Supplementary Information
|
|
|
- Colin Bond
- 6 years ago
- Views:
Transcription
1 Supplementary Information promotes cancer cell invasion and proliferation by receptor-mediated endocytosis-dependent and -independent mechanisms, respectively Kensaku Shojima, Akira Sato, Hideaki Hanaki, Ikuko Tsujimoto, Masahiro Nakamura 2, Kazunari Hattori 3, Yuji Sato 4, Keiji Dohi 4, Michinari Hirata 4, Hideki Yamamoto, and Akira Kikuchi, Department of Molecular Biology and Biochemistry, Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita , Japan. 2 Diagnostics Division, 3 Department of Informatics & Structure-based Drug Discovery, 4 Department of Oncology & Immunology, Discovery Research Laboratory for Innovative Frontier Medicines, Shionogi & Co., Ltd. -, Futaba-cho 3-chome, Toyonaka, , Japan. Correspondence author. Department of Molecular Biology and Biochemistry, Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita , Japan. Phone: Fax: akikuchi@molbiobc.med.osaka-u.ac.jp.
2 Supplementary Figure legends Figure S. Generation of anti- rat monoclonal antibody. (A) KKLS cells treated with 25 µg/ml Fab fragments (#4, #6, #8, #4, #6, #2, #27, or #3) or pab5a-5 were subjected to the invasion assay. Relative invasion activities were expressed as percentages of PBS-treated control cells. (B) MKN-45 cells stably expressing the neomycin resistance gene (MKN-45/control) or (MKN-45/) were subjected to the invasion assay in the presence of Fab fragments or pab5a-5. Relative invasion activity was expressed as the percentages of the invasion observed by MKN-45/control cells treated with PBS. (C) The amount of purified bound to mab5a6 or pab5a-5 was detected by ELISA. Relative intensities were expressed as arbitrary units. (D) Top panel, the indicated concentrations of were incubated with control IgG or Fz2CRD-IgG coated on a 96-well plate; the amount of bound was detected by ELISA. Bottom panel, (5 ng/ml) was incubated with control IgG or Fz2CRD-IgG in the presence or absence of 25 µg/ml control Ab, mab5a6, or µg/ml sfrp2, and then the amount of bound was detected by ELISA. Relative intensities were expressed as arbitrary units. Results are shown as the mean ± SE of three independent experiments., P <.5. Figure S2. and Wnt receptor expression levels in HeLaS3, A549, and Calu-6 cells used in this study. (A) mrna levels of the indicated genes in cancer cells were examined by semi-quantitative RT-PCR analyses. Results are shown as the fold change compared with mrna levels in MKN-45 cells (left panel) and shown as the fold increase compared with mrna levels in KKLS cells (right four panels). 2
3 (B-D) Lysates of HeLaS3 cells (B), A549 cells (C), and Calu-6 cells (D) transfected with the indicated sirnas were probed with the indicated antibodies. HSP9 is used as a loading control. (E) Lysates of HeLaS3 cells stably expressing the neomycin resistance gene (Control#2) or (#8 or #9) were probed with the indicated antibodies. (F) Lysates of Control#2 or #8 cells transfected with indicated sirnas were probed with the indicated antibodies. (G) Lysates of A549 cells stably expressing GFP or were probed with the indicated antibodies. (H and I) mrna levels of the indicated genes in HeLaS3 cells (H) and A549 cells (I) transfected with the indicated sirnas were examined by semi-quantitative RT-PCR analyses. Results are shown as the mean ± SE of three independent experiments., P <.5. Figure S3. signaling is involved in migration and invasion of HeLaS3 and A549 cells. HeLaS3 and A549 cells transfected with the indicated sirnas were subjected to the migration (A and C) and invasion (B) assays. Relative migration and invasion activities were expressed as percentages of those in control cells. Results are shown as the mean ± SE of three independent experiments., P <.5. Figure S4. is required for cell proliferation in KYSE-7 and TE- cells. (A) mrna levels in various cancer cells were examined by semi-quantitative RT-PCR analysis. Results are shown as the fold increase compared with mrna levels in HeLaS3 cells. (B) Lysates from KYSE-7 cells and TE- cells transfected with # sirna were probed with the indicated antibodies. (C) KYSE-7 cells (left panel) and TE- cells (right panel) transfected with the # sirna were subjected to the proliferation assay. 3
4 Results are shown as the mean ± SE of three independent experiments., P <.5. Figure S5. Labelling of with AlexaFluor 546. (A and B) Purified (4 pmol) was incubated with (+) or without (-) 2 pmol (A) or 8 pmol (B) of AlexaFluor 546. Labelled (+) or -unlabelled (-) was stained with Coomassie Brilliant Blue (CBB, left top panel) or detected by a fluorescence image analyzer (right top panel). NIH3T3 cells were stimulated with the indicated concentration of labelled () or unlabelled (), and lysates were then probed with anti-dvl2 antibody (bottom panel). (C) Colocalization of with the internalized FLAG-Fz2 was expressed as the percentages of total puncta of the internalized FLAG-Fz2 in HeLaS3 cells. Results are shown as the mean ± SE of three independent experiments. Figure S6. Blockade of clathrin-dependent receptor endocytosis suppresses Fz2 internalization in HeLaS3 cells stably expressing. (A) After transient expression of FLAG-Fz2, HeLaS3 cells stably expressing the neomycin resistance gene (Control#2) or (#8) were pre-treated with 25 µg/ml anti-gst antibody (control Ab) or mab5a6 for 6 min at 4 C; then the cells were transferred to a heated chamber (37 C) for 6 min. The representative confocal images (left panels) and quantification of internalized FLAG-Fz2 (right panels) are shown. (B) Control#2 or #8 expressing FLAG-Fz2 were pre-treated with 7.5 µm MDC for 48 h for 6 min at 4 C; then the cells were transferred to a heated chamber (37 C) for 6 min. Results are shown as the mean ± SE of three independent experiments. Scale bars, µm., P <.5. Figure S7. is not required for AKT, PKC, and JNK activities but SFK activities. 4
5 (A) Lysates of HeLaS3 cells stably expressing or transfected with sirnas were probed with the indicated antibodies. (B) Lysates of HeLaS3, A549, and Calu-6 cells were probed with the indicated antibodies. (C) HeLaS3 cells were transfected with the indicated sirnas, and lysates were then probed with the indicated antibodies. (D) A549 (left top panels) and Calu-6 (right top panels) cells were transfected with the indicated sirnas, and lysates were then probed with the indicated antibodies. Band intensities of p-sfk at the position of Tyr46 were normalized with band intensities of total Src in each lane (bottom panels). Results are shown as the fold increase compared with the intensity in control cells. (E) A549 cells stably expressing GFP or (left panels) and Calu-6 cells (right panels) were treated with or without MDC for 48 h, and lysates were then probed with the indicated antibodies. Results are shown as the mean ± SE of three independent experiments. Figure S8. Full scan images of immunoblots presented in Figure 2. (A) Full scan images of immunoblots in Figure 2c. (B) Full scan images of immunoblots in Figure 2d. Long exposure (top panel) and short exposure (bottom panel) are shown. Figure S9. Full scan images of immunoblots presented in Figure 4b. Long exposure (top panel) and short exposure (bottom panel) are shown. Figure S. Full scan images of immunoblots presented in Figure 5c. Short exposure (top panel) and long exposure (bottom panel) are shown. Figure S. Full scan images of immunoblots presented in Figure 6. 5
6 (A) Full scan images of immunoblots in Figure 6a. (B) Full scan images of immunoblots in Figure 6b Figure S2. Full scan images of immunoblots presented in Figure 6. (A) Full scan images of immunoblots in Figure 6d. (B) Full scan images of immunoblots in Figure 6e. 6
7 Shojima et al., Figure S A KKLS B 5 MKN45/neo MKN-45/control MKN45/wnt5a MKN-45/ Relative invasion (%) Relative invasion (%) C Relative intensity (arbitrary units) 2 Fab Abs mab5a6 pab5a Purified (µg/ml) D Relative intensity (arbitrary units) Relative intensity (arbitrary units) (-) Fab Abs Control IgG Fz2CRD-IgG 5 (ng/ml) Control IgG Fz2CRD-IgG
8 Shojima et al., Figure S2 A mrna expression (log fold change). mrna expression (fold increase) 5 (x 3 ) Ror Ror2 Fz2 Fz B C D E HSP HSP9 HeLaS3 A549 F Control#2 #8 G HSP HSP9 HeLaS3 A H HSP9 Calu-6 mrna expression (fold increase) HeLaS3 Ror HSP9 HeLaS3 Ror2 Fz Fz6 I mrna expression (fold increase).5 A549 Ror Fz2 Fz6
9 Shojima et al., Figure S3 A Relative migration (%) HeLaS A549 B Relative invasion (%) HeLaS A549 C Relative migration (%) HeLaS A549
10 Shojima et al., Figure S4 A B mrna expression (fold increase) 2 HSP9 KYSE-7 TE C Cell number ( 5 ) KYSE-7 sicontrol 6 si# Days TE- sicontrol si# Days
11 Shojima et al., Figure S5 A Alexa B Alexa C Dvl2 (ng/ml) (ng/ml) NIH3T3 CBB staining Fluorescence image 37 9 Dvl2 CBB staining Fluorescence image (ng/ml) (ng/ml) NIH3T Internalized /FLAG-Fz2 (%)
12 Shojima et al., Figure S6 A mab5a6 Control Ab Control#2 min, 4 C 6 min, 37 C FLAG-Fz2 #8 min, 4 C 6 min, 37 C Distribution pattern of Fz2 (% of cells expressing Fz2) Control Ab mab5a6 Incubation Cell surface Cell surface/punctate Punctate C 4 C 37 C 37 C Control# C 4 C 37 C 37 C #8 B MDC Control Control#2 min, 4 C 6 min, 37 C FLAG-Fz2 #8 min, 4 C 6 min, 37 C Distribution pattern of Fz2 (% of cells expressing Fz2) MDC Incubation Cell surface Cell surface/punctate Punctate C 4 C 37 C 37 C Control# C 4 C 37 C 37 C #8
13 Shojima et al., Figure S7 A B p-akt Total AKT p-pkc PKCα p-jnk Total JNK HSP9 HeLaS3 D Src 6 Fyn 59 Yes 6 HSP9 9 C p-sfk Src Fyn HSP9 9 HeLaS3 p-sfk Total Src Clathrin 6 p-sfk 6 Total Src 8 Clathrin p-sfk/total Src (fold increase).5 A549 p-sfk/total Src (fold increase).5 Calu-6 E Treatment p-sfk Total Src 6 6 Treatment p-sfk Total Src 6 6 p-sfk/total Src (fold increase) 2 A549 p-sfk/total Src (fold increase).5 Calu-6
14 Shojima et al., Figure S8 A (Figure 2c) B (Figure 2d) (5ng/ml) min Control Ab mab5a Control mab5a6 (ng/ml) Cell surface Ror Active Rac 25 (Long exposure) 25 Control mab5a6 (ng/ml) Total Ror Total Rac 25 (Short exposure)
15 Shojima et al., Figure S9 Figure 4b Control mab5a6 (ng/ml) Active Rac (Long exposure) Control mab5a6 (ng/ml) Total Rac 25 5 (Short exposure)
16 Figure 5c Control MDC (ng/ml) Shojima et al., Figure S Active Rac 25 (Short exposure) Control MDC (ng/ml) Total Rac 25 (Long exposure)
17 Shojima et al., Figure S A (Figure 6a) B (Figure 6b) Treatment p-sfk p-sfk Total Src Total Src 5 Clathrin 25 5
18 Shojima et al., Figure S2 A (Figure 6d) sicontrol sifz2 B (Figure 6e) Control#2 #8 #9 sifz6 siror/ p-sfk p-sfk Total Src Total Src
19 Table S. Small interfering RNA (sirna) used in this study Target genes Target Sequences Randomized control CAGTCGCGTTTGCGACTGG CTGTGGATAACACCTCTGT (#) CCAAGCTATTTGGAAGCTT (#2) Ror GTACTGCGATGAAACTTCA Ror2 GGATTACAGAGGAACGGCA Fz2 CGGTCTACATGATCAAATA Fz6 GGTTCCACCTTGTCGTAAA Src CCTTCCTGGAGGACTACTT Fyn GGGATGATATGAAAGGAGA
20 Table S2. Forward and reverse primers for real-time RT-PCR used in this study Primer Ror Ror2 Fz2 Fz6 GAPDH Sequence CTTCGCCCAGGTTGTAATTGAAGC CTGCCAAAAACAGAGGTGTTATCC CAAGGAGGTGGTTTCTTCCA ATTTCACATTCATCGCGACA TGTGTGACGTACCCTCGTGT TGTCCTTCAGCGTTTTGATG GAGCGTGATTGTGCTG GCTCTGGGTAGCGGAA TTCCCTAATCTGATGGGTC TTCAAGCTCCTCAGGC CCTGTTCGACAGTCAGCCG CGACCAAATCCGTTGACTCC
Journal of Cell Science Supplementary Material
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal
Coleman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
GFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
supplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
Supplemental Data Supplementary Figure Legends and Scheme Figure S1.
Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,
Supplement Figure 1. Plin5 Plin2 Plin1. KDEL-DSRed. Plin-YFP. Merge
Supplement Figure 1 Plin5 Plin2 Plin1 KDEL-DSRed Plin-YFP Merge Supplement Figure 2 A. Plin5-Ab MitoTracker Merge AML12 B. Plin5-YFP Cytochrome c-cfp merge Supplement Figure 3 Ad.GFP Ad.Plin5 Supplement
Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1.
Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Percent of original fluorescence was plotted as a function of time following photobleaching
HCT116 SW48 Nutlin: p53
Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates
Supplementary Information
Supplementary Information Live imaging reveals the dynamics and regulation of mitochondrial nucleoids during the cell cycle in Fucci2-HeLa cells Taeko Sasaki 1, Yoshikatsu Sato 2, Tetsuya Higashiyama 1,2,
Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover
Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and
SureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
Hossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
Intestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by. Regulating Occludin
Intestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by Regulating Occludin Chaithanya Chelakkot 1,ǂ, Jaewang Ghim 2,3,ǂ, Nirmal Rajasekaran 4, Jong-Sun Choi 5, Jung-Hwan
TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure
Cell-Based ELISA Sampler Kit for detecting phospho-erk1/2 (pthr 202 /ptyr 204 ), phospho-jnk (pthr 183 /ptyr 185 ), and phospho-p38 MAPK (pthr 180 /ptyr 182 ) in cultured cell lines adequate for 192 assays
ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
Supplemental Materials and Methods
Supplemental Materials and Methods 125 I-CXCL12 binding assay KG1 cells (2 10 6 ) were preincubated on ice with cold CXCL12 (1.6µg/mL corresponding to 200nM), CXCL11 (1.66µg/mL corresponding to 200nM),
Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
CytoGLOW. IKK-α/β. Colorimetric Cell-Based ELISA Kit. Catalog #: CB5358
CytoGLOW IKK-α/β Colorimetric Cell-Based ELISA Kit Catalog #: CB5358 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only.
Supplementary Material. TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the. ERK1/2 signaling pathway
Supplementary Material TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the ERK1/2 signaling pathway Cui Zhang 1, Fan-Fan Hong 1, Cui-Cui Wang 1, Liang Li 1, Jian-Ling Chen
INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807
INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended
Isolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
SUPPLEMENTARY INFORMATION
doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8
Supplementary Figure 1. Isolation of GFPHigh cells.
Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding
Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2
Molecular Cell, Volume 65 Supplemental Information The TRAIL-Induced Cancer Secretome Promotes a Tumor-Supportive Immune Microenvironment via CCR2 Torsten Hartwig, Antonella Montinaro, Silvia von Karstedt,
EGFR (Phospho-Ser695)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely
Application Note AN001
Testing hybridoma supernatants with the Spots On Dots Antibody Screening Kit Application Note AN1 Table of Contents Overview... 2 Figure 1. Screening of hybridomas raised against peptide antigens... 3
Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics
Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected
Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and the
Focus Application. Cell Migration. Featured Study: Inhibition of Cell Migration by Gene Silencing. xcelligence System Real-Time Cell Analyzer
xcelligence System Real-Time Cell Analyzer Focus Application Cell Migration Featured Study: Inhibition of Cell Migration by Gene Silencing Markus Greiner and Richard Zimmermann Department of Medical Biochemistry
Real-time 96-well antibody internalization assays using IncuCyte FabFluor Red Antibody Labeling Reagent
Nicola Bevan, Tim Dale, Del Trezise Essen BioScience Welwyn Garden City, Hertfordshire, UK Introduction Monoclonal antibodies are now widely used as anti-cancer, antiinflammatory and anti-viral therapeutic
Supporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
Supplemental Information. HEXIM1 and NEAT1 Long Non-coding RNA Form. a Multi-subunit Complex that Regulates. DNA-Mediated Innate Immune Response
Molecular Cell, Volume 67 Supplemental Information HEXIM1 and NEAT1 Long Non-coding RNA Form a Multi-subunit Complex that Regulates DNA-Mediated Innate Immune Response Mehdi Morchikh, Alexandra Cribier,
Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer
Author's response to reviews Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer Authors: Hannah Jörißen (hannah.joerissen@molbiotech.rwth-aachen.de)
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative
Immunological Techniques in Research and Clinical Medicine. Philip L. Cohen, M.D. Chief of Rheumatology, LKSOM 10 March 2016
Immunological Techniques in Research and Clinical Medicine Philip L. Cohen, M.D. Chief of Rheumatology, LKSOM 10 March 2016 Antibodies Remarkable Tools for Research and Diagnosis You can make an antibody
Int. J. Mol. Sci. 2016, 17, 1259; doi: /ijms
S1 of S5 Supplementary Materials: Fibroblast-Derived Extracellular Matrix Induces Chondrogenic Differentiation in Human Adipose-Derived Mesenchymal Stromal/Stem Cells in Vitro Kevin Dzobo, Taegyn Turnley,
Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing
Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Chase L. Beisel, Yvonne Y. Chen, Stephanie J. Culler, Kevin G. Hoff, & Christina
Please read manual carefully before starting experiment
RayBio Cell-Based Phosphorylation ELISA Kit - Preliminary For the semi-quantitative detection of both phosphorylated and pan human, mouse or rat proteins in adherent whole cell lines. User Manual (Revised
Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer
Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer containing 10% serum The data error bars indicate means
Xfect Protein Transfection Reagent
Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection
Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1
Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 4.52E-18 PDK1 6.77E-18 CSRP2 4.42E-17 PFKP 1.23E-14 MSH2 3.79E-13 NARF_A 5.56E-13 ADFP 5.56E-13 FAM13A1 1.56E-12 FAM29A_A 1.22E-11 CA9 1.54E-11
Chemically defined conditions for human ipsc derivation and culture
Nature Methods Chemically defined conditions for human ipsc derivation and culture Guokai Chen, Daniel R Gulbranson, Zhonggang Hou, Jennifer M Bolin, Victor Ruotti, Mitchell D Probasco, Kimberly Smuga-Otto,
FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.
Instruction manual RNA-direct SYBR Green Realtime PCR Master Mix 0810 F0930K RNA-direct SYBR Green Realtime PCR Master Mix Contents QRT-201T QRT-201 0.5mLx2 0.5mLx5 Store at -20 C, protected from light
Sapphire. Biomolecular Imager THE NEXT GENERATION OF LASER-BASED IMAGING
Sapphire Biomolecular Imager THE NEXT GENERATION OF LASER-BASED IMAGING Breakthrough image capture and analysis The Sapphire Biomolecular Imager is a next generation laser scanning system that provides
SANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
Multiplex Fluorescence Assays for Adherence Cells without Trypsinization
Multiplex Fluorescence Assays for Adherence Cells without Trypsinization The combination of a bright field and three fluorescent channels allows the Celigo to perform many multiplexed assays. A gating
Amersham * ECL * Gel horizontal electrophoresis system
GE Healthcare Life Sciences Data file 28-9970-20 AB Electrophoresis products Amersham * ECL * Gel horizontal electrophoresis system Amersham ECL Gel and Amersham ECL Gel Box constitute a horizontal mini-gel
RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit
RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit Catalog #: PEL-Stat3-Y705 User Manual Last revised August 10, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and
A) B) Ladder. Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical
A) B) Ladder C) r4 r4 Nt- -Ct 78 kda Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical calpains is shown. The protease core consists of
Confocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)
BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9
of Medicine, Zhejiang University, Hangzhou, Zhejiang , China Michigan, 4424B MS-1, 1301 Catherine Street, Ann Arbor, MI 48109, USA.
Supplemental figure legends: Neddylation inhibitor MLN4924 suppresses growth and migration of human gastric cancer cells Huiyin Lan 1,2#, Zaiming Tang 1#, Hongchuan Jin 2, and Yi Sun 1,3,4* 1 Institute
42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2)
SUPPLEMENTAL DATA Supplementary Experimental Procedures Fluorescence Microscopy - A Zeiss Axiovert 200M microscope equipped with a Zeiss 100x Plan- Apochromat (1.40 NA) DIC objective and Hamamatsu Orca
Supplementary Information
Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on
RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit
RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit Catalog #: PEL-Stat3-Y705-T User Manual Last revised October 10, 2017 Caution: Extraordinarily useful information enclosed ISO
Silencer Select Pre-designed sirna Silencer Select Validated sirna Silencer Select Custom Designed sirna Custom Select sirna
Catalog #: Various Silencer Select Pre-designed sirna Silencer Select Validated sirna Silencer Select Custom Designed sirna Custom Select sirna General Product Details and User Information Refer to page
pgbkt7 Anti- Myc AH109 strain (KDa) 50
pgbkt7 (KDa) 50 37 Anti- Myc AH109 strain Supplementary Figure 1. Protein expression of CRN and TDR in yeast. To analyse the protein expression of CRNKD and TDRKD, total proteins extracted from yeast culture
FRAUNHOFER IME SCREENINGPORT
FRAUNHOFER IME SCREENINGPORT Detection technologies used in drug discovery Introduction Detection technologies in drug discovery is unlimited only a biased snapshot can be presented Differences can presented
by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL
Supplementary Materials and methods Neuronal cultures and transfection The hippocampus was dissected from E8 rat embryos, dissociated, and neurons plated onto glass coverslips coated with poly-ornithine
Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility
Cell Chemical Biology, Volume 24 Supplemental Information A Versatile Tool for Live-Cell Imaging and Super-Resolution Nanoscopy Studies of HIV-1 Env Distribution and Mobility Volkan Sakin, Janina Hanne,
Transport of Potato Lipoxygenase into the Vacuole Larsen, Mia Kruse Guldstrand; Welinder, Karen Gjesing; Jørgensen, Malene
Aalborg Universitet Transport of Potato Lipoxygenase into the Vacuole Larsen, Mia Kruse Guldstrand; Welinder, Karen Gjesing; Jørgensen, Malene Publication date: 2009 Document Version Publisher's PDF, also
mir-24-mediated down-regulation of H2AX suppresses DNA repair
Supplemental Online Material mir-24-mediated down-regulation of H2AX suppresses DNA repair in terminally differentiated blood cells Ashish Lal 1,4, Yunfeng Pan 2,4, Francisco Navarro 1,4, Derek M. Dykxhoorn
Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A
Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Contacts: Marty Simonetti martysimonetti@gmail.com Kirby Alton kirby.alton@abeomecorp.com Rick Shimkets
Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand
SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin
Supplemental Material for
Supplemental Material for TXI TELNGIECTSI MUTTED (TM)-MEDITED DN DMGE RESPONSE IN OXIDTIVE STRESS-INDUCED VSCULR ENDOTHELIL CELL SENESCENCE Hong Zhan 1, Toru Suzuki 1,2, Kenichi izawa 1, Kiyoshi Miyagawa,
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα
Supplementary Material. Levels of S100B protein drive the reparative process in acute muscle injury and muscular dystrophy
Supplementary Material Levels of protein drive the reparative process in acute muscle injury and muscular dystrophy Francesca Riuzzi 1,4 *, Sara Beccafico 1,4 *, Roberta Sagheddu 1,4, Sara Chiappalupi
Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
Abstract. PLOS ONE 1 August 2014 Volume 9 Issue 8 e103651
Fine-Tuning of Smad Protein Function by Poly(ADP- Ribose) Polymerases and Poly(ADP-Ribose) Glycohydrolase during Transforming Growth Factor b Signaling Markus Dahl 1. a, Varun Maturi 1., Peter Lönn 1.
Supplemental Material to: SRam Sripad, Dongyoung Kim, Raimund Ober, E. Sally Ward
Landes Bioscience www.landesbioscience.com Supplemental Material to: SRam Sripad, Dongyoung Kim, Raimund Ober, E. Sally Ward The level of HER2 expression is a predictor of antibody- HER2 trafficking behavior
TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure
Cell-Based ELISA Kit for detecting phospho-stat3 (ptyr 705 ) in cultured cell lines adequate for 96 assays (1 96 well plate) Catalog Number RAB0444 Storage Temperature 20 C TECHNICAL BULLETIN Product Description
3. Results. 3.1 Generation of HEK293 cell clones stably expressing ETA and ETB receptors
3. Results 3.1 Generation of HEK293 cell clones stably expressing ETA and ETB receptors To investigate the dimerisation of the endothelin receptor subtypes HEK293 cells were stably transfected with plasmids
ab G alpha i Activation Assay Kit
ab173234 G alpha i Activation Assay Kit Instructions for Use For the simple and fast measurement of G alpha i activation. This product is for research use only and is not intended for diagnostic use. Version
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/157/ra4/dc1 Supplementary Materials for Genome-Wide RNAi Screen Reveals Disease-Associated Genes That Are Common to Hedgehog and Wnt Signaling Leni S. Jacob,
Rat IGF-1 ELISA Kit (rigf-1-elisa)
Rat IGF-1 ELISA Kit (rigf-1-elisa) Cat. No. EK0377 96 Tests in 8 x 12 divisible strips Background Insulin-like growth factor 1 (IGF-1), also known as somatomedin C, is a polypeptide protein hormone similar
GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual
GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000
RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit
RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit Catalog #: TFEH-p65 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,
Center Drive, University of Michigan Health System, Ann Arbor, MI
Leukotriene B 4 -induced reduction of SOCS1 is required for murine macrophage MyD88 expression and NFκB activation Carlos H. Serezani 1,3, Casey Lewis 1, Sonia Jancar 2 and Marc Peters-Golden 1,3 1 Division
Supplementary Figure Legend
Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss
Roche Molecular Biochemicals Technical Note No. LC 9/2000
Roche Molecular Biochemicals Technical Note No. LC 9/2000 LightCycler Optimization Strategy Introduction Purpose of this Note Table of Contents The LightCycler system provides different detection formats
The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit
Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline
Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System
Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,
ReverTra Ace qpcr RT Master Mix
Instruction manual ReverTra Ace qpcr RT Master Mix 1203 F1173K ReverTra Ace qpcr RT Master Mix FSQ-201 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Protocol 1. RNA template
Meso Scale Discovery Applications
A Suite of Assays to Detect hosphorylated Receptor Tyrosine Kinases Associated with Neoplasia Timothy S. Schaefer, Jane Zhang, Sean Higgins, Laura K. Schaefer, Robert M. Umek and Jacob N. Wohlstadter Reversible
Strategies to Improve Drug Tolerance in Nab Assays
Strategies to Improve Drug Tolerance in Nab Assays Steven J Swanson, PhD Senior Vice President, Research ImmunoCellular Therapeutics Ltd steven.swanson@imuc.com AAPS National Biotech Conference June 2015
RayBio Phospho- Akt (Ser473) ELISA Kit
RayBio Phospho- Akt (Ser473) ELISA Kit For Measuring Phosphorylated Akt (Ser473) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Akt (Ser473) ELISA Kit Protocol (Cat#: PEL-Akt-S473-001)
Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.
Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice
Purification of alpha-1 antitrypsin using an antibody based affinity chromatography medium
Purification of alpha-1 antitrypsin using an antibody based affinity chromatography medium Ulrika Meyer a, Hanna Wlad a, Sven Blokland b, Frank J.M. Detmers b and Henrik Ihre a a GE Healthcare Bio-Sciences
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1