Randomized. Regulators
|
|
- Millicent Waters
- 5 years ago
- Views:
Transcription
1 Harbison et al. Supplementary Figure Number of promoter regions bound Actual Randomized Regulators Distribution of the number of promoter regions bound per regulator (blue). For regulators profiled under multiple conditions, the union of promoter regions bound under all conditions is reported. An average of randomized distributions for the same set of P values randomly assigned among regulators and promoter regions is shown in pink.
2 Harbison et al. Supplementary Figure 2 1 AlignACE CONVERGE Kellis MDScan MEME MEME_c 68,279 Motifs 147 Regulators 2 Scoring and Significance Testing 4259 Motifs 116 Regulators 3 Clustering and Averaging Motifs 116 Regulators Conservation Testing 283 Motifs 82 Regulators 5 Assignment of Single Motif to Each Regulator 65 Motifs/Regulators Overview of motif discovery and assignment. Motifs were identified by applying a suite of motif discovery programs to the intergenic sequences identified by the binding data. The resulting specificity predictions were filtered for significance and then clustered to yield representative motifs. Conservation-based metrics were used to identify the highest-confidence subset of these motifs. For cases in which multiple significant binding motifs were found for a factor, we used statistical scores or information from specificity databases to choose a single motif for each regulator. A complete description of the method can be found in Supplementary Methods.
3 Harbison et al. Supplementary Figure 3 No competitor TTACNTAA TTACTAA Comparison of Cin5 binding to two sequences. Recombinant Cin5 was purified from bacteria and incubated with a Cy5-labeled oligonucleotide containing the sequence (gcgacattacctaagggc) and challenged with one of two unlabeled competitors: the same sequence (lanes 2-8) or the previoulsy published binding site (gcgacattactaaagggc; lanes 9-15). The concentration of each competitor was varied in 3-fold steps. The probe based on our discovered motif was approximately 27-fold better in competing away the shifted band compared to the probe based on the previously published specificity. Similar results were obtained for a probe containing a core sequence of TTACGTAA.
4 Harbison et al. Supplementary Figure Number of promoter regions bound Rich medium Gln3 Amino acid starvation Fhl1 Gcn4 Met32 Bas1 Gcr2 Dal81 Rcs1 Pho2 Arg80 Aro80 Rtg3 Arg81 Met31 Stp1 Gln3 Put3 Sip4 Dal82 Cbf1 Rph1 Cha4 Gat1 Met4 Rtg1 Uga3 Regulators Pairwise comparison of the number of promoter regions bound under two different conditions for 25 regulators (based solely on genome-wide location data with P 0.001). Dark blue bars represent the number of promoter regions bound under growth in rich medium; light blue bars represent the number of promoter regions bound under growth in amino acid starvation medium.
5 Harbison et al. Supplementary Figure Background Bound only in amino acid starvation Bound in rich growth Frequency (%) Score [% maximum] of matching sites 0% 0%-33% 33%-66% 66%-100% Consensus of matching sites for each score Quality of Gcn4 binding sites among intergenic regions bound under different conditions. Each intergenic region was scored based on the quality of the best matching subsequence to the Gcn4 binding specificity (TGASTCA). In rich media conditions 68% of the intergenic regions contain high-quality matches to the Gcn4 specificity. Under starvation conditions the levels of Gcn4 protein rise, and the set of bound intergenic regions expands. Of the newly bound regions, only 27% contain high-quality matches. By contrast, only 3% of all intergenic regions contain matches of this quality.
Transcriptional Regulatory Code of a Eukaryotic Genome
Supplementary Information for Transcriptional Regulatory Code of a Eukaryotic Genome Christopher T. Harbison 1,2*, D. Benjamin Gordon 1*, Tong Ihn Lee 1, Nicola J. Rinaldi 1,2, Kenzie Macisaac 3, Timothy
More informationMotifs. BCH339N - Systems Biology / Bioinformatics Edward Marcotte, Univ of Texas at Austin
Motifs BCH339N - Systems Biology / Bioinformatics Edward Marcotte, Univ of Texas at Austin An example transcriptional regulatory cascade Here, controlling Salmonella bacteria multidrug resistance Sequencespecific
More informationSupplementary Information. Arrays of Individual DNA Molecules on Nanopatterned Substrates
Supplementary Information Arrays of Individual DNA Molecules on Nanopatterned Substrates Roland Hager, Alma Halilovic, Jonathan R. Burns, Friedrich Schäffler, Stefan Howorka S1 Figure S-1. Characterization
More informationNature Methods: doi: /nmeth Supplementary Figure 1. Construction of a sensitive TetR mediated auxotrophic off-switch.
Supplementary Figure 1 Construction of a sensitive TetR mediated auxotrophic off-switch. A Production of the Tet repressor in yeast when conjugated to either the LexA4 or LexA8 promoter DNA binding sequences.
More informationDiscovering Motifs in Ranked Lists of DNA Sequences
of DNA Sequences Eran Eden 1*, Doron Lipson 1, Sivan Yogev 1,2, Zohar Yakhini 1,3* 1 Computer Science Department, Technion, Haifa, Israel, 2 IBM Research Laboratories, Haifa, Israel 3 Agilent Laboratories,
More informationSupporting Information
Supporting Information Supplementary Figure-1 Results of Phage Display Screening Against TNT The sequences seen in Supplementary Figure-1 represent the phages sequenced after the third and fourth rounds
More informationBayesian Variable Selection and Data Integration for Biological Regulatory Networks
Bayesian Variable Selection and Data Integration for Biological Regulatory Networks Shane T. Jensen Department of Statistics The Wharton School, University of Pennsylvania stjensen@wharton.upenn.edu Gary
More informationmrna Sequencing Quality Control (V6)
mrna Sequencing Quality Control (V6) Notes: the following analyses are based on 8 adult brains sequenced in USC and Yale 1. Error Rates The error rates of each sequencing cycle are reported for 120 tiles
More informationHigh resolution models of transcription factor-dna affinities improve in vitro and in vivo binding predictions: supplementary methods
High resolution models of transcription factor-dna affinities improve in vitro and in vivo binding predictions: supplementary methods Phaedra Agius 1, Aaron Arvey 1, William Chang 1, William Stafford Noble
More informationInferring gene regulatory logic from high-throughput measurements of thousands of systematically designed promoters
Inferring gene regulatory logic from high-throughput measurements of thousands of systematically designed promoters Eilon Sharon,,5, Yael Kalma,,5, Ayala Sharp, ali Raveh-Sadka, Michal Levo, Danny Zeevi,,
More informationProblem Set 8. Answer Key
MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no
More informationMeta-analysis discovery of. tissue-specific DNA sequence motifs. from mammalian gene expression data
Meta-analysis discovery of tissue-specific DNA sequence motifs from mammalian gene expression data Bertrand R. Huber 1,3 and Martha L. Bulyk 1,2,3 1 Division of Genetics, Department of Medicine, 2 Department
More informationIn 1996, the genome of Saccharomyces cerevisiae was completed due to the work of
Summary: Kellis, M. et al. Nature 423,241-253. Background In 1996, the genome of Saccharomyces cerevisiae was completed due to the work of approximately 600 scientists world-wide. This group of researchers
More information1 Najafabadi, H. S. et al. C2H2 zinc finger proteins greatly expand the human regulatory lexicon. Nat Biotechnol doi: /nbt.3128 (2015).
F op-scoring motif Optimized motifs E Input sequences entral 1 bp region Dinucleotideshuffled seqs B D ll B1H-R predicted motifs Enriched B1H- R predicted motifs L!=!7! L!=!6! L!=5! L!=!4! L!=!3! L!=!2!
More informationSupplementary Figure 1. NORAD expression in mouse (A) and dog (B). The black boxes indicate the position of the regions alignable to the 12 repeat
Supplementary Figure 1. NORAD expression in mouse (A) and dog (B). The black boxes indicate the position of the regions alignable to the 12 repeat units in the human genome. Annotated transposable elements
More informationSite-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter
Supplement Supporting Materials and Methods Site-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter were independently generated using a two-step PCR method. The Smad4 binding site
More informationRPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification.
RPA-AB RPA-C (a) (b) (c) (d) (e) (f) Supplemental Figure S: SDS-PAGE stained with Coomassie Blue after protein purification. (a) RPA; (b) RPA-AB; (c) RPA-CDE; (d) RPA-CDE core; (e) RPA-DE; and (f) RPA-C
More informationECS 234: Genomic Data Integration ECS 234
: Genomic Data Integration Heterogeneous Data Integration DNA Sequence Microarray Proteomics >gi 12004594 gb AF217406.1 Saccharomyces cerevisiae uridine nucleosidase (URH1) gene, complete cds ATGGAATCTGCTGATTTTTTTACCTCACGAAACTTATTAAAACAGATAATTTCCCTCATCTGCAAGGTTG
More informationSUPPLEMENTARY INFORMATION
doi:138/nature10532 a Human b Platypus Density 0.0 0.2 0.4 0.6 0.8 Ensembl protein coding Ensembl lincrna New exons (protein coding) Intergenic multi exonic loci Density 0.0 0.1 0.2 0.3 0.4 0.5 0 5 10
More informationMicroarrays & Gene Expression Analysis
Microarrays & Gene Expression Analysis Contents DNA microarray technique Why measure gene expression Clustering algorithms Relation to Cancer SAGE SBH Sequencing By Hybridization DNA Microarrays 1. Developed
More informationb number of motif occurrences
supplementary information DOI: 1.138/ncb194 a b number of motif occurrences number of motif occurrences number of motif occurrences I II III IV V X TTGGTCAGTGCA 3 8 23 4 13 239 TTGGTCAGTGCT 7 5 8 1 3 83
More informationIdentification of individual motifs on the genome scale. Some slides are from Mayukh Bhaowal
Identification of individual motifs on the genome scale Some slides are from Mayukh Bhaowal Two papers Nature 423, 241-254 (15 May 2003) Sequencing and comparison of yeast species to identify genes and
More informationMethods and tools for exploring functional genomics data
Methods and tools for exploring functional genomics data William Stafford Noble Department of Genome Sciences Department of Computer Science and Engineering University of Washington Outline Searching for
More informationColeman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
More informationDeep sequencing reveals global patterns of mrna recruitment
Supplementary information for: Deep sequencing reveals global patterns of mrna recruitment during translation initiation Rong Gao 1#*, Kai Yu 1#, Ju-Kui Nie 1,Teng-Fei Lian 1, Jian-Shi Jin 1, Anders Liljas
More informationProcedia - Social and Behavioral Sciences 97 ( 2013 )
Available online at www.sciencedirect.com ScienceDirect Procedia - Social and Behavioral Sciences 97 ( 2013 ) 602 611 Abstract The 9 th International Conference on Cognitive Science Filtering of background
More informationA Repressor Complex Governs the Integration of
Developmental Cell 15 Supplemental Data A Repressor Complex Governs the Integration of Flowering Signals in Arabidopsis Dan Li, Chang Liu, Lisha Shen, Yang Wu, Hongyan Chen, Masumi Robertson, Chris A.
More informationSupplementary Information
Supplementary Information Supplementary Figure 1: Synthetic annealed poly(ra):poly(dt) hybrid induces type I interferon response. a) Bone marrow derived macrophages (BMDM) were transfected with or without
More informationMotif Discovery from Large Number of Sequences: a Case Study with Disease Resistance Genes in Arabidopsis thaliana
Motif Discovery from Large Number of Sequences: a Case Study with Disease Resistance Genes in Arabidopsis thaliana Irfan Gunduz, Sihui Zhao, Mehmet Dalkilic and Sun Kim Indiana University, School of Informatics
More informationLimitations and potentials of current motif discovery algorithms
Published online September 2, 2005 Limitations and potentials of current motif discovery algorithms Jianjun Hu 1,2, Bin Li 2 and Daisuke Kihara 1,2,3,4, * Nucleic Acids Research, 2005, Vol. 33, No. 15
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Conserved arginines on the rim of Hfq catalyze base pair formation and exchange Subrata Panja and Sarah A. Woodson T.C. Jenkins Department of Biophysics, Johns Hopkins University,
More informationLecture 7 Motif Databases and Gene Finding
Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 7 Motif Databases and Gene Finding Motif Databases & Gene Finding Motifs Recap Motif Databases TRANSFAC
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11726 Supplementary Figure 1 SRP RNA constructs used in single molecule experiments. a, Secondary structure of wildtype E. coli SRP RNA, which forms an elongated hairpin structure capped
More informationSupporting Information Defined Bilayer Interactions of DNA Nanopores Revealed with a Nuclease-Based Nanoprobe Strategy
Supporting Information Defined Bilayer Interactions of DNA Nanopores Revealed with a Nuclease-Based Nanoprobe Strategy Jonathan R. Burns* & Stefan Howorka* 1 Contents 1. Design of DNA nanopores... 3 1.1.
More informationSUPPLEMENTARY INFORMATION
18Pura Brain Liver 2 kb 9Mtmr Heart Brain 1.4 kb 15Ppara 1.5 kb IPTpcc 1.3 kb GAPDH 1.5 kb IPGpr1 2 kb GAPDH 1.5 kb 17Tcte 13Elov12 Lung Thymus 6 kb 5 kb 17Tbcc Kidney Embryo 4.5 kb 3.7 kb GAPDH 1.5 kb
More informationGenome-Wide Survey of MicroRNA - Transcription Factor Feed-Forward Regulatory Circuits in Human. Supporting Information
Genome-Wide Survey of MicroRNA - Transcription Factor Feed-Forward Regulatory Circuits in Human Angela Re #, Davide Corá #, Daniela Taverna and Michele Caselle # equal contribution * corresponding author,
More informationEnhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme
Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the
More informationZhang et al., RepID facilitates replication Initiation. Supplemental Information:
Supplemental Information: a b 1 Supplementary Figure 1 (a) DNA sequence of all the oligonucleotides used in this study. Only one strand is shown. The unshaded nucleotide sequences show changes from the
More informationSolutions to 7.02 Quiz II 10/27/05
Solutions to 7.02 Quiz II 10/27/05 Class Average = 83 Standard Deviation = 9 Range Grade % 87-100 A 43 74-86 B 39 55-73 C 17 > 54 D 1 Question 1 (56 points) While studying deep sea bacteria, you discover
More informationLearning Methods for DNA Binding in Computational Biology
Learning Methods for DNA Binding in Computational Biology Mark Kon Dustin Holloway Yue Fan Chaitanya Sai Charles DeLisi Boston University IJCNN Orlando August 16, 2007 Outline Background on Transcription
More informationVisualization of codon-dependent conformational rearrangements during translation termination
Supplementary information for: Visualization of codon-dependent conformational rearrangements during translation termination Shan L. He 1 and Rachel Green 1 1 Howard Hughes Medical Institute, Department
More informationPolyadenylation Site Choice In Yeast Is Affected By. Competition Between Npl3 And Polyadenylation Factor CFI
Supplemental Data for: Polyadenylation Site Choice In Yeast Is Affected By Competition Between And Polyadenylation Factor CFI Miriam E. Bucheli 1, Xiaoyuan He 2,**, Craig D. Kaplan 3, Claire L. Moore 2
More informationSingle-molecule imaging of DNA curtains reveals intrinsic energy landscapes for nucleosome deposition
SUPPLEMENTARY INFORMATION Single-molecule imaging of DNA curtains reveals intrinsic energy landscapes for nucleosome deposition Mari-Liis Visnapuu 1 and Eric C. Greene 1 1 Department of Biochemistry &
More informationWebMOTIFS: Automated discovery, filtering, and scoring of DNA sequence motifs using multiple programs and Bayesian approaches
WebMOTIFS: Automated discovery, filtering, and scoring of DNA sequence motifs using multiple programs and Bayesian approaches Katherine A. Romer 1, Guy-Richard Kayombya 1, Ernest Fraenkel 2,3 1 Department
More informationViral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover
Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and
More informationEnhancers. Activators and repressors of transcription
Enhancers Can be >50 kb away from the gene they regulate. Can be upstream from a promoter, downstream from a promoter, within an intron, or even downstream of the final exon of a gene. Are often cell type
More informationGiri Narasimhan. CAP 5510: Introduction to Bioinformatics. ECS 254; Phone: x3748
CAP 5510: Introduction to Bioinformatics Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs07.html 2/8/07 CAP5510 1 Pattern Discovery 2/8/07 CAP5510 2 What we have
More informationregression t value two sample t values regression line
Suppl. Table 1: Testing SCRE sequence information without the structural constraint SCRE t test on difference of coefficients SCRE t value sequence only t value Dm1 6.62 6.84 1.29 Dm2 7.06 7.46 1.84 Dm3
More informationSupplemental Data. Sethi et al. (2014). Plant Cell /tpc
Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/167/ra20/dc1 Supplementary Materials for Poly(ADP-Ribose) (PAR) Binding to Apoptosis-Inducing Factor Is Critical for PAR Polymerase-1 Dependent Cell Death (Parthanatos)
More informationSupplementary Materials. for. array reveals biophysical and evolutionary landscapes
Supplementary Materials for Quantitative analysis of RNA- protein interactions on a massively parallel array reveals biophysical and evolutionary landscapes Jason D. Buenrostro 1,2,4, Carlos L. Araya 1,4,
More information466 Asn (N) to Ala (A) Generate beta dimer Interface
Table S1: Amino acid changes to the HexA α-subunit to convert the dimer interface from α to β and to introduce the putative GM2A binding surface from β- onto the α- subunit Residue position (α-numbering)
More informationTITLE: Restoration of Wild-Type Activity to Mutant p53 in Prostate Cancer: A Novel Therapeutic Approach
AD Award Number: W81XWH-05-1-0109 TITLE: Restoration of Wild-Type Activity to Mutant p53 in Prostate Cancer: A Novel Therapeutic Approach PRINCIPAL INVESTIGATOR: James Manfredi, Ph.D. CONTRACTING ORGANIZATION:
More informationGenome-Scale Predictions of the Transcription Factor Binding Sites of Cys 2 His 2 Zinc Finger Proteins in Yeast June 17 th, 2005
Genome-Scale Predictions of the Transcription Factor Binding Sites of Cys 2 His 2 Zinc Finger Proteins in Yeast June 17 th, 2005 John Brothers II 1,3 and Panayiotis V. Benos 1,2 1 Bioengineering and Bioinformatics
More informationSupporting Online Material
Supporting Online Material Table of contents 1 Supplementary figure 1 2 Supplementary figure 2 3 Supplementary figure 3 4 Supplementary figure 4 5 Supplementary figure 5 6 Supplementary figure 6 7 Supplementary
More information6-Foot Mini Toober Activity
Big Idea The interaction between the substrate and enzyme is highly specific. Even a slight change in shape of either the substrate or the enzyme may alter the efficient and selective ability of the enzyme
More informationTranscription Gene regulation
Transcription Gene regulation The machine that transcribes a gene is composed of perhaps 50 proteins, including RNA polymerase, the enzyme that converts DNA code into RNA code. A crew of transcription
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Processing of mutations and generation of simulated controls. On the left, a diagram illustrates the manner in which covariate-matched simulated mutations were obtained, filtered
More informationÜbung V. Einführung, Teil 1. Transktiptionelle Regulation TFBS
Übung V Einführung, Teil 1 Transktiptionelle Regulation TFBS Transcription Factors These proteins promote transcription 1. Bind DNA 2. Activate Transcription These two functions usually reside on separate
More informationOligonucleotides were purchased from Eurogentec, purified by denaturing gel electrophoresis
SUPPLEMENRY INFORMION Purification of probes and Oligonucleotides sequence Oligonucleotides were purchased from Eurogentec, purified by denaturing gel electrophoresis and recovered by electroelution. Labelling
More informationIntracellular receptors specify complex patterns of gene expression that are cell and gene
SUPPLEMENTAL RESULTS AND DISCUSSION Some HPr-1AR ARE-containing Genes Are Unresponsive to Androgen Intracellular receptors specify complex patterns of gene expression that are cell and gene specific. For
More informationSupplementary information Bi-specific Aptamers mediating Tumour Cell Lysis
Supplementary information Bi-specific Aptamers mediating Tumour Cell Lysis Figure S1 SELEX scheme of different CD16 DNA selection approaches. Nine rounds of filter SELEX were conducted in parallel, only
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature06147 SUPPLEMENTARY INFORMATION Figure S1 The genomic and domain structure of Dscam. The Dscam gene comprises 24 exons, encoding a signal peptide (SP), 10 IgSF domains, 6 fibronectin
More informationHossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
More informationSupplementary Figure 1 Telomerase RNA fragments used in single-molecule FRET experiments. A pseudoknot fragment (nts ) labeled at position U42
Supplementary Figure 1 Telomerase RNA fragments used in single-molecule FRET experiments. A pseudoknot fragment (nts 32-195) labeled at position U42 with Cy3 (green circle) was constructed by a two piece
More informationSequence Alignments. Week 3
Sequence Alignments Week 3 Independent Project Gene Due: 9/25 (Monday--must be submitted by email) Rough Draft Due: 11/13 (hard copy due at the beginning of class, and emailed to me) Final Version Due:
More informationSupplementary Figure 1: Two modes of low concentration of BsSMC on a DNA (a) Protein staining (left) and fluorescent imaging of Cy3 (right) confirm
Supplementary Figure 1: Two modes of low concentration of BsSMC on a DNA (a) Protein staining (left) and fluorescent imaging of Cy3 (right) confirm that BsSMC was labeled with Cy3 NHS-Ester. In each panel,
More informationB. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
More informationC2H2 zinc finger proteins greatly expand the human regulatory lexicon
Supplementary Information for: C2H2 zinc finger proteins greatly expand the human regulatory lexicon Hamed S. Najafabadi*,1, Sanie Mnaimneh*,1, Frank W. Schmitges*,1, Michael Garton 1, Kathy N. Lam 2,
More informationNature Methods: doi: /nmeth Supplementary Figure 1. Pilot CrY2H-seq experiments to confirm strain and plasmid functionality.
Supplementary Figure 1 Pilot CrY2H-seq experiments to confirm strain and plasmid functionality. (a) RT-PCR on HIS3 positive diploid cell lysate containing known interaction partners AT3G62420 (bzip53)
More informationSupplemental Data. Zhou et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Confirmation of mutant mapping results. (A) Complementation assay with stably transformed genomic fragments (ComN-N) (2 kb upstream of TSS and 1.5 kb downstream of TES) and CaMV
More informationChIP. November 21, 2017
ChIP November 21, 2017 functional signals: is DNA enough? what is the smallest number of letters used by a written language? DNA is only one part of the functional genome DNA is heavily bound by proteins,
More informationCFTR-null wt CFTR-null 1.0. Probe: Neo R. Figure S1
A. B. 4.0 3.0 2.0 1.0 4.0 3.0 2.0 1.0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Probe: Neo R CFTR-null wt CFTR-null Figure S1 A. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 10kb 8kb CFTR-null wt B. Probe: CFTR
More informationGene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis
Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods
More informationSemi-conservative replication DNA Helicases DNA polymerases Transcription Codon Messenger RNA Transfer RNA. Molecular Genetics Unit
Name: Unit 7 Molecular Genetics Students will be able to: Theme: DNA Heredity 6.1 Understand the structure and role of DNA Explain the structure of DNA (monomer and polymer) Discuss the process of DNA
More informationAnswers to Module 1. An obligate aerobe is an organism that has an absolute requirement of oxygen for growth.
Answers to Module 1 Short Answers 1) What is an obligate aerobe? An obligate aerobe is an organism that has an absolute requirement of oxygen for growth. What about facultative anaerobe? 2) Distinguish
More informationSupplementary Information to: Genome-wide Real-time in vivo Transcriptional Dynamics During Plasmodium falciparum. Blood-stage Development
Supplementary Information to: Genome-wide Real-time in vivo Transcriptional Dynamics During Plasmodium falciparum Blood-stage Development Painter et al. 1 of 8 Supplementary Figure 1: Supplementary Figure
More informationSUPPLEMENTAL MATERIALS
SUPPLEMENL MERILS Eh-seq: RISPR epitope tagging hip-seq of DN-binding proteins Daniel Savic, E. hristopher Partridge, Kimberly M. Newberry, Sophia. Smith, Sarah K. Meadows, rian S. Roberts, Mark Mackiewicz,
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1154040/dc1 Supporting Online Material for Selective Blockade of MicroRNA Processing by Lin-28 Srinivas R. Viswanathan, George Q. Daley,* Richard I. Gregory* *To whom
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. sndrop-seq overview.
Supplementary Figure 1 sndrop-seq overview. A. sndrop-seq method showing modifications needed to process nuclei, including bovine serum albumin (BSA) coating and droplet heating to ensure complete nuclear
More informationMechanism of Transcription Termination by RNA Polymerase III Utilizes a Non-template Strand Sequence-Specific Signal Element
Molecular Cell Supplemental Information Mechanism of ranscription ermination by RNA Polymerase III Utilizes a Non-template Strand Sequence-Specific Signal Element Aneeshkumar G. Arimbasseri and Richard
More information1) The penicillin family of antibiotics, discovered by Alexander Fleming in 1928, has the following general structure: O O
ame: TF ame: LS1a Fall 06 Problem Set #3 Due Friday 10/13 at noon in your TF s drop box on the 2 nd floor of the Science Center All questions including the (*extra*) ones should be turned in 1) The penicillin
More informationWordSpy: identifying transcription factor binding motifs by building a dictionary and learning a grammar
W412 W416 Nucleic Acids Research, 2005, Vol. 33, Web Server issue doi:10.1093/nar/gki492 WordSpy: identifying transcription factor binding motifs by building a dictionary and learning a grammar Guandong
More informationThe Stringent Response
The Stringent Response When amino acids are limiting a response is triggered to shut down a wide range of biosynthetic processes This process is called the Stringent Response It results in the synthesis
More informationGene Prediction Group
Group Ben, Jasreet, Jeff, Jia, Kunal TACCTGAAAAAGCACATAATACTTATGCGTATCCGCCCTAAACACTGCCTTCTTTCTCAA AGAAGATGTCGCCGCTTTTCAACCGAACGATGTGTTCTTCGCCGTTTTCTCGGTAGTGCA TATCGATGATTCACGTTTCGGCAGTGCAGGCACCGGCGCATATTCAGGATACCGGACGCT
More informationNature Genetics: doi: /ng Supplementary Figure 1. Neighbor-joining tree of the 183 wild, cultivated, and weedy rice accessions.
Supplementary Figure 1 Neighbor-joining tree of the 183 wild, cultivated, and weedy rice accessions. Relationships of cultivated and wild rice correspond to previously observed relationships 40. Wild rice
More informationMolecular Biology (BIOL 4320) Exam #1 March 12, 2002
Molecular Biology (BIOL 4320) Exam #1 March 12, 2002 Name KEY SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses after the question number.
More informationName Section Problem Set 3
Name Section 7.013 Problem Set 3 The completed problem must be turned into the wood box outside 68120 by 4:40 pm, Thursday, March 13. Problem sets will not be accepted late. Question 1 Based upon your
More informationThyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation
1 2 3 4 5 SUPPLEMENTAL DATA Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation Magalí Nazar, Juan Pablo Nicola, María Laura
More informationFile S1. Program overview and features
File S1 Program overview and features Query list filtering. Further filtering may be applied through user selected query lists (Figure. 2B, Table S3) that restrict the results and/or report specifically
More informationUsing Weighted Set Cover to Identify Biologically Significant Motifs. A thesis presented to. the faculty of. In partial fulfillment
Using Weighted Set Cover to Identify Biologically Significant Motifs A thesis presented to the faculty of the Russ College of Engineering and Technology of Ohio University In partial fulfillment of the
More informationProblem Set 4. I) I) Briefly describe the two major goals of this paper. (2 pts)
Problem 1: Clustering (33 points) Problem Set 4 Microarray and DNA chip technologies have made it possible to study expression patterns of thousand of genes simultaneously. The amount of data coming out
More informationRepresentation in Supervised Machine Learning Application to Biological Problems
Representation in Supervised Machine Learning Application to Biological Problems Frank Lab Howard Hughes Medical Institute & Columbia University 2010 Robert Howard Langlois Hughes Medical Institute What
More informationSupplementary Information
Supplementary Information promotes cancer cell invasion and proliferation by receptor-mediated endocytosis-dependent and -independent mechanisms, respectively Kensaku Shojima, Akira Sato, Hideaki Hanaki,
More informationMCB 102 University of California, Berkeley August 11 13, Problem Set 8
MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without
More informationIntroduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics
Introduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics abedi777@ymail.com Outlines Technology Basic concepts Data analysis Printed Microarrays In Situ-Synthesized
More informationMotif Finding: Summary of Approaches. ECS 234, Filkov
Motif Finding: Summary of Approaches Lecture Outline Flashback: Gene regulation, the cis-region, and tying function to sequence Motivation Representation simple motifs weight matrices Problem: Finding
More information