Supplemental Data. Wang et al. Plant Cell. (2013) /tpc
|
|
|
- Robert Logan
- 5 years ago
- Views:
Transcription
1 SNL1 SNL Supplemental Figure 1. The Expression Patterns of SNL1 and SNL in Different Tissues of Arabidopsis from Genevestigator Web Site ( 1
2 A SNL1 SNL Root Stem Leaf Flower Seed B SNL1 SNL (D) MS Days of after pollination Root Stem Leaf Flower Seed MS SNL1 SNL1 SNL SNL Atg839 Atg839 Supplemental Figure. Expression Patterns of SNL1 and SNL Using Gene Atg839 as Internal Control. (A) QRT-PCR analysis of SNL1 and SNL expression in Arabidopsis tissues. Results were normalized against the expression of Atg839. The mean values and SE were from three independent experiments. A representative result of gel electrophoresis is displayed at the bottom. (B) QRT-PCR analysis of SNL1 (grey) and SNL (white) in developing siliques. The X axis presents the developmental stage after pollination. The mean values and SE were from three independent experiments. MS, mature seed. A representative result of gel electrophoresis is displayed at the bottom.
3 1 Col snl1 Germination ratio (%) Concentration of ABA (μm) Supplemental Figure 3. Over-expression of SNL1 Restores the Seed Germination of snl1 in Response to ABA. The germination phenotype of Col, snl1 and homozygous transgenic plants containg P35S:SNL1 (3- and -6) in response to different ABA concentrations. Percentages of seed germination are means (± SE) based on at least eight individual plants for each genotype. 3
4 1 8 Germination ratio (%) 6 4 Col snl1 snl-1 4# snl1 snl- 3# snl1 snl-1 16# snl1 snl-1 14# snl1 snl- 9# snl1 snl-1 11# snl1 snl- 13# snl1 snl-1 snl Weeks of after-ripening Supplemental Figure 4. Seed Germination Analysis of Different Double Mutant snl1 snl-1 and snl1 snl- Lines. Ratio of seed germination is mean (± SE) based on at least eight individual plants for each line. All the lines were grown and harvested in identical conditions. SE, standard error. 4
5 CFP-HDA19 YFP-SNL1 Mergerd Mergerd with bright Supplemental Figure 5. Nuclear Localizations of SNL1 and HDA19. Nuclear localizations of CFP-HDA19 and YFP-SNL1. The A. tumefaciens strains (GV311 with pm9rk) carrying the constructs pensg-cfp-hda19 and pensg-yfp-snl1 respectively were infiltrated into N. benthamiana leaves simultaneously, and the fluorescence signal was obtained after days infiltration. The photos from left to right show the fluorescence (CFP-HDA19, YFP-SNL1), merged fluorescence and merged fluorescence with bright image by Multiphoton Laser Scanning Microscope. These experiments were performed three times with similar results. 5
6 Germination ratio (%) Ler hda Weeks of after-ripening Germination ratio(%) weeks of after-ripening Ws hda19- Supplemental Figure 6. Seed Dormancy Phenotype of hda19 Mutants. The homozygous hda19-1 and hda19- mutants (Long et al., 6) were grown together with wild type Ler and Ws for seed germination analysis. Percentages of seed germination are means (± SE) based on at least eight individual plants for each genotype. This experiment was repeated three times with independent samples. 6
7 14 1 Up-regulated 1 1 Down-regulated Gene Number Dormancy related Germination related ABA Auxin Brassinosteroid Cytokinin Ethylene Gibberellin Jasmonic acid Seed storage proteins Inhib. of protein degradation Protein degradation Heat Shock Cell-wall modification Cell cycle related Cytoskeleton Translation associated DNA repair Respiration Electron Transport Pentose phosph. pathway Glyc. and gluconeogenesis Krebs cycle Beta oxidation Stress 4 15 Photosynthesis/chloroplast related Unannotated Supplemental Figure 7. The Number of Genes That Are Differentially Expressed in snl1 snl-1 Mutant Seed. The genes are categorized into groups based on known and predicted functions in the TAGGIT analysis. The data consist of genes that have a fold change 1.5 (log Ratio.6) and a FDR value.5. The complete list is presented in Supplemental Data Set 1 online. 7
8 4 35 Col snl-1 snl1 snl1 snl ACO5 ERF6 ERF8 ERF114 EXPB1 EXPA EXPA6 EXPA8 DREBB SNL1 SNL Supplemental Figure 8. Expression Patterns of Some Genes in snl Mutants in Table 1. The expressions of some hormone- and dormancy-related genes were validated by qrt-pcr. Total RNA was extracted from 1 h imbibed Col and mutant seeds. The mean values and SE were from three biological replicates and normalized using ACTIN8 as an internal control. The relative expression level in Col was set at one. For expression of SNL1 and SNL, the primers SNL1/-QF and SNL1/-QR were used in qrt-pcr (see Supplemental Table 1 online), which amplified the fragments before the T-DNA insertions in the gene locus respectively. 8
9 SNL1.1 μm 1 μm 1 μm SNL Concentration of ACC (μm) Supplemental Figure 9. Gene Expression of SNL1 and SNL in Response to ACC. Gene expression of SNL1 and SNL in response to increasing concentrations of ACC. Expression analysis was performed using qrt-pcr. Total RNA was extracted from Col seeds imbibed for 1 h with different ACC concentrations in a controlled incubator. The average value with SD was calculated from three independent experiments. The expression values of the individual genes were normalized using the expression level of ACTIN8 as internal standard. 9
10 A B snl1 snl-1 etr1- snl1 snl-1 etr1- Col 8 Col snl1 snl-1 etr1- etr1- snl1 snl-1 Hypocotyl lengh (mm) 6 4 Bar=1 mm Concentration of ACC (μm) Supplemental Figure 1. The etr1- Mutation Reduced the Triple Response of snl1 snl-1 to ACC. (A) Triple responses of etr1-, snl1 snl-1, snl1 snl-1 etr1- and Col to ACC. The plants were grown 3 days in MS medium without (top) and with (bottom) 1 μm ACC in dark at room temperature after 3 days at 4. The triple response was observed and the hypocotyl length of different lines was measured after 3 days in darkness ( ). Bar=1 mm. (B) The hypocotyl length of the different lines monitored for the triple response. This experiment was repeated three times and the average value is shown with SD (n=15). 1
11 A B Root length (cm) Bar=1 cm Col snl1 snl snl1 snl Concentration of ABA (μm) Supplemental Figure 11. The Sensitivity of Root Growth to ABA in the Mutants snl1, snl-1 and snl1 snl-1. (A) The post-germination phenotype of Col, snl1, snl-1 and snl1 snl-1 in response to increasing concentrations of ABA. Plants were transferred to a vertical MS plate after 3 days growth in a controlled incubator (16 h light, ), and the root growth was watched after 1 days in MS plate without (top) or with (bottom) 1μM ABA. (B) Root lengths after 1 days growth on vertical MS plates with different concentrations of ABA in a controlled incubator (16 h light, ). Three independent experiments were performed and similar results were obtained, representative data are displayed. Error bars denote SD (n>1). Bar=1.5 cm. 11
12 A B Germination ratio (%) Concentration of PAC (μm) GA4 contents(ng/g FW) Col col snl1 snl-1 snl1 snl-1 Supplemental Figure 1. GA Levels and Responses During Seed Germination in the snl Mutants. (A) Influence of PAC on the germination of mutants and Col. Percentages of seed germination are means (± SD) based on at least eight individual plants for each line. At least three independent experiments were performed and similar results were obtained. (B) The GA4 contents of fresh seeds from Col and mutants were determined by HPLC. This experiment was repeated three times and the average value is shown with SD. 1
13 4 3 1 ACO1 ACO4 ERF9 ERF15 ERF11 CYP77A1 CYP77A Supplemental Figure 13. Expression of Genes Involved in Ethylene and ABA Pathways in 7-Day-Old Seedlings of Col and snl Mutants. The average expression values are shown with SD and normalized using the expression level of ACTIN8 as an internal standard. Each experiment was repeated three times with independent samples and the relative level in Col was set at one. 13
14 ACO ACO ERF9.4.. ERF ERF11 Region 1.3 Region.6 Region Region 1.1 Region.8 Region Region 1.6 Region.1 Region Region 1.4 Region.8 Region Region 1.4 Region.1 Region CYP77A CYP77A Region 1.8 Region.3 Region Region 1.18 Region.6 Region Supplemental Figure 14. ChIP Assay of Up-regulated Key Genes Involved in the Ethylene and ABA Pathways in snl Mutants Using 18S as Internal Control Gene. 14
15 Up-regulated Down-regulated hub1 snl1snl hub1 snl1snl Supplemental Figure 15. Analysis of Overlapping Genes between hub1 and snl1 snl-1 that Are Up- and Down-regulated in Seeds Compared to Col. Venn diagrams of differentially expressed genes of hub1 were obtained from Liu et al. (11). 15
16 Primer name DNA sequence LP1 5 -TGCTGTGATTCACATCGAGAG-3 RP1 5 -CTGTCACTTCCGGAAGTGAAG-3 LP 5 - CTCTTCAAGCAAATCCGAGTG-3 RP 5 -TCCCGGAGTTATATCTCTGGG-3 LP3 5 - TTTGAAGGATGGTGATCTTGC-3 RP3 5 - TTCGCAGACAGAATTCTCTCG-3 SNL1-F 5 - AAAAAGCAGGCTTGATGAAGCGGATAAGAGATGAT-3 SNL1-R 5 -AGAAAGCTGGGTTTTAAGCTGAGAGAAACCTATGG-3 HDA19-F 5 -AAAAAGCAGGCTTAATGGATACTGGCGGCAATTCG-3 HDA19-R 5 -AGAAAGCTGGGTCTTATGTTTTAGGAGGAAACGCC-3 SNL1-QF 5 - GCGAGTGTTGCACTCCTAGCT -3 SNL1-QR 5 - TCTGCGCATGTGCTTAAAAGA -3 SNL-QF 5 - GAGATTATGCAGCCAAGATGA -3 SNL-QR 5 - CTCACAACGCTCAAAGAACTG -3 ACO1-PF 5 -GATGGCTAGGTCCATCGAAT-3 ACO1-PR 5 -TTTTGGGTCACTCCCATTGT-3 ACO1-QF () 5 -TGTCAGATCCCAAACATTTCAG-3 ACO1-QR () 5 - GGGTATTTAGCCACTTTTGTTCC -3 ACO1-CF (3) 5 -CCTATACCGCCATCCAAGAA-3 ACO1-CR (3) 5 -ACAAGAGCTTTGGAGCTGGA-3 ACO4-PF 5 -TGGATGTGTGTGGTCCAAAA-3 ACO4-PR 5 -GAAAAGAAGCGCAGAGAGGA-3 ACO4-CF () 5 -AACGACGTTGACTGGGAATC-3 ACO4-CR () 5 -GTCGTCGAGATCAGGGACAT-3 ACO4-QF (3) 5 -CCGGTTAAGCATTCAATCGT-3 ACO4-QR (3) 5 -AGAGTCGCTTCCCGGATTAT-3 ERF15-PF 5 -ACCCTCGCAAGAAAAAGACA-3 ERF15-PR 5 -TCTTGGGTTGGAGAGAGGAA-3 ERF15-QF () 5 -CAACTCTAAGCCAACGCAAAC-3 ERF15-QR () 5 -TCTGATCTCAGCCGCATACTT-3 ERF15-CF (3) 5 -AAGAGACAGGTGACGGAGGA-3 ERF15-CR (3) 5 -CAAAACCCCTTCCAACTTGA-3 ERF11-QF 5 -ACTCACTGGTCAACCCATCC-3 ERF11-QR 5 -CTTGTTCGGGTCACGAATCT-3 ERF11-PF 5 -TCTTTTGAGACACGCAATCG-3 ERF11-PR 5 -ACGCACACGCATGTATTTTGT-3 ERF11-CF () 5 -GCATGGCCTTGATCAAATAGA-3 ERF11-CR () 5 -CAACCAATAAAGCCGACAGG-3 ERF11-CF (3) 5 -AGATTCGTGACCCGAACAAG-3 16
17 ERF11-CR (3) ERF9-PF ERF9-PR ERF9-QF () ERF9-QR () ERF9-CF (3) ERF9-CR (3) CYP77A1-PF CYP77A1-PR CYP77A1-QF () CYP77A1-QR () CYP77A1-CF (3) CYP77A1-CR (3) CYP77A-PF CYP77A-PR CYP77A-QF () CYP77A-QR () CYP77A-CF (3) CYP77A-CR (3) DOG1-QF DOG1-QR FUS3-QF FUS3-QR ACO5-QF ACO5-QR ERF114-QF ERF114-QR ERF6-QF ERF6-QR ERF8-QF ERF8-QR EXPB1-QF EXPB1-QR EXPA6-QF EXPA6-QR EXPA-QF EXPA-QR EXPA8-QF EXPA8-QR NCED4-QF NCED4-QR DREBB-QF DREBB-QR 5 -TAAGCTTGGCCTTGTGACCT-3 5 -GCGTGAGATCAAGCAATCAA-3 5 -CGAGGGTTTGACTGAAAAGC-3 5 -AGAGAGTTTCGTGGCTCCAA-3 5 -GCATAACCACCGACGACTTT-3 5 -TTCGGTTTGATCCGGTTAAT-3 5 -CCGGTGGAGCTAGGTTAAGA-3 5 -CACGCTCTTTATGCATGCTC-3 5 -GAAGGGGTTTTATAGGCTAT-3 5 -TCCATCGCTCAAGACTCTCTCC-3 5 -ACCTCGTCTTTTCCGAAGATCG-3 5 -CAGAACGGTTCCTCACACAA-3 5 -TGTCTCTAGCGGCGAAGATT-3 5 -CCGTCGGCAAATTTTTGTAT-3 5 -TCATTCCTGGCCTTTCTTTC-3 5 -CAATTCCTTCTTCGCCACTCG-3 5 -GCCTCTGGTCCAATCATACGC-3 5 -AAAGGATCAAAAACGCAACG-3 5 -GATTGGGGTGGTCGTGTAAG-3 5 -TAGGCTCGTTTATGCTTTGTGTGG-3 5 -CGCACTTAAGTCGCTAAGTGATGC-3 5 -TGAATGCAAGGAAGGGATTC-3 5 -CACCTAGCTGCAGACCATGA-3 5 -CGCTAGAGCTTGCGAAGAGT-3 5 -TCTTCCCAGTCCACGTTTTC-3 5 -CAAGTTGCGCCTACTCATCA-3 5 -TTTTGGGTCTCGGATTTCAG-3 5 -GAAGCGGCTAGAGCTTACGA-3 5 -GTACAGGCCACGACCATCTT-3 5 -TGGCCAAAGCAAAGAGATTT-3 5 -AGAGAGGTTCGTCGCTGAGA-3 5 -CATGTGAACGCAGGATCAAC-3 5 -TGTGAGCTTCACGGAGAATG-3 5 -GGCTCTGATGCTTCTGGAAC-3 5 -CTGAGCAAAGTTCGGAGGAC-3 5 -ATGCACCCTCAACTTCTGCT-3 5 -CCCACATTTCTGCCCACTAT-3 5 -TTCCTCCAAGGAACTCATGG-3 5 -CTGTGACGGTGATGGTTGAC-3 5 -TCTCGCAACAGCTCTCTTCA-3 5 -AGAGTGCCGTGGATGATTTC-3 5 -ACGCTAGAAAGAACGCGAAA-3 5 -GCTCGAGCCCTAGATTTCCT-3 17
18 SNL1-QF SNL1-QR SNL-QF SNL-QR ACTIN8-QF ACTIN8-QR 18S-QF 18S-QR ATG839-QF ATG839-QR 5 -CGTCCTCTTGGTTCTTCTCG-3 5 -TACGACAACGCATCATTGGT-3 5 -CATAGGCAAATTCCGTCCTC-3 5 -CTCGAGTAAGAGCGGAATCG-3 5 -CTCAGGTATTGCAGACCGTATGAG-3 5 -CTGGACCTGCTTCATCATACTCTG-3 5 -GGTGGTGGTGCATGGCCGTTCTT-3 5 -GACGGGCGGTGTGTACAAAGGGC-3 5 -AACTCTATGCAGCATTTGATCCACT-3 5 -TGATTGCATATCTTTATCGCCATC-3 Supplemental Table 1. Primers for Mutant Genotyping, Plasmid Construction, QRT-PCR/Q-PCR and ChIP Assay. QF and QR: Primer for quantitative PCR PF and PR: primer for Chip q-pcr, amplifying fragment in promoter (region 1) CF and CR: primer for Chip q-pcr, amplifying fragment in enconding region () : primer for Chip, amplified fragment in enconding region (3) : primer for Chip, amplified fragment in enconding region 3 18
19 Supplemental Refferences: Long, J.A., Ohno, C., Smith, Z.R., and Meyerowitz, E.M. (6). Topless regulates apical embryonic fate in Arabidopsis. Science 31: Liu, Y., Geyer, R., van Zanten, M., Carles, A., Li, Y., Hörold, A., van Nocker, S., and Soppe, W.J.J. (11). Identification of the Arabidopsis REDUCED DORMANCY gene uncovers a role for the polymerase associated factor 1 complex in seed dormancy. PLoS ONE 6: e41. 19
Supplemental Data. Cui et al. (2012). Plant Cell /tpc a b c d. Stem UBC32 ACTIN
A Root Stem Leaf Flower Silique Senescence leaf B a b c d UBC32 ACTIN C * Supplemental Figure 1. Expression Pattern and Protein Sequence of UBC32 Homologues in Yeast, Human, and Arabidopsis. (A) Expression
Supplementary Information
Supplementary Information Supplementary Fig. 1. Seed dormancy and germination responses of RVE1 and PIF1. (a) Diagram of RVE1 and the T-DNA insertion of the rve1-2 mutant (SAIL_326_A01). Black boxes represent
Supplemental Figure 1. Rosette Leaf Morphology of Single, Double and Triple Mutants of eid3, phya-201 and phyb-5. Photographs of Ler wild type,
Supplemental Figure 1. Rosette Leaf Morphology of Single, Double and Triple Mutants of eid3, phya-201 and phyb-5. Photographs of Ler wild type, phya-201, phyb-5, phya-201 phyb-5, eid3, phya-201 eid3, phyb-5
A Repressor Complex Governs the Integration of
Developmental Cell 15 Supplemental Data A Repressor Complex Governs the Integration of Flowering Signals in Arabidopsis Dan Li, Chang Liu, Lisha Shen, Yang Wu, Hongyan Chen, Masumi Robertson, Chris A.
Supplementary Information
Supplementary Information MED18 interaction with distinct transcription factors regulates plant immunity, flowering time and responses to hormones Supplementary Figure 1. Diagram showing T-DNA insertion
Supplementary Fig 1. The responses of ERF109 to different hormones and stresses. (a to k) The induced expression of ERF109 in 7-day-old Arabidopsis
Supplementary Fig 1. The responses of ERF109 to different hormones and stresses. (a to k) The induced expression of ERF109 in 7-day-old Arabidopsis seedlings expressing ERF109pro-GUS. The GUS staining
A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Journal of Plant Research A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana Linna Leng 1 Qianqian Liang
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/5/244/ra72/dc1 Supplementary Materials for An Interaction Between BZR1 and DELLAs Mediates Direct Signaling Crosstalk Between Brassinosteroids and Gibberellins
Supplemental Data. Guo et al. (2015). Plant Cell /tpc
Supplemental Figure 1. The Mutant exb1-d Displayed Pleiotropic Phenotypes and Produced Branches in the Axils of Cotyledons. (A) Branches were developed in exb1-d but not in wild-type plants. (B) and (C)
Supplemental Data. Benstein et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Purification of the heterologously expressed PGDH1, PGDH2 and PGDH3 enzymes by Ni-NTA affinity chromatography. Protein extracts (2 µl) of different fractions (lane 1 = total extract,
Construction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
Supplemental Data. Huo et al. (2013). Plant Cell /tpc
Supplemental Data. Huo et al. (2013). Plant Cell 10.1105/tpc.112.108902 1 Supplemental Figure 1. Alignment of NCED4 Amino Acid Sequences from Different Lettuce Varieties. NCED4 amino acid sequences are
Supplementary Information. c d e
Supplementary Information a b c d e f Supplementary Figure 1. atabcg30, atabcg31, and atabcg40 mutant seeds germinate faster than the wild type on ½ MS medium supplemented with ABA (a and d-f) Germination
Supplementary Figure 1. BES1 specifically inhibits ABA responses in early seedling
Supplementary Figure 1. BES1 specifically inhibits ABA responses in early seedling development. a. Exogenous BR application overcomes the hypersensitivity of bzr1-1d seedlings to ABA. Seed germination
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Seeds of Col-0 were harvested from plants grown at 16 C, stored for 2 months, imbibed for indicated
Supplemental Materials
Supplemental Materials Supplemental Figure S. Phenotypic assessment of alb4 mutant plants under different stress conditions. (A) High-light stress and drought stress. Wild-type (WT) and alb4 mutant plants
Supplemental Data. Sethi et al. (2014). Plant Cell /tpc
Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes
Supplemental Data. Na Xu et al. (2016). Plant Cell /tpc
Supplemental Figure 1. The weak fluorescence phenotype is not caused by the mutation in At3g60240. (A) A mutation mapped to the gene At3g60240. Map-based cloning strategy was used to map the mutated site
S156AT168AY175A (AAA) were purified as GST-fusion proteins and incubated with GSTfused
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Supplemental Materials Supplemental Figure S1 (a) Phenotype of the wild type and grik1-2 grik2-1 plants after 8 days in darkness.
Supplemental Data. Liu et al. (2013). Plant Cell /tpc
Supplemental Figure 1. The GFP Tag Does Not Disturb the Physiological Functions of WDL3. (A) RT-PCR analysis of WDL3 expression in wild-type, WDL3-GFP, and WDL3 (without the GFP tag) transgenic seedlings.
Supplemental Figure 1. VLN5 retains conserved residues at both type 1 and type 2 Ca 2+ -binding
Supplemental Figure 1. VLN5 retains conserved residues at both type 1 and type 2 Ca 2+ -binding sites in the G1 domain. Multiple sequence alignment was performed with DNAMAN6.0.40. Secondary structural
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray
WiscDsLox485 ATG < > //----- E1 E2 E3 E4 E bp. Col-0 arr7 ARR7 ACTIN7. s of mrna/ng total RNA (x10 3 ) ARR7.
A WiscDsLox8 ATG < > -9 +0 > ---------//----- E E E E E UTR +9 UTR +0 > 00bp B S D ol-0 arr7 ol-0 arr7 ARR7 ATIN7 D s of mrna/ng total RNA opie 0. ol-0 (x0 ) arr7 ARR7 Supplemental Fig.. Genotyping and
Supplementary information
Supplementary information Supplementary figures Figure S1 Level of mycdet1 protein in DET1 OE-1, OE-2 and OE-3 transgenic lines. Total protein extract from wild type Col0, det1-1 mutant and DET1 OE lines
Supplemental data. Zhao et al. (2009). The Wuschel-related homeobox gene WOX11 is required to activate shoot-borne crown root development in rice.
Supplemental data. Zhao et al. (2009). The Wuschel-related homeobox gene WOX11 is required to activate shoot-borne crown root development in rice. A B Supplemental Figure 1. Expression of WOX11p-GUS WOX11-GFP
Supplemental Figure 1.
Supplemental Data. Charron et al. Dynamic landscapes of four histone modifications during de-etiolation in Arabidopsis. Plant Cell (2009). 10.1105/tpc.109.066845 Supplemental Figure 1. Immunodetection
Table S1. List of primers used in this study.
Gene/Construct/ mutant Primer name Sequence (5 ->3 ) Confimation of T-DNA insertion clh1-1 LBb1 5 GCGTGGACCGCTTGCTGCAACT3 1LP1 5 CCGAAAATGATAAATGCATGG3 1RP1 5 ATGTCCAGCTCGAAAGATTCC3 clh2-1 Lb4 5 CTACAAATTGCCTTTTCTTATCGAC3
Supplementary Figures 1-12
Supplementary Figures 1-12 Supplementary Figure 1. The specificity of anti-abi1 antibody. Total Proteins extracted from the wild type seedlings or abi1-3 null mutant seedlings were used for immunoblotting
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10928 Materials and Methods 1. Plant material and growth conditions. All plant lines used were in Col-0 background unless otherwise specified. pif4-101 mutant
Nature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.
Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements
SUPPLEMENTARY INFORMATION
DOI:.38/ncb54 sensitivity (+/-) 3 det- WS bri-5 BL (nm) bzr-dbri- bzr-d/ bri- g h i a b c d e f Hypcocotyl length(cm) 5 5 PAC Hypocotyl length (cm)..8..4. 5 5 PPZ - - + + + + - + - + - + PPZ - - + + +
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
Supplemental Data. Steiner et al. Plant Cell. (2012) /tpc
Supplemental Figure 1. SPY does not interact with free GST. Invitro pull-down assay using E. coli-expressed MBP-SPY and GST, GST-TCP14 and GST-TCP15. MBP-SPY was used as bait and incubated with equal amount
SUPPLEMENTARY INFORMATION
AS-NMD modulates FLM-dependent thermosensory flowering response in Arabidopsis NATURE PLANTS www.nature.com/natureplants 1 Supplementary Figure 1. Genomic sequence of FLM along with the splice sites. Sequencing
Supplemental Figure S1. Validation of auxin-related gene expression from Fig. 1A. Relative gene expression in 2x and 3x seeds 6 days after
Supplemental Figure S1. Validation of auxin-related gene expression from Fig. 1A. Relative gene expression in 2x and 3x seeds 6 days after pollination (6 DAP), as determined by RT-qPCR for YUC10 (A), YUC11
Supplemental Data. Dai et al. (2013). Plant Cell /tpc Absolute FyPP3. Absolute
A FyPP1 Absolute B FyPP3 Absolute Dry seeds Imbibed 24 hours Dry seeds Imbibed 24 hours C ABI5 Absolute Dry seeds Imbibed 24 hours Supplemental Figure 1. Expression of FyPP1, FyPP3 and ABI5 during seed
Alternative Cleavage and Polyadenylation of RNA
Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related
Supplemental Data. Hu et al. Plant Cell (2017) /tpc
1 2 3 4 Supplemental Figure 1. DNA gel blot analysis of homozygous transgenic plants. (Supports Figure 1.) 5 6 7 8 Rice genomic DNA was digested with the restriction enzymes EcoRⅠ and BamHⅠ. Lanes in the
Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh
Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon
AD BD TOC1. Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between
AD X BD TOC1 AD BD X PIFΔAD PIF TOC1 TOC1 PIFΔAD PIF N TOC1 TOC1 C1 PIFΔAD PIF C1 TOC1 TOC1 C PIFΔAD PIF C TOC1 Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between PIF and TOC1
Supplemental Data. Borg et al. Plant Cell (2014) /tpc
Supplementary Figure 1 - Alignment of selected angiosperm DAZ1 and DAZ2 homologs Multiple sequence alignment of selected DAZ1 and DAZ2 homologs. A consensus sequence built using default parameters is shown
Supplementary Figure 1 Collision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK2, PPK3 and PPK4 respectively.
Supplementary Figure 1 lision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK, PPK3 and PPK respectively. % of nuclei with signal / field a 5 c ppif3:gus pppk1:gus 0 35 30 5 0 15 10
Sperm cells are passive cargo of the pollen tube in plant fertilization
In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION VOLUME: 3 ARTICLE NUMBER: 17079 Sperm cells are passive cargo of the pollen tube in plant fertilization Jun Zhang 1, Qingpei
Supplemental Data. Zhang et al. Plant Cell (2014) /tpc
Supplemental Data. Zhang et al. Plant Cell (214) 1.115/tpc.114.134163 55 - T C N SDIRIP1-GFP 35-25 - Psb 18 - Histone H3 Supplemental Figure 1. Detection of SDIRIP1-GFP in the nuclear fraction by Western
ABI3 Controls Embryo De-greening Through Mendel's I locus
Supporting Online Material for ABI3 Controls Embryo De-greening Through Mendel's I locus Frédéric Delmas a,b,c, Subramanian Sankaranarayanan d, Srijani Deb d, Ellen Widdup d, Céline Bournonville b,c,norbert
Supplemental Data. Zhang et al. (2010). Plant Cell /tpc
Supplemental Figure 1. uvs90 gene cloning The T-DNA insertion in uvs90 was identified using thermal asymmetric interlaced (TAIL)-PCR. Three rounds of amplification were performed; the second (2 nd ) and
Supplemental Data. Farmer et al. (2010) Plant Cell /tpc
Supplemental Figure 1. Amino acid sequence comparison of RAD23 proteins. Identical and similar residues are shown in the black and gray boxes, respectively. Dots denote gaps. The sequence of plant Ub is
Supplemental Data. Lee et al. Plant Cell. (2010) /tpc Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2.
Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2. (A) Protein structures of DWA1 and DWA2. WD40 region was determined based on the NCBI conserved domain databases (B, C) Schematic representation
Supplemental materials
Supplemental materials Materials and methods for supplemental figures Yeast two-hybrid assays TAP46-PP2Ac interactions I. The TAP46 was used as the bait and the full-length cdnas of the five C subunits
- 1 - Supplemental Data
- 1-1 Supplemental Data 2 3 4 5 6 7 8 9 Supplemental Figure S1. Differential expression of AtPIP Genes in DC3000-inoculated plants. Gene expression in leaves was analyzed by real-time RT-PCR and expression
Supplemental Figure 1. Conserved regions of the kinase domain of PEPR1, PEPR2, CLV1 and BRI1.
Supplemental Figure 1. Conserved regions of the kinase domain of PEPR1, PEPR2, CLV1 and BRI1. The asterisks and colons indicate the important residues for ATP-binding pocket and substrate binding pocket,
Supplemental Data. Challa et al. (2016). Plant Cell /tpc
Supplemental Figure 1. DEX-induced TCP4 activity rescues jaw-d phenotypes. (A) and (B) Rosettess of 32-day-old Col-0;ProTCP4:mTCP4:GR plants (A) and jaw-d;protcp4:mtcp4:gr (B) plants grown in mock or in
Supplemental Materials
Supplemental Materials Flores-Pérez et al., Supplemental Materials, page 1 of 5 Supplemental Figure S1. Pull-down and BiFC controls, and quantitative analyses associated with the BiFC studies. (A) Controls
Supplemental Data. Osakabe et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Phylogenetic analysis of KUP in various species. The amino acid sequences of KUPs from green algae and land plants were identified with a BLAST search and aligned using ClustalW
Supplementary information, Figure S1
Supplementary information, Figure S1 (A) Schematic diagram of the sgrna and hspcas9 expression cassettes in a single binary vector designed for Agrobacterium-mediated stable transformation of Arabidopsis
Candidate region (0.74 Mb) ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC ATC TCT GGG ACT CAT TAG CAG GAG GCT AGC
A idm-3 idm-3 B Physical distance (Mb) 4.6 4.86.6 8.4 C Chr.3 Recom. Rate (%) ATG 3.9.9.9 9.74 Candidate region (.74 Mb) n=4 TAA D idm-3 G3T(E4) G4A(W988) WT idm-3 ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/27/rs8/dc1 Supplementary Materials for Genetics and Phosphoproteomics Reveal a Protein Phosphorylation Network in the Abscisic Acid Signaling Pathway in Arabidopsis
Supplemental Data. Tilbrook et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Protein alignment of with. Identical aligned residues highlighted in black and similar and non-similar residues highlighted in grey and white, respectively. Position of Trp residues
0.5% Sucrose. Supplemental Data. Chao et al. (2011). Plant Cell /tpc Col-0 tsc10a-2. Root length (mm)
A 0% 0.5% 1% Col-0 tsc10a-2 B Root length (mm) 35 30 25 20 15 10 5 0 0% 0.50% 1% 2% 4% Sucrose concentration 2% 4% Sucrose Col-0 tsc10a-2 Supplemental Figure 1. The effect of sucrose on root growth of
B. Transgenic plants with strong phenotype (%)
A. TCTAGTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTT AAATATGGTCTAAAGAAGAAGAATATGGTCTAAAGAAGAAGAATATGG 2XP35S STTM165 5 GGGGGATGAAGctaCCTGGTCCGA3 3 CCCCCUACUUC---GGACCAGGCU5 mir165 HindIII mir165 96 nt GTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTT
Supplemental Data. Furlan et al. Plant Cell (2017) /tpc
Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Figure.
Supplemental Figure 1. Transcript profiles of Arabidopsis IPMS1 and IPMS2 in different tissues and developmental stages.
Transcript level (intensity) Supplemental Data. Xing et al. Plant Cell (2017) 10.1105/tpc.17.00186 1600 1400 1200 1000 800 600 400 200 0 IPMS1 IPMS2 Supplemental Figure 1. Transcript profiles of Arabidopsis
Supplemental Data. Tang et al. Plant Cell. (2012) /tpc
Supplemental Figure 1. Relative Pchlide Fluorescence of Various Mutants and Wild Type. Seedlings were grown in darkness for 5 d. Experiments were repeated 3 times with same results. Supplemental Figure
Supplementary Figure 1
a b Supplementary Figure 1. Expression of AtSWEET13 and AtSWEET14. (a) Expression of AtSWEET13 and (b) AtSWEET14 obtained from Arabidopsis efp Browser (http://bar.utoronto.ca/efp/cgi-bin/efpweb.cgi) 1-3.
AD-FIL AD-YAB2 -2 BD-JAZ3 AD-YAB3 AD-YAB5 AD-FIL -4 3AT BD-JAZ3 AD-YAB3
3 4 9 10 11 12 AD-FIL AD-YAB5 2 B AD-YAB3 1 BD-JAZ 5 6 7 8 AD-FIL A AD-YAB2 Supplemental Data. Boter et al. (2015). Plant Cell 10.1105/tpc.15.00220 BD AD-YAB2-2 -2 BD-JAZ3 AD-YAB3 BD AD-YAB5-4 AD-FIL -4
Supplemental Data. Wu and Xue (2010). Plant Cell /tpc
Supplemental Data. Wu and Xue (21). Plant Cell 1.115/tpc.11.75564 A P1-S P1-A P2-S P2-A P3-S P3-A P4-S P4-A B Relative expression Relative expression C 5. 4.5 4. 3.5 3. 2.5 2. 1.5 1..5 5. 4.5 4. 3.5 3.
Supplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
Supplemental Data. Hachez et al. Plant Cell (2014) /tpc Suppl. Figure 1A
Suppl. Figure 1A Suppl. Figure 1B Supplemental Figure 1: Results of the commercial screening of interactants using split ubiquitin technique. (A) Isolated preys (192) using the bait construct pbt3-n- as
Supplementary Figure 1 PZA inhibits root hair formation as well as cell elongation in the maturation zone of eto1-2 roots. (A) The PI staining of the
Supplementary Figure 1 PZA inhibits root hair formation as well as cell elongation in the maturation zone of eto1-2 roots. (A) The PI staining of the roots of three-day-old etiolated seedlings of Col-0
Supplemental Figure 1. Floral commitment in Arabidopsis WT and mutants.
Percentage of induction Supplemental Data. Torti et al. (2012). Plant Cell 10.1105/tpc.111.092791 A +0 +0 LD LDs +1 LDs +3 +3 LDs +5 +5 LDs LD 50 μm AP1 B C 140 120 100 80 60 40 20 0-20 -40 wt Col soc1-2
Supplemental Data. Lin et al. Plant Cell. (2014) /tpc
Supplemental Figure 1. Scheme for extraction of polysome-mrna from in vitro germinated pollen (in vitro), pollinated (in vivo stage, ST14 and ST15a) and non-pollinated (Bud stage, ST10-12) floral buds.
Supplemental Data. Jing et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Characterization of epp1 Mutants. (A) Cotyledon angles of 5-d-old Col wild-type (gray bars) and epp1-1 (black bars) seedlings under red (R), far-red (FR) and blue (BL) light conditions,
Supplemental Data. Fan et al. (2014). Plant Cell /tpc
Supplemental Data. Fan et al. (). Plant Cell./tpc.. Cell wall EXP EXP EXP9 HLH/bHLH AIF HFR HBI PAR ABAR Atg778 At3g39 Atg38 Atg3 EXP EXP6 EXP8 Photosynthesis PSAD- PSAD- PSBY PSBO- PSAN LHCB6 PSBS LHCB
Supplemental Data. Sentandreu et al. (2011). Plant Cell /tpc
SUPPLEMENTAL ANALYSIS 1. Definition of the PIF3-regulated transcriptome in the dark. We applied an ANOVA approach using the Rosetta Resolver platform to look for genes whose expression was statistically
DAY 1 DAY 2 DAY 3. GUS activity. Time h (ZT) Cluster 1. Cluster 2 Cluster 3. Cluster 4. Cluster 5. Cluster 6
Supplemental Data. Giraud et al. (21). Plant Cell 1.115/tpc.11.74518 A) B) 6 5 4 3 2 1 DAY 1 2 15 1 5 IP SITE II DAY 2 7 6 5 4 3 2 1 IP SITE II DAY 3 IP SITE II ealtive transcript abundance 12 1 75 5 25
Supplementary Information
Supplementary Information ER-localized auxin transporter PIN8 regulates auxin homeostasis and male gametophyte development in Arabidopsis Supplemental Figures a 8 6 4 2 Absolute Expression b Absolute Expression
Supplementary Information
Supplementary Information COP1 E3 ligase protects HYL1 to retain microrna biogenesis Seok Keun Cho 1, Samir Ben Chaabane 1, Pratik Shah 1, Christian Peter Poulsen 1, and Seong Wook Yang 1 * 1 Laboratory
Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes
Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional
Design. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
A Nucleus-Encoded Chloroplast Protein YL1 Is Involved in Chloroplast. Development and Efficient Biogenesis of Chloroplast ATP Synthase in Rice
A Nucleus-Encoded Chloroplast Protein YL1 Is Involved in Chloroplast Development and Efficient Biogenesis of Chloroplast ATP Synthase in Rice Fei Chen 1,*, Guojun Dong 2,*, Limin Wu 1, Fang Wang 3, Xingzheng
Liu, Yang (2012) The characterization of a novel abscission-related gene in Arabidopsis thaliana. PhD thesis, University of Nottingham.
Liu, Yang (2012) The characterization of a novel abscission-related gene in Arabidopsis thaliana. PhD thesis, University of Nottingham. Access from the University of Nottingham repository: http://eprints.nottingham.ac.uk/12529/4/thesis_part_3_final.pdf
Identification and Characterization of a Plastidic Adenine. Nucleotide Uniporter (OsBT1-3) Required for Chloroplast
Identification and Characterization of a Plastidic Adenine Nucleotide Uniporter (OsBT1-3) Required for Chloroplast Development in the Early Leaf Stage of Rice Authors: Daoheng Hu 1, Yang Li 1, Wenbin Jin
Supplementary Information. The flowering gene SINGLE FLOWER TRUSS drives heterosis for yield in tomato
Supplementary Information The flowering gene SINGLE FLOWER TRUSS drives heterosis for yield in tomato Uri Krieger 1, Zachary B. Lippman 2 *, and Dani Zamir 1 * 1. The Hebrew University of Jerusalem Faculty
pmyrsaur78 psosein4+ psosetr1+ psosetr2+
SAUR77 SAUR78 SAUR76 Figure S1 Phylogenetic analysis of Arabidopsis SAUR proteins. The analyses were conducted in MEGA5, using the Neighbor-Joining method. The percentage of replicate trees in which the
Supplemental Figure 1. Phos-Tag mobility shift detection of in vivo phosphorylated ERF6 in 35S:ERF6 WT plants after B. cinerea inoculation.
Supplemental Figure 1. Phos-Tag mobility shift detection of in vivo phosphorylated ERF6 in 35S:ERF6 WT plants after B. cinerea inoculation. Protein extracts from 35S:ERF6 WT seedlings treated with B. cinerea
PIE1 ARP6 SWC6 KU70 ARP6 PIE1. HSA SNF2_N HELICc SANT. pie1-3 A1,A2 K1,K2 K1,K3 K3,LB2 A3, A4 A3,LB1 A1,A2 K1,K2 K1,K3. swc6-1 A3,A4.
A B N-terminal SWC2 H2A.Z SWC6 ARP6 PIE1 HSA SNF2_N HELICc SANT C pie1-3 D PIE1 ARP6 5 Kb A1 200 bp A3 A2 LB1 arp6-3 A4 E A1,A2 A3, A4 A3,LB1 K1,K2 K1,K3 K3,LB2 SWC6 swc6-1 A1,A2 A3,A4 K1,K2 K1,K3 100
kda
Relative VENUS/RFP fluorescence Relative fluorescence a min 2 min 4 min 6 min 8 min min Jas9-VENUS d kda 8 3 75 63 48 Jas9-VENUS Col- - + - + COR µm Jas9-VENUS 35 28 H2B-RFP 7 b c Overlay,2,8,6,4,2,6,4,2,8,6,4,2
Supplemental Data. Meng et al. (2011). Plant Cell /tpc B73 CML311 CML436. Gaspé Flint
Gaspé Flint B73 CML311 CML436 A B C D 10 th leaf 10 th leaf 10 th leaf Supplemental Figure 1. Whole plant images of the four varieties used in this study (A) Extreme early flowering temperate line Gaspé
SUPPLEMENTARY INFORMATION
Gene replacements and insertions in rice by intron targeting using CRISPR Cas9 Table of Contents Supplementary Figure 1. sgrna-induced targeted mutations in the OsEPSPS gene in rice protoplasts. Supplementary
Supplemental Figure 1. Mutation in NLA Causes Increased Pi Uptake Activity and
Supplemental Figure 1. Mutation in NLA Causes Increased Pi Uptake Activity and PHT1 Protein Amounts. (A) Shoot morphology of 19-day-old nla mutants under Pi-sufficient conditions. (B) [ 33 P]Pi uptake
Supplementary information, Data S1 MATERIALS AND METHODS. Growth of Arabidopsis and rice plants
Supplementary information, Data S1 MATERIALS AND METHODS Growth of Arabidopsis and rice plants Arabidopsis thaliana ecotype Columbia (Col-0) was used in all experiments. Seeds were sown on MS plates and
Using mutants to clone genes
Using mutants to clone genes Objectives: 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype
PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF
YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract
Supplemental Figure 1
Supplemental Figure 1 A LK sls1 lks1-2 F 1 sls1 B LK sls1 lks1-2 F 1 lks1-2 sls1 F 1 lks1-2 sls1 F 2 Col lks1-2 Col+LKS1 Col Col+LKS1 Supplemental Figure 1. Genetic analysis of sls1 mutant. (A) and (B)
Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene. Andrew ElBardissi, The Pennsylvania State University
Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene Andrew ElBardissi, The Pennsylvania State University Abstract: Hong Ma, The Pennsylvania State University The Excess Microsporocytes
Supplemental Data. Zhou et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Confirmation of mutant mapping results. (A) Complementation assay with stably transformed genomic fragments (ComN-N) (2 kb upstream of TSS and 1.5 kb downstream of TES) and CaMV
Gene specific primers. Left border primer (638) ala3-4 (Salk_082157) Gene specific primers. Left border primer (1343)
Supplemental Data. Poulsen et al. (2008) The Arabidopsis P4-ATPase pump ALA3 localizes to the Golgi and requires a β subunit to function in lipid translocation and secretory vesicle formation. A ala3-1
Supporting Information
Supporting Information Deng et al. 10.1073/pnas.1102117108 Fig. S1. Predicted structure of Arabidopsis bzip60 RNA. Lowest free energy form (ΔG = 309.72 (initially 343.10) of bzip60 mrna folded by M-Fold
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity.
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity. (A) Amino acid alignment of HDA5, HDA15 and HDA18. The blue line
(b) Genotyping of SALK_ (AT1g51690) and SALK_ (At1g17720) to find homozygous single mutant plants.
Supplemental Table 1. Primers used for cloning and RT-PCR. The B-type subunits cdna CDS were amplified using high-fidelity PCR amplification with gene specific primers. The cdna CDS sequences were obtained