Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation
|
|
- Gerald Chase
- 6 years ago
- Views:
Transcription
1 SUPPLEMENTAL DATA Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation Magalí Nazar, Juan Pablo Nicola, María Laura Vélez, Claudia Gabriela Pellizas, Ana María Masini- Repiso. SUPPLEMENTAL TABLE 1: Primers and probes information A. Primer sets used for RT-qPCR and ChIP assays Designation Primer Sequence (5 to 3 ) TPO (F) GCATGTATCATTGGGAAGCA (R) CGGTGTTGTCACAGATGACC Amplicon Size (bp) Intron Spanning Sequences (bp) qpcr Efficiencies % β-actin (F) GGCACCACACTTTCTACAATG (R) TGGCTGGGGTGTTGAAGGT % ChIP P1 (F) GGAGCGAGAACTGGTGAAGG (R) CTAGGGTCACCCACATAGGTTC 92 (-369/-277 # ) 101% ChIP P2 (F) CTGCTTTCTATGAGTGGCACC (R) CTCTCTGGAGACTTGGTTACC 163 (-163/-53 # ) 99% B. Primer sets used for construction of ptpo κb Primer Sequence (5 to 3 ) (F) AGGGTACCAGACTGCTTTCTA (R) TCTGCTAGCCACACAGACCAGTAATG C. Primers used for Site-directed Mutagenesis for construction of ptpo κbm Primer Sequence (5 to 3 ) (F) TGGGATGAACTAGAAATATAGGATAAGATAAACACACAGGAACC TATGTGGGTG (R) CACCCACATAGGTTCCTGTGTGTTTATCTTATCCTATATTTCTAGT TCATCCCA 1
2 D. Oligonucleotides used for EMSA Designation Primer Sequence (5 to 3 ) Location TPO κb TPO κbm TPO Z TPO Zm TPO B TPO Bm (F) GGATAAGAGAAACTCCCAGGAACC (R) gctatggttcctgggagtttctcttatcc (F) GGATAAGGAGAACCTTCAGGAACC (R) gctatggttcctgaaggttctccttatcc (F) ACAAATACTAAACAAACAGAATGG (R) gctatccattctgtttgtttagtatttgt (F) ACAATAATCAAACAACAGAATGG (R) gctatccattctgttgtttgattattgt (F) CACACAAGCACTTGGCAGAAACAA (R) gctatttgtttctgccaagtgcttgtgtg (F) CACACAAGCACGGTCCAGAAACAA (R) gctatttgtttctggaccgtgcttgtgtg -318/-294 # -155/-131 # -175/-151 # # Positions given are relative to TPO transcription start site. Shaded nucleotides represent introduced desired mutations. Lower case sequences represent a non-native short 3 overhang addition for α- 32 P-dATP fill-in labeling reaction mediated by Klenow (EMSA assays). Underlined sequences indicated restriction enzimes sites used for subcloning into pgl3-basic. 2
3 Supplemental Figure 1. LPS increases TSH-induced binding of TTF-1 and TTF-2 to B and Z sites in the TPO promoter. Nuclear proteins were isolated from FRTL-5 cells treated with TSH (0.5 miu/ml) or TSH + LPS (100 ng/ml) for 1 h. EMSA was performed with 32 P-labeled oligonucleotide corresponding to the TTF-1 binding site B (probe TPO-B) or TTF-2 consensus site Z (probe TPO-Z) described in the TPO promoter. A, Representative EMSA assay demonstrating that LPS increased 3
4 TSH-induced TTF-1 recruitment to region B (lanes 2 and 5). Specificity was tested by performing competition experiments in the presence of a 100-fold excess of cold TPO-B (lanes 3 and 6). Incubations done in the presence of an anti-ttf-1 antibody decreased shifted complex (lanes 4 and 7). B, Representative EMSA assay showing that LPS increased TSH-induced TTF-2 binding to region Z (lanes 2 and 5). Band shift specificity was demonstrated by conducting competition assays with 100-fold excess of cold oligonucleotide Z (lanes 3 and 6). The presence of TTF-2 in the shifted complex was accomplished using an anti-ttf-2 antibody (lanes 4 and 7). NS, nonspecific. 4
5 Supplemental Figure 2. LPS increases TTF-1 and TTF-2 nuclear levels. Starved FRTL-5 cells were treated with TSH (0.5 miu/ml) in presence or absence of LPS (100 ng/ml) for 1h and then harvested for nuclear-cytoplasmic protein preparation. Representative Western blot of cytoplasmic and nuclear extracts (40μg) showing TTF-1 and TTF-2 levels. Nuclear recruitment of p65 was evaluated as positive control of LPS action. Histone H1 was used to correct loading differences in nuclear extracts. α-tubulin was assess to exclude cytoplasmic contaminants in nuclear extracts. 5
6 Supplemental Figure 3. p38 activation does not affect p65 nuclear translocation. A, Representative Western blot of whole proteins obtained from FRTL-5 cells treated after starvation as indicated in the figure for 30 min. Histone H1 staining was used to correct loading differences. Densitometric analysis was carried out to determine the relative nuclear level increase of p65 normalized to Histone H1. B, Relative activity of an artificial NF-κB-responsive vector containing five κb sites in tandem linked to Luc (5x κb-luc) after the indicated stimulus for 24 h in presence or absence of p38 inhibitor (SB μm), which was added to the culture medium 1 h before treatment. Results are expressed as Luc activity normalized to β-galactosidase and relative to basal activity for each construct. #, P < 0.05 vs. basal; **, P < 0.01 vs. TSH (ANOVA; Student-Newman- Keuls). 6
Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More informationSite-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter
Supplement Supporting Materials and Methods Site-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter were independently generated using a two-step PCR method. The Smad4 binding site
More informationLegend for Supplemental Figures and Tables
Legend for Supplemental Figures and Tables Supplemental Fig. 1. Negative regulation of the CYP27B1 promoter in a ligand-dependent manner (A) OK-P cells were transfected with pcdna-trα, pcdna-trβ1 or pcdna3
More informationElectrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were. oligonucleotide spanning the NF-kB site (5 -GATCC-
SUPPLEMENTARY MATERIALS AND METHODS Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were prepared as previously described. (1) A [ 32 P] datp-labeled doublestranded oligonucleotide spanning
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
More informationSupplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA
More informationCell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
More informationEstradiol-Estrogen Receptor α Mediates the Expression of the CXXC5 Gene through the Estrogen Response Element-Dependent Signaling Pathway
Estradiol-Estrogen Receptor α Mediates the Expression of the CXXC5 Gene through the Estrogen Response Element-Dependent Signaling Pathway Pelin Yaşar, Gamze Ayaz and Mesut Muyan SUPPLEMENTARY INFORMATION
More informationSupplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.
Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. (a) Transfection of different concentration of GAS5-overexpressing
More informationLi et al., Supplemental Figures
Li et al., Supplemental Figures Fig. S1. Suppressing TGM2 expression with TGM2 sirnas inhibits migration and invasion in A549-TR cells. A, A549-TR cells transfected with negative control sirna (NC sirna)
More informationGenomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two
Supplemental Materials and Methods Genomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two upstream regions of the human Klf9 gene (-5139 to -5771 bp and -3875 to -4211 bp)
More informationTranscriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death
SUPPLEMENTAL DATA Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death Huajun Jin 1, Arthi Kanthasamy 1, Vellareddy Anantharam
More informationSUPPLEMENTARY MATERIALS
SUPPLEMENTARY MATERIALS Supplementary Table S1: List of primers used for ChIP analysis and Oligo-pull-down assay. Genes Sequence mppargc1a FW 5 -GCGAGGTTTCTGCTTAGTCA-3 (-2317) RV 5 -ACAATGACTAAGCAGAAACCTCG-3
More informationTable 1. Primers, annealing temperatures, and product sizes for PCR amplification.
Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Gene Direction Primer sequence (5 3 ) Annealing Temperature Size (bp) BRCA1 Forward TTGCGGGAGGAAAATGGGTAGTTA 50 o C 292
More informationSupplementary Figure 1 Validate the expression of mir-302b after bacterial infection by northern
Supplementary Figure 1 Validate the expression of mir-302b after bacterial infection by northern blot. Northern blot analysis of mir-302b expression following infection with PAO1, PAK and Kp in (A) lung
More informationRayBio Human NF-κB p65 Transcription Factor Activity Assay Kit
RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit Catalog #: TFEH-p65 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,
More information(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower
Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/291/ra78/dc1 Supplementary Materials for Regulation of Yeast G Protein Signaling by the Kinases That Activate the AMPK Homolog Snf1 Sarah T. Clement, Gauri Dixit,
More information8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and
1 Supplemental information 2 3 Materials and Methods 4 Reagents and animals 5 8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and 6 Silencer Select Pre-designed sirna
More informationB. C. Staurosporine BEZ235 DMSO. -actin. Suppl. Fig. 1 BEZ235 and BGT226 inhibit phosphorylation of Akt and downstream targets of PI3K and mtor.
DMSO Staurosporine BGT226 A. B. C. BGT226 P-Akt 0 1 2 4 8 hrs. P-Akt 0 5 10 25 50 100 nm PS6 P-4E-BP1 -actin C-Caspase3 -actin PS6 P-4E-BP1 -actin Suppl. Fig. 1 and BGT226 inhibit phosphorylation of Akt
More informationTable S1. Primers used in RT-PCR studies (all in 5 to 3 direction)
Table S1. Primers used in RT-PCR studies (all in 5 to 3 direction) Epo Fw CTGTATCATGGACCACCTCGG Epo Rw TGAAGCACAGAAGCTCTTCGG Jak2 Fw ATCTGACCTTTCCATCTGGGG Jak2 Rw TGGTTGGGTGGATACCAGATC Stat5A Fw TTACTGAAGATCAAGCTGGGG
More informationSupplemental Data. Sethi et al. (2014). Plant Cell /tpc
Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes
More informationSupplementary Table, Figures and Videos
Supplementary Table, Figures and Videos Table S1. Oligonucleotides used for different approaches. (A) RT-qPCR study. (B) qpcr study after ChIP assay. (C) Probes used for EMSA. Figure S1. Notch activation
More informationSUPPLEMENTARY INFORMATION
(Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).
More informationSupplemental Data. Seo et al. (2014). Plant Cell /tpc
Supplemental Figure 1. Protein alignment of ABD1 from other model organisms. The alignment was performed with H. sapiens DCAF8, M. musculus DCAF8 and O. sativa Os10g0544500. The WD40 domains are underlined.
More informationHPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,
1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung
More informationFig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector.
Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector. (a) Western blotting analysis and (b) qpcr analysis of eif6 expression in HEK293 T cells transfected with either
More informationSupplementary Information
Supplementary Information Sam68 modulates the promoter specificity of NF-κB and mediates expression of CD25 in activated T cells Kai Fu 1, 6, Xin Sun 1, 6, Wenxin Zheng 1, 6, Eric M. Wier 1, Andrea Hodgson
More informationNature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.
Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements
More informationb alternative classical none
Supplementary Figure. 1: Related to Figure.1 a d e b alternative classical none NIK P-IkBa Total IkBa Tubulin P52 (Lighter) P52 (Darker) RelB (Lighter) RelB (Darker) HDAC1 Control-Sh RelB-Sh NF-kB2-Sh
More information3 P p25. p43 p41 28 FADD. cflips. PE-Cy5 [Fluorescence intensity]
L S p4 3 D3 76 N S L Ve ct or p4 3 D3 76 N S L Ve ct or A aspase 8 FADD TRAF2 D95-R - + Vector D95L TL I S L D376N T RAIL-R1 T RAIL-R2 D95-R E-y5 [Fluorescence intensity] Supplemental Fig. 1 Different
More informationSomatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb
Cell Reports Supplemental Information Somatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb Hirotsugu Ishizu, Yuka W. Iwasaki, Shigeki Hirakata, Haruka Ozaki, Wataru Iwasaki,
More informationFig Hypoxia causes growth retardation and developmental delay. (A) Morphology of wildtype zebrafish embryos at 48 hours post fertilization
FIGURES AND TABLES Fig. 1-1. Hypoxia causes growth retardation and developmental delay. (A) Morphology of wildtype zebrafish embryos at 48 hours post fertilization (hpf) after 24 h of normoxia or hypoxia
More informationTable S1. Nucleotide sequences of synthesized oligonucleotides for quantitative
Table S1. Nucleotide sequences of synthesized oligonucleotides for quantitative RT-PCR For CD8-1 transcript, forward primer CD8-1F 5 -TAGTAACCAGAGGCCGCAAGA-3 reverse primer CD8-1R 5 -TCTACTAAGGTGTCCCATAGCATGAT-3
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible
More informationA novel mechanism of post-translational modulation of HMGA functions by the histone chaperone nucleophosmin.
A novel mechanism of post-translational modulation of HMGA functions by the histone chaperone nucleophosmin. Laura Arnoldo 1,#, Riccardo Sgarra 1,#, Eusebio Chiefari 2, Stefania Iiritano 2, Biagio Arcidiacono
More informationData Supplement Plasmin Triggers Cytokine Induction in Human Monocyte-Derived Macrophages
Data Supplement Plasmin Triggers Cytokine Induction in Human Monocyte-Derived Macrophages Qun Li, Yves Laumonnier, Tatiana Syrovets, and Thomas Simmet Methods Antibodies and Reagents Antibodies for immunoblotting:
More informationSUPPLEMENTARY INFORMATION
Figure S1: Activation of the ATM pathway by I-PpoI. A. HEK293T cells were either untransfected, vector transfected, transfected with an I-PpoI expression vector, or subjected to 2Gy γ-irradiation. 24 hrs
More informationSupplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and
Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationSupplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
More informationSupplementary Material for: p53-dependent expression of CXCR5 chemokine receptor in MCF-7 breast cancer cells
Supplementary Material for: p53-dependent expression of CXCR5 chemokine receptor in MCF-7 breast cancer cells Nikita A Mitkin 1, Christina D Hook 1, Anton M Schwartz 1, Subir Biswas 2, Dmitry V Kochetkov
More informationSUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION
SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune
More informationSupplemental materials
Supplemental materials Materials and methods for supplemental figures Yeast two-hybrid assays TAP46-PP2Ac interactions I. The TAP46 was used as the bait and the full-length cdnas of the five C subunits
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationAt E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
More informationtranscription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,
Supplementary Data Supplementary Figure Legends Supplementary Figure 1 FHL-mediated TGFβ-responsive reporter transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected
More informationEngineering splicing factors with designed specificities
nature methods Engineering splicing factors with designed specificities Yang Wang, Cheom-Gil Cheong, Traci M Tanaka Hall & Zefeng Wang Supplementary figures and text: Supplementary Figure 1 Supplementary
More informationFig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
More informationSupplementary Figure 1.
Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed
More informationp53 increases MHC class I expression by upregulating the endoplasmic reticulum aminopeptidase ERAP1
Supplementary Information p53 increases MHC class I expression by upregulating the endoplasmic reticulum aminopeptidase ERAP1 Bei Wang 1, Dandan Niu 1, Liyun Lai 1, & Ee Chee Ren 1,2 1 Singapore Immunology
More informationA Repressor Complex Governs the Integration of
Developmental Cell 15 Supplemental Data A Repressor Complex Governs the Integration of Flowering Signals in Arabidopsis Dan Li, Chang Liu, Lisha Shen, Yang Wu, Hongyan Chen, Masumi Robertson, Chris A.
More informationmonoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in
Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal
More informationSupplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.
Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of
More informationSupplementary information
Supplementary information Supplementary Figure 1 (a) EM image of the pyramidal layer of wt mice. CA3 pyramidal neurons were selected according to their typical alignment, size and shape for subsequent
More informationFile name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo
More informationSupplemental Figure 1
Supplemental Fig. 1. Kinetics of,,, AKT and ERK activation in BMMCs following SCF stimulation. Starved BMMCs were stimulated with 250ng/mL of SCF for the indicated time. Soluble Cell Lysates (SCLs) were
More informationSupplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto
Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in
More informationSupplemental Figure legends Figure S1. (A) (B) (C) (D) Figure S2. Figure S3. (A-E) Figure S4. Figure S5. (A, C, E, G, I) (B, D, F, H, Figure S6.
Supplemental Figure legends Figure S1. Map-based cloning and complementation testing for ZOP1. (A) ZOP1 was mapped to a ~273-kb interval on Chromosome 1. In the interval, a single-nucleotide G to A substitution
More informationFig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of
Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/198/ra74/dc1 Supplementary Materials for Short RNA Duplexes Elicit RIG-I Mediated Apoptosis in a Cell Type and Length-Dependent Manner Osamu Ishibashi, Md. Moksed
More informationSupplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray
More information/04/$15.00/0 Molecular Endocrinology 18(3): Copyright 2004 by The Endocrine Society doi: /me
0888-8809/04/$15.00/0 Molecular Endocrinology 18(3):588 605 Printed in U.S.A. Copyright 2004 by The Endocrine Society doi: 10.1210/me.2003-0090 Increased Cytochrome P450 17 -Hydroxylase Promoter Function
More informationSupplementary Data Supplementary Figures
Supplementary Data Supplementary Figures Supplementary Figure 1. Pi04314 is expressed during infection, each GFP-Pi04314 fusion is stable and myr GFP-Pi04314 is removed from the nucleus while NLS GFP-Pi04314
More informationSupplementary Materials
Supplementary Materials Construction of Synthetic Nucleoli in Human Cells Reveals How a Major Functional Nuclear Domain is Formed and Propagated Through Cell Divisision Authors: Alice Grob, Christine Colleran
More informationSupplemental Material Igreja and Izaurralde 1. CUP promotes deadenylation and inhibits decapping of mrna targets. Catia Igreja and Elisa Izaurralde
Supplemental Material Igreja and Izaurralde 1 CUP promotes deadenylation and inhibits decapping of mrna targets Catia Igreja and Elisa Izaurralde Supplemental Materials and methods Functional assays and
More informationSupplemental Table S1. RT-PCR primers used in this study
Supplemental Table S1. RT-PCR primers used in this study -----------------------------------------------------------------------------------------------------------------------------------------------
More informationRayBio Human jun-b Transcription Factor Activity Assay Kit
RayBio Human jun-b Transcription Factor Activity Assay Kit Catalog #: TFEH-JUNB User Manual Mar 28, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,
More informationSupplementary Figure 1. Nur77 and leptin-controlled obesity. (A) (B) (C)
Supplementary Figure 1. Nur77 and leptin-controlled obesity. (A) Effect of leptin on body weight and food intake between WT and KO mice at the age of 12 weeks (n=7). Mice were i.c.v. injected with saline
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3164 Supplementary Figure 1 Validation of effective Gnas deletion and epithelial thickness. a, Representative genotyping in mice treated or not with tamoxifen to show Gnas deletion. To
More informationAlpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by
Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by down-regulating PKA and CREB activation Sudha Saryu Malhotra 1, Pankaj Suman 2 and Satish Kumar Gupta 1 * 1 Reproductive
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Validation of CDK9-inhibitor treatment.
Supplementary Figure 1 Validation of CDK9-inhibitor treatment. (a) Schematic of GAPDH with the middle of the amplicons indicated in base pairs. The transcription start site (TSS) and the terminal polyadenylation
More informationSupplementary Information
Supplementary Information MED18 interaction with distinct transcription factors regulates plant immunity, flowering time and responses to hormones Supplementary Figure 1. Diagram showing T-DNA insertion
More informationRayBio Human GATA-3 Transcription Factor Activity Assay Kit
RayBio Human GATA-3 Transcription Factor Activity Assay Kit Catalog #: TFEH-GATA3 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,
More informationRayBio Human c-myc Transcription Factor Activity Assay
RayBio Human cmyc Transcription Factor Activity Assay Catalog #: TFEHCMYC User Manual Sept 20, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 18884948555 (Toll Free) or 7707292992, Fax: 7702062393
More informationFigure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
More informationSupplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with
Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with concentration of 800nM) were incubated with 1mM dgtp for the indicated
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationsupplementary information
DOI: 10.1038/ncb2116 Figure S1 CDK phosphorylation of EZH2 in cells. (a) Comparison of candidate CDK phosphorylation sites on EZH2 with known CDK substrates by multiple sequence alignments. (b) CDK1 and
More informationNature Genetics: doi: /ng.3556 INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE. Supplementary Figure 1
INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE Supplementary Figure 1 REF6 expression in transgenic lines. (a,b) Expression of REF6 in REF6-HA ref6 and REF6ΔZnF-HA ref6 plants detected by RT qpcr (a) and immunoblot
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Thompson et al., http://www.jcb.org/cgi/content/full/jcb.200909067/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Modification-specific antibodies do not detect unmodified
More informationJung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh
Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon
More information1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA.
Supplemental data: 1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA. Strategy#1: 20nt at both sides: #1_BglII-Fd primer : 5 -gga
More informationhnrnp C promotes APP translation by competing with FMRP for APP mrna recruitment to P bodies
hnrnp C promotes APP translation by competing with for APP mrna recruitment to P bodies Eun Kyung Lee 1, Hyeon Ho Kim 1, Yuki Kuwano 1, Kotb Abdelmohsen 1, Subramanya Srikantan 1, Sarah S. Subaran 2, Marc
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1154040/dc1 Supporting Online Material for Selective Blockade of MicroRNA Processing by Lin-28 Srinivas R. Viswanathan, George Q. Daley,* Richard I. Gregory* *To whom
More informationSupplemental Data. Sun et al. Plant Cell. (2012) /tpc FLS2 -cmyc -GFP FLS2 -HA. FLS2-FLAG FLS2 -HA BAK1-HA flg22 (10mM)
Supplemental Data. Sun et al. Plant ell. ()..5/tpc..9599 A FLS-FLA FLS -HA BAK-HA flg (mm) - B FLS -cmyc -FP FLS -HA IP antibody cmyc FLA FP cmyc IP ; WB: α-ha IP; WB: α-ha IP: α-fla; WB: α-ha IP ; WB:
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID protein kinase N1 PKN1 Human The protein encoded by this gene belongs to the protein
More informationSupplemental Data. Hu et al. Plant Cell (2017) /tpc
1 2 3 4 Supplemental Figure 1. DNA gel blot analysis of homozygous transgenic plants. (Supports Figure 1.) 5 6 7 8 Rice genomic DNA was digested with the restriction enzymes EcoRⅠ and BamHⅠ. Lanes in the
More informationKhaled_Fig. S MITF TYROSINASE R²= MITF PDE4D R²= Variance from mean mrna expression
Khaled_Fig. S Variance from mean mrna expression.8 2 MITF.6 TYROSINASE.4 R²=.73.2.8.6.4.2.8.6.4.2.8.6.4.2 MALME3M SKMEL28 UACC257 MITF PDE4D R²=.63 4.5 5 MITF 3.5 4 PDE4B 2.5 3 R²=.2.5 2.5.8.6.4.2.8.6.4.2
More informationSupplementary Fig.1. Over-expression of RNase L in stable polyclonal cell line
Supplemental Data mrna Protein A kda 75 40 NEO/vector NEO/RNase L RNASE L β-actin RNASE L β-actin B % of control (neo vector), normalized 240 ** 200 160 120 80 40 0 Neo Neo/RNase L RNase L Protein Supplementary
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2271 Supplementary Figure a! WM266.4 mock WM266.4 #7 sirna WM266.4 #10 sirna SKMEL28 mock SKMEL28 #7 sirna SKMEL28 #10 sirna WM1361 mock WM1361 #7 sirna WM1361 #10 sirna 9 WM266. WM136
More informationPost-translational modification
Protein expression Western blotting, is a widely used and accepted technique to detect levels of protein expression in a cell or tissue extract. This technique measures protein levels in a biological sample
More informationSupplemental Figure 1.
Supplemental Data. Charron et al. Dynamic landscapes of four histone modifications during de-etiolation in Arabidopsis. Plant Cell (2009). 10.1105/tpc.109.066845 Supplemental Figure 1. Immunodetection
More informationConstruction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
More informationRayBio Human FRA-2 Transcription Factor Activity Assay Kit
RayBio Human FRA-2 Transcription Factor Activity Assay Kit Catalog #: TFEH-FRA2 User Manual May 2, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,
More informationSupplemental material
Supplemental material THE JOURNAL OF CELL BIOLOGY Taylor et al., http://www.jcb.org/cgi/content/full/jcb.201403021/dc1 Figure S1. Representative images of Cav 1a -YFP mutants with and without LMB treatment.
More informationSupplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide,
Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, conjugated with either TAT or Myristic acid and biotin for
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11070 Supplementary Figure 1 Purification of FLAG-tagged proteins. a, Purification of FLAG-RNF12 by FLAG-affinity from nuclear extracts of wild-type (WT) and two FLAG- RNF12 transgenic
More informationData Sheet GITR / NF-ĸB-Luciferase Reporter (Luc) - Jurkat Cell Line Catalog #60546
Data Sheet GITR / NF-ĸB-Luciferase Reporter (Luc) - Jurkat Cell Line Catalog #60546 Description This cell line expresses a surface human GITR (glucocorticoid-induced TNFR family related gene; TNFRSF18;
More information