse or human genome, can be done: 1- y keywords (ENSEML ID, HUGO gene name, synonyms or
CH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
PrimePCR Assay Validation Report
Gene Information Gene Name keratin 78 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT78 Human This gene is a member of the type II keratin gene family
Introduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph
Introduction to Plant Genomics and Online Resources Manish Raizada University of Guelph Genomics Glossary http://www.genomenewsnetwork.org/articles/06_00/sequence_primer.shtml Annotation Adding pertinent
TIGR THE INSTITUTE FOR GENOMIC RESEARCH
Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,
Systematic evaluation of spliced alignment programs for RNA- seq data
Systematic evaluation of spliced alignment programs for RNA- seq data Pär G. Engström, Tamara Steijger, Botond Sipos, Gregory R. Grant, André Kahles, RGASP Consortium, Gunnar Rätsch, Nick Goldman, Tim
Ensembl workshop. Thomas Randall, PhD bioinformatics.unc.edu. handouts, papers, datasets
Ensembl workshop Thomas Randall, PhD tarandal@email.unc.edu bioinformatics.unc.edu www.unc.edu/~tarandal/ensembl handouts, papers, datasets Ensembl is a joint project between EMBL - EBI and the Sanger
EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science
EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can
Genome Annotation. Stefan Prost 1. May 27th, States of America. Genome Annotation
Genome Annotation Stefan Prost 1 1 Department of Integrative Biology, University of California, Berkeley, United States of America May 27th, 2015 Outline Genome Annotation 1 Repeat Annotation 2 Repeat
Supplemental Data. Wang et al. Plant Cell. (2013) /tpc
SNL1 SNL Supplemental Figure 1. The Expression Patterns of SNL1 and SNL in Different Tissues of Arabidopsis from Genevestigator Web Site (https://www.genevestigator.com/gv/index.jsp). 1 A 1. 1..8.6.4..
Supplemental Materials
Supplemental Materials Supplemental Figure S. Phenotypic assessment of alb4 mutant plants under different stress conditions. (A) High-light stress and drought stress. Wild-type (WT) and alb4 mutant plants
Lesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
Cufflinks Scripture Both. GENCODE/ UCSC/ RefSeq 0.18% 0.92% Scripture
Cabili_SuppFig_1 a 1.9.8.7.6.5.4.3.2.1 Partially compatible % Partially recovered RefSeq coding Fully compatible % Fully recovered RefSeq coding Cufflinks Scripture Both b 18.5% GENCODE/ UCSC/ RefSeq Cufflinks
DNA is normally found in pairs, held together by hydrogen bonds between the bases
Bioinformatics Biology Review The genetic code is stored in DNA Deoxyribonucleic acid. DNA molecules are chains of four nucleotide bases Guanine, Thymine, Cytosine, Adenine DNA is normally found in pairs,
GS Analysis of Microarray Data
GS01 0163 Analysis of Microarray Data Keith Baggerly and Brad Broom Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org bmbroom@mdanderson.org 8
SUPPLEMENTARY INFORMATION
AS-NMD modulates FLM-dependent thermosensory flowering response in Arabidopsis NATURE PLANTS www.nature.com/natureplants 1 Supplementary Figure 1. Genomic sequence of FLM along with the splice sites. Sequencing
Gene Finding Genome Annotation
Gene Finding Genome Annotation Gene finding is a cornerstone of genomic analysis Genome content and organization Differential expression analysis Epigenomics Population biology & evolution Medical genomics
Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12212 Supplementary Discussion Contamination Assessment We evaluated the amount of human contamination in our viral DNA preparations by identifying sequences
Gene Regulation 10/19/05
10/19/05 Gene Regulation (formerly Gene Prediction - 2) Gene Prediction & Regulation Mon - Overview & Gene structure review: Eukaryotes vs prokaryotes Wed - Regulatory regions: Promoters & enhancers -
RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013
RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein
WiscDsLox485 ATG < > //----- E1 E2 E3 E4 E bp. Col-0 arr7 ARR7 ACTIN7. s of mrna/ng total RNA (x10 3 ) ARR7.
A WiscDsLox8 ATG < > -9 +0 > ---------//----- E E E E E UTR +9 UTR +0 > 00bp B S D ol-0 arr7 ol-0 arr7 ARR7 ATIN7 D s of mrna/ng total RNA opie 0. ol-0 (x0 ) arr7 ARR7 Supplemental Fig.. Genotyping and
Fermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Number and length distributions of the inferred fosmids.
Supplementary Figure 1 Number and length distributions of the inferred fosmids. Fosmid were inferred by mapping each pool s sequence reads to hg19. We retained only those reads that mapped to within a
Transcription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018
Outline Overview of the GEP annotation projects Annotation of Drosophila Primer January 2018 GEP annotation workflow Practice applying the GEP annotation strategy Wilson Leung and Chris Shaffer AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCT
This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part
This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part of the author's official duties as a United States Government
Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline
Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline Xi Wang Bioinformatics Scientist Computational Life Science Page 1 Bayer 4:3 Template 2010 March 2016 17/01/2017
KnetMiner USER TUTORIAL
KnetMiner USER TUTORIAL Keywan Hassani-Pak ROTHAMSTED RESEARCH 10 NOVEMBER 2017 About KnetMiner KnetMiner, with a silent "K" and standing for Knowledge Network Miner, is a suite of open-source software
Annotation of contig62 from Drosophila elegans Dot Chromosome
Abstract: Annotation of contig62 from Drosophila elegans Dot Chromosome 1 Maxwell Wang The goal of this project is to annotate the Drosophila elegans Dot chromosome contig62. Contig62 is a 32,259 bp contig
Final exam: Introduction to Bioinformatics and Genomics DUE: Friday June 29 th at 4:00 pm
Final exam: Introduction to Bioinformatics and Genomics DUE: Friday June 29 th at 4:00 pm Exam description: The purpose of this exam is for you to demonstrate your ability to use the different biomolecular